Download Latest Version
TraRECo_v084_c_src_for_linux_x86_64_fix.tar.gz (55.3 MB)
Get an email when there's a new version of TraRECo
| Name | Modified | Size | Downloads / Week |
|---|---|---|---|
| TraRECo_v084_c_src_for_linux_x86_64_fix.tar.gz | 2018-09-08 | 55.3 MB | |
| TraRECo_c_version_readme.txt | 2018-09-07 | 3.2 kB | |
| TraRECo_v084_c_src_for_linux.tar.gz | 2018-07-16 | 55.6 MB | |
| TraRECo_v067_matlab_only.zip | 2017-11-13 | 54.0 MB | |
| trareco_v067_pkg_for_windows.exe | 2017-10-31 | 425.3 MB | |
| TraRECo_v067.zip | 2017-10-31 | 54.0 MB | |
| readme.txt | 2017-10-31 | 2.6 kB | |
| Totals: 7 Items | 644.2 MB | 0 |
TraRECo - A de novo transcriptome assembler with read error correction
Version 0.8.4
by Seokhyun Yoon, 2018.09.07
===== Licensing and Contact =====
1. TraRECo is distributed under a GPL 3.0 license
(https://www.gnu.org/licenses/gpl-3.0-standalone.html)
2. Contact for inquiries and/or bug report: syoon@dku.edu
===== Building and running TraRECo =====
The C/C++ source provided here were developed using ECLIPSE
and can be compiled in both Linux and Windows enviroment.
1. Building TraRECo
(1) extract TraRECo_vxxx.tar.gz
(2) change directory (cd) to TraRECo_vxxx by typing "cd TraRECo_vxxx (enter)"
(3) build executable by typing "make (enter)".
(4) If successful, an executable named "TraRECo" will be created.
2. Testing TraRECo
(1) Type "./TraRECo (enter)"
(2) You can see some options to run TraRECo
3. Running TraRECo example
(1) Find "trareco_example.sh" in the current directory.
(2) Type "./trareco_example.sh (ebter)" to run TraRECo example
(The sample data and reference transcriptome are in the directory "sample_data")
(For evaluation, you need the standalone version of BLASTN installed in your computer.)
* The standalone version of BLASTN is available at https://www.ncbi.nlm.nih.gov/guide/howto/run-blast-local/
4. Output files
The resulting transcriptome file(s) will be created at the directory (folder) you specified by "-outdir" with its name given by xxx_MinCvgDepth_y.fasta, where xxx is the file name prefix you specified by "-prefix" option and y (e.g., 4) is the coverage depth threshold of the transcripts contained in the file, i.e., the file contains only those transcript candidates whose estimated coverage depth is equal to or greater than y.
5. Checking out the final assembly results in xxx_MinCvgDepth_y.fasta
The file is basically a FASTA file with header line and base sequences pair, as shown below.
>T_3_21_1_1_33.000000 3 21 33.000000 68 214710 214711
CTGATTTTCCCAAAGAATTAAAGCGATGAAGGGAGAAGACAAGATTCTTTCACCCCCTTTAAAAAAAA
>T_4_22_1_1_66.000000 4 22 66.000000 66 214710 214711
CAAAGAATTAAAGCGATGAAGGGAGAAGACAAGATTCTTTCACCCCCTTTTCTTCATCAGAAAAAA
:
As shown above, the header line contains seven items: the first item is a string representing (candidate) Transcript ID with a prefix "T_" (or "I_") and the last 6 items are all numbers representing respectively the transcript/isoform id. number, group id., estimated abundance (average read coverage depth), length of the sequence, the number of reads used in the assembly and the number of reads provided by the input file(s), where only the estimated abundance is in floating point number while all others are integer number.
Some (candidate) Transcripts may share the same group index, which means they are from the same sub-graph and, hopefully, isoforms from the same gene. Note, however, that some of genes can be merged into one sub-graph due to sequence repeats (paraloguous gene) among different genes and/or similar sequence contained in many different genes. Note also that the transcript/isoform ID contains some of the information mentioned below delimited by "_", which is useful when you run BLAST as the transcript ID will be shown as query sequence id.
================================
