From: Adrian J. <ori...@gm...> - 2010-01-27 22:15:52
|
Hi: I was going to ask a similar question. What is: H3764@B5?:F8( F?4>@B;?4B76 G=C<>B>><F@> in the example that Jessica described below. Now my example: chr1 13106026 T C 98 114 37 30 c$c$c$c$cCcccccccccccccCCCCCccccAC GIIH0DF@>=HF7HHAFH8EHDB-GHHD2H My understanding: On chromosome 1 at position 13106026 , on reference there is T, however on 29 of 30 tags have C and 1/30 has A. c$c$c$c$cCcccccccccccccCCCCCccccAC - mean 4 tags has c end of read. Of 29 tags 7'C' are on forward strand. Whereas on others we see reverse complement 'c' (that is G originally). - Am i correct? Is samtools pileup format converts G to c for reverse strands (, strands)? Also what is - GIIH0DF@>=HF7HHAFH8EHDB-GHHD2H Could you please help me understand. A screen shot of my example: 13106031 13106041 13106051 TGTTTCGAGGGCACTACAGCCAGAGCAATGGGAGG C c c c c c, C.G c,,,, c,,,,, c,,,,,, c,,,,,, c,,,,,, c,,,,,,,,,,,,, c,,,,,,,,,,,,,, c,,,,,,,,,,,,,, c,,,,,,,,,,,,,, c,,,,,,,,,,,,,, c,,,,,,,,,,,,,, c,,,,,,,,,,,,,, c,,,,,,,,,,,,,,,,, C.................. C.................. C................... C................... C................... c,,,,,,,,,,,,,,,,,,,, c,,,,,,,,,,,,,,,,,,,, c,,,,,,,,,,,,,,,,,,,,, c,,,,,,,,,,,,,,,,,,,,,,,,,, A...................................... C..................A................... thank you. Adrian On Wed, Jan 27, 2010 at 11:44 AM, Heng Li <lh...@sa...> wrote: > This question has been raised several times. I know add it to FAQ: > > http://sourceforge.net/apps/mediawiki/samtools/index.php?title=SAM_FAQ#I_see_.60.2A.27_in_the_pileup_sequence_column._What_are_they.3F > > Heng > > On Wed, Jan 27, 2010 at 10:55:37AM -0500, Jessica Maia wrote: >> Hi there, >> >> I have a question about the indel file format. Here's the indel file line: >> >> 1 52102 * -AC/-AC 37 159 27 13 -AC * 3 9 1 >> >> In the 10th column in the indel file line is a (*) which is supposed to represent the second allele. Does the (*) refer to the reference allele? >> >> Here's the corresponding lines in the pileup file: >> 1 52102 T T 66 0 27 13 .,$.,,..,.,-2ac,-2ac,+2ac,-2ac H3764@B5?:F8( >> 1 52102 * -AC/-AC 37 159 27 13 -AC * 3 9 1 >> 1 52103 A A 54 0 26 12 ..,,..,.**,* F?4>@B;?4B76 >> 1 52104 C C 54 0 26 12 ..$,,..,.**,* G=C<>B>><F@> >> >> Thanks, >> >> Jessica >> >> >> ------------------------------------------------------------------------------ >> The Planet: dedicated and managed hosting, cloud storage, colocation >> Stay online with enterprise data centers and the best network in the business >> Choose flexible plans and management services without long-term contracts >> Personal 24x7 support from experience hosting pros just a phone call away. >> http://p.sf.net/sfu/theplanet-com >> _______________________________________________ >> Samtools-help mailing list >> Sam...@li... >> https://lists.sourceforge.net/lists/listinfo/samtools-help > > > -- > The Wellcome Trust Sanger Institute is operated by Genome Research > Limited, a charity registered in England with number 1021457 and a > company registered in England with number 2742969, whose registered > office is 215 Euston Road, London, NW1 2BE. > > ------------------------------------------------------------------------------ > The Planet: dedicated and managed hosting, cloud storage, colocation > Stay online with enterprise data centers and the best network in the business > Choose flexible plans and management services without long-term contracts > Personal 24x7 support from experience hosting pros just a phone call away. > http://p.sf.net/sfu/theplanet-com > _______________________________________________ > Samtools-help mailing list > Sam...@li... > https://lists.sourceforge.net/lists/listinfo/samtools-help > |