From: Nicole W. <NLW...@lb...> - 2009-09-29 22:36:41
|
Hi Tom, is this supposed to be a tab-delimited file? i thought it was a fasta? didn't it used to be a fasta (at least that's what i used to use)? what is the spec for this tab-delimited file? you are right that the spec does request "in.ref_list", as in samtools import <in.ref_list> <in.sam> <out.bam> but i don't see a definition of what this "in.ref_list" file format is in the documentation. do you have a suggestion? nicole On Sep 29, 2009, at 2:51 PM, Tom Blackwell wrote: > > Is it possible that in your call to samtools import, the first > argument is a fasta file for the worm genome, rather than a tab- > delimited file naming the five chromosomes and giving their > lengths ? See man samtools. > > - tom blackwell - > > On Tue, 29 Sep 2009, Nicole Washington wrote: > >> Hello, >> >> I did a little investigation... it seemed to be bugging out in some >> get_header function. So, just in case, I added a header to my >> L1.merged file (having a header was never a requirement before), >> similar to this (for all chromosomes): >> >> @SQ SN:I AS:WormBase WS190 LN:15072421 SP:Caenorhabditis elegans >> >> Now, when I added the header, the import command didn't seg fault! >> However, when I ran the tview, it did seg fault. >> >> samtools tview L1.bam.bai elegans.WS190.dna.fa >> >> when i did a backtrace in gdb, i got this: >> >> #0 0x08066924 in bam_fetch (fp=0x8f930f0, idx=0x8f93068, tid=0, >> beg=0, >> end=80, data=0x8f93008, func=0x8049f20 <tv_fetch_func>) at >> bam_index.c:556 >> #1 0x0804a0b9 in tv_draw_aln (tv=0x8f93008, tid=0, pos=0) at >> bam_tview.c:269 >> #2 0x0804acf5 in bam_tview_main (argc=3, argv=0xbff561b8) at >> bam_tview.c:402 >> #3 0x080563e9 in main (argc=4, argv=Cannot access memory at >> address 0x4 >> ) at bamtk.c:123 >> >> help? >> >> nicole >> >> >> Begin forwarded message: >> >>> From: Nicole Washington <NLW...@lb...> >>> Date: September 29, 2009 2:18:52 PM PDT >>> To: sam...@li... >>> Subject: seg fault on import >>> hi, >>> i'm trying to perform an import with worm fasta WS190, and i get a >>> segfault when running the import command: >>>> samtools import elegans.WS190.dna.fa L1.merged L1.bam >>> [sam_header_read2] 1000653 sequences loaded. >>> Segmentation fault (core dumped) >>> i thought maybe it was the blank lines in the fasta file, so i >>> removed those. but that didn't fix it. >>> i've tried this with all different versions of my sam file, and it >>> is still not working. i include a 10-line sam file at the bottom >>> of this email that i tried (L1.merged). i am running the latest >>> samtools (svn revision 469). >>> any ideas? >>> nicole >>> EX36I5J02G5DRG 0 V 9068340 0 27M * >>> 0 0 GATCAAAGAATACAATCTTCATTTTAC * AS:i:27 HI:i:1 >>> EX36I5J02G5X2V 0 I 13953063 0 >>> 16M1D59M1D39M * 0 0 >>> GATCGCCCGCAGACGCCTTCGGCTTCCCATCACTCCGAGTCCGAGGTCAAGAAGACCAGCAAGAAGTAAATACTGTGCTCGTTATTGTTTCCTAATGAAATTGTTGTTAAACAT >>> * AS:i:96 HI:i:1 >>> EX36I5J02GFGT4 0 X 60733 0 8M1D42M * >>> 0 0 GATCTTGGAAGCTCTAAATTGTTTTTGTTGGTAATAAAAACTTGTTATAC >>> * AS:i:35 HI:i:1 >>> EX36I5J02GFGT4 16 IV 4389136 0 42M1D8M * >>> 0 0 GTATAACAAGTTTTTATTACCAACAAAAACAATTTAGAGCTTCCAAGATC >>> * AS:i:35 HI:i:2 >>> EX36I5J02GNVZU 0 X 14978582 0 7M1D42M >>> * 0 0 >>> GATCCCGTTAATACTCTGTACGCTAAAGCATAAATAAAGACGATGTGTC * AS:i:38 >>> HI:i:1 >>> EX36I5J02GQ2EN 16 V 3978812 0 1S39M1D5M >>> * 0 0 GTGAGTTAATAAATTTCATTTCATGAATAAATATTTCGATGGATC >>> * AS:i:37 HI:i:1 >>> EX36I5J02I9M5J 16 IV 12390268 0 >>> 40M1D59M1D12M * 0 0 >>> AACCCCAACGACTTTATGTCGGAATAACAAGAACAACAAAATTTACGAACGTGGTCTCTCCTTCTTTCCCTTGAACAGGGCGATGAGGGAGGTGTTGGCACCTTCACGATC >>> * AS:i:93 HI:i:1 >>> EX36I5J02ILYM1 0 II 7106202 0 13M1D38M1S >>> * 0 0 >>> GATCTTCTGTTATGTTATTGTTCGCAGTTGTAATAAACAGTTGTGACTTTGT * AS:i:44 >>> HI:i:1 >> > |