Menu
▾
▴
Re: [Samtools-help] Fwd: samtools view -r
|
From: Heng Li <lh...@sa...> - 2011-09-28 15:48:50
|
That all depends on how you merge files. Heng On Sep 28, 2011, at 11:38 AM, Michael Lindberg wrote: > I figured out the problem, apparently in a merged file, the file name goes in place of the RG:Z: rather than the true read group, is this intended? > > Begin forwarded message: > >> From: Michael Lindberg <mik...@gm...> >> Date: September 28, 2011 11:13:38 AM EDT >> To: sam...@li... >> Subject: samtools view -r >> >> I believe that the samtools view -r option in the most recent release no longer works as expected. >> >> >> shared/bin/samtools-0.1.7/samtools view test.bam -r ERR000027 | head >> ERR000027.95 177 1 234402626 0 45M 4 148280096 0 TTTTTTTTTTTTTTTTTTATTGATCATTCTTGGGTGTTTCTCGCA ;<=>>????@@@@@AAA?@AA?@?@@A??@@>><?<??==<5;=9 XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:92 XM:i:0 XO:i:0 XG:i:0 MD:Z:45 OQ:Z:II;5IIII8IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII >> ERR000027.95 113 4 148280096 37 45M 1 234402626 0 CACGAGAGACCATATGTTGTATATTTCTATTTATGTGAAATGTCC 782:=;><<9==<>?<??<=?>?@@>>=???=>>;>=<<=>:<:: XT:A:U NM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:45 OQ:Z:AI5IIIIIIEIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII >> >> >> /shared/bin/samtools1.18 view NA19239.discordants.readSorted.bam -r ERR000027 >> #produces nothing >> >> /shared/bin/samtools1.16 view NA19239.discordants.readSorted.bam -r ERR000027 >> #produces nothing >> >> >> Thanks, >> Mike > > ------------------------------------------------------------------------------ > All the data continuously generated in your IT infrastructure contains a > definitive record of customers, application performance, security > threats, fraudulent activity and more. Splunk takes this data and makes > sense of it. Business sense. IT sense. Common sense. > http://p.sf.net/sfu/splunk-d2dcopy1_______________________________________________ > Samtools-help mailing list > Sam...@li... > https://lists.sourceforge.net/lists/listinfo/samtools-help -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. |