Work at SourceForge, help us to make it a better place! We have an immediate need for a Support Technician in our San Francisco or Denver office.

Close

#269 bowtie2 line 413 argument isn't numeric

v0.9.0
closed
Val
bowtie (175)
5
2014-02-17
2013-01-22
Michael Dickens
No

for the latest version bowtie2-2.0.5/bowtie2 the following error message appears for each read. This wasn't happening in earlier bowtie2 versions for the our same datasets and comands used:

bowtie2 -f -p 2 -k 1 --very-sensitive --un-conc unaligned_reads/101_files -x genome_file -1 bowtie_out/101.pair1 -2 bowtie_out/101.pair2 -U bowtie_out/101.singletons -S bowtie_out/101.sam

Argument ">@NINA_0030:7:1:19416:1020#0/1%0AGGTGGCTTTGGTTGTATGGGTAG..." isn't numeric in bitwise and (&) at /usr/local/bioinfosoft/bowtie2-2.0.5/bowtie2 line 413, <BT> line 13.
Argument ">@NINA_0030:7:1:19416:1020#0/2%0AATTACTCTTATCTTTTTCTTTTT..." isn't numeric in bitwise and (&) at /usr/local/bioinfosoft/bowtie2-2.0.5/bowtie2 line 413, <BT> line 15.
Argument ">@NINA_0030:7:1:6896:1022#0/1%0ATATAGAGTTTAGTAGGCGTATAAA..." isn't numeric in bitwise and (&) at /usr/local/bioinfosoft/bowtie2-2.0.5/bowtie2 line 413, <BT> line 17.
Argument ">@NINA_0030:7:1:6896:1022#0/2%0ACTATAGAGTTTAATAGTTCGCTTA..." isn't numeric in bitwise and (&) at /usr/local/bioinfosoft/bowtie2-2.0.5/bowtie2 line 413, <BT> line 19.
Argument ">@NINA_0030:7:1:12832:1025#0/2%0ACAGTTTCCCACAATCGTCTCATT..." isn't numeric in bitwise and (&) at /usr/local/bioinfosoft/bowtie2-2.0.5/bowtie2 line 413, <BT> line 21.

Discussion

  • This error is happening when the fasta header has a @ after the > such as:
    >@NINA_0030:8:1:3487:1035#0/1
    AACGTTTAGCCGCTATAAATTAATTATCCCTATAGTAACTTTTTAGTACT

     
  • Val
    Val
    2014-02-17

    The error does not happen anymore. However, the '@' sign cannot be part of the output since this will be against the SAM output format specifications.

    Val

     
  • Val
    Val
    2014-02-17

    • status: open --> closed
    • assigned_to: Val
    • Group: --> v0.9.0