SEWAL

Open source tools for next generation DNA sequencing analysis and visualization

Features

DNA sequence Analysis
Deep Sequencing Visualization
Genotype Frequency Analysis
Illumina Data Processing
Molecular Evolution

Project Activity

See All Activity >

Follow SEWAL

SEWAL Web Site

Other Useful Business Software

MongoDB Atlas runs apps anywhere

Deploy in 115+ regions with the modern database for every enterprise.

MongoDB Atlas gives you the freedom to build and run modern applications anywhere—across AWS, Azure, and Google Cloud. With global availability in over 115 regions, Atlas lets you deploy close to your users, meet compliance needs, and scale with confidence across any geography.

Start Free

Rate This Project

User Ratings

5.0 out of 5 stars

★★★★★

★★★★

★★★

★★

★

ease 1 of 5 2 of 5 3 of 5 4 of 5 5 of 5 0 / 5

features 1 of 5 2 of 5 3 of 5 4 of 5 5 of 5 0 / 5

design 1 of 5 2 of 5 3 of 5 4 of 5 5 of 5 0 / 5

support 1 of 5 2 of 5 3 of 5 4 of 5 5 of 5 0 / 5

User Reviews

Filter Reviews:

All

danmalysh Posted 2010-12-18

Sorry, was not logged in. Here I try again. Can you remove my first post? Thanks again for compiling Sewal for ubunto! Have couple questions about it: 1. Does Sewal only understand data in qseq format? I currently have different selection rounds as *.fa files and *.txt files. Our bioinformatician has already processed them (quality and barcode and correct length-sorting), can I do anything with it now using sewal? my txt files look like this: CTCCCCGTGGTTCCATTCTCCCCCTAGACATGTTGCCCTCATCCT 1 AGCCTTTTCCTTCTCGACTTTATGTCTTCCTGGCTTTTAAGCTAG 5 CTTCTGCCCGAACTGGCCCTCGCTCTACTTTCGGCGTCTCCACCT 3 2. What directory do you recommend to run sewal from? I'm currently running it from /usr/bin/. Where is default location for file output? Do you specify the location every time you process the file?