Re: [Samtools-help] Reference Name with Colon

[Lucas S. <lsw...@bc...>]

Will ReplaceSamHeader work on a bam file? Or would I need to convert bam 
to sam, use ReplaceSamHeader, then convert sam back to bam?

~Thanks,
Lucas

Alec Wysoker wrote:
> Hi Lucas,
>
> In BAM, the alignment records do not have reference names.  They have 
> indices into a table in the header.  The list of reference sequences 
> is represented in two ways in the header.  There is a binary 
> representation, and there is (optionally) a text representation.  I 
> don't know how you created your BAM, but it has at least one of these. 
>
> This is what you can do:
>
>    1. Use Picard's ViewSam command to dump the BAM to text.  You can
>       pipe this into 'head' in order to grab the header lines rather
>       than converting the entire BAM to text.
>    2. Edit the header that ViewSam dumped, fixing the reference
>       sequence names.
>    3. Pass the file containing the header to ReplaceSamHeader with the
>       HEADER= option.
>
> -Alec
>
> Lucas Swanson wrote:
>> Hi Alec,
>>
>> Will that replace the reference names in each alignment record 
>> though? I do not think the .bam file I am using has a header section.
>>
>> ~Thanks,
>> Lucas
>>
>> Alec Wysoker wrote:
>>> Hi Lucas,
>>>
>>> You can use ReplaceSamHeader from the Picard package, but despite 
>>> the name, it does not replace the header in place, but writes out a 
>>> new file with the header you supply.
>>>
>>> -Alec
>>>
>>> Lucas Swanson wrote:
>>>> Thanks, but is there a quick and simple way to change all the 
>>>> reference names in my 7gig .bam file to use dashes rather than colons?
>>>>
>>>> ~Lucas
>>>>
>>>>
>>>> Michael James Clark wrote:
>>>>  
>>>>> In short: no. But there is a solution that will make it work.
>>>>>
>>>>> Replace the colon with a dash. I'm guessing your FASTA reference 
>>>>> genome
>>>>> contig names had colons in them. You should not use FASTA files 
>>>>> with colons.
>>>>>
>>>>> The colon doesn't work because samtools uses the colon to signify 
>>>>> the end of
>>>>> the contig name.
>>>>> E.g.:
>>>>> samtools view in.bam chr1:1000-2000.
>>>>>
>>>>> In your case, once you change the colons to dashes:
>>>>>
>>>>> samtools view in.bam k31-100019:1000-2000
>>>>>
>>>>> Hope that helps.
>>>>>
>>>>> MJ
>>>>>
>>>>>
>>>>> On 4/26/10 5:47 PM, "Lucas Swanson" <lsw...@bc...> wrote:
>>>>>
>>>>>      
>>>>>> I am having some trouble viewing reads aligned to a region and 
>>>>>> think it
>>>>>> might be because my reference names have a colon in them, e.g.
>>>>>> "k31:1000019".
>>>>>>
>>>>>> So the command I am giving and the output is:
>>>>>> [lswanson@lucass01 orphan_info]$ ./samtools view 
>>>>>> full_test_orphan.bam
>>>>>> "k31:1000019"
>>>>>> [bam_header_read] EOF marker is absent.
>>>>>> [main_samview] fail to get the reference name. Continue anyway.
>>>>>>
>>>>>> If I just do:
>>>>>> [lswanson@lucass01 orphan_info]$ ./samtools view 
>>>>>> full_test_orphan.bam |
>>>>>> head -n1
>>>>>> [bam_header_read] EOF marker is absent.
>>>>>> SOLEXA3_96:5:6:1385:2018        73      k31:1000019     1       23
>>>>>> 50M    =1       0
>>>>>> GGTATGAATGCCCTCGCCGAAGCACGCCACATCACCAGTAGAAGCCATCT
>>>>>> @B8@@ABB@@;86?29/9>:<6:?.<29=8%%%%%%%%%%%%%%%%%%%%      XT:A:U  
>>>>>> NM:i:1
>>>>>> SM:i:23 AM:i:0 X0:i:1   X1:i:4  XM:i:1  XO:i:0  XG:i:0  MD:Z:33T16
>>>>>>
>>>>>> So I know that there is at least one read mapping to the 
>>>>>> reference named
>>>>>> "k31:1000019".
>>>>>>
>>>>>> Is there any way to get the reads aligned to a reference with a 
>>>>>> colon in
>>>>>> the reference name?
>>>>>>
>>>>>> ~Thanks,
>>>>>> Lucas Swanson
>>>>>>
>>>>>> ------------------------------------------------------------------------------ 
>>>>>>
>>>>>> _______________________________________________
>>>>>> Samtools-help mailing list
>>>>>> Sam...@li...
>>>>>> https://lists.sourceforge.net/lists/listinfo/samtools-help
>>>>>>           
>>>>>       
>>>>
>>>>
>>>> ------------------------------------------------------------------------------ 
>>>>
>>>> _______________________________________________
>>>> Samtools-help mailing list
>>>> Sam...@li...
>>>> https://lists.sourceforge.net/lists/listinfo/samtools-help
>>>>   
>>