Open source tools for next generation DNA sequencing analysis and visualization

Features

  • DNA sequence Analysis
  • Deep Sequencing Visualization
  • Genotype Frequency Analysis
  • Illumina Data Processing
  • Molecular Evolution

Project Activity

See All Activity >

Follow SEWAL

SEWAL Web Site

Other Useful Business Software
Host LLMs in Production With On-Demand GPUs Icon
Host LLMs in Production With On-Demand GPUs

NVIDIA L4 GPUs. 5-second cold starts. Scale to zero when idle.

Deploy your model, get an endpoint, pay only for compute time. No GPU provisioning or infrastructure management required.
Try Free
Rate This Project
Login To Rate This Project

User Ratings

★★★★★
★★★★
★★★
★★
1
0
0
0
0
ease 1 of 5 2 of 5 3 of 5 4 of 5 5 of 5 0 / 5
features 1 of 5 2 of 5 3 of 5 4 of 5 5 of 5 0 / 5
design 1 of 5 2 of 5 3 of 5 4 of 5 5 of 5 0 / 5
support 1 of 5 2 of 5 3 of 5 4 of 5 5 of 5 0 / 5

User Reviews

  • Sorry, was not logged in. Here I try again. Can you remove my first post? Thanks again for compiling Sewal for ubunto! Have couple questions about it: 1. Does Sewal only understand data in qseq format? I currently have different selection rounds as *.fa files and *.txt files. Our bioinformatician has already processed them (quality and barcode and correct length-sorting), can I do anything with it now using sewal? my txt files look like this: CTCCCCGTGGTTCCATTCTCCCCCTAGACATGTTGCCCTCATCCT 1 AGCCTTTTCCTTCTCGACTTTATGTCTTCCTGGCTTTTAAGCTAG 5 CTTCTGCCCGAACTGGCCCTCGCTCTACTTTCGGCGTCTCCACCT 3 2. What directory do you recommend to run sewal from? I'm currently running it from /usr/bin/. Where is default location for file output? Do you specify the location every time you process the file?
Read more reviews >

Additional Project Details

Registered

2010-04-26