Download
Open source tools for next generation DNA sequencing analysis and visualization
Features
- DNA sequence Analysis
- Deep Sequencing Visualization
- Genotype Frequency Analysis
- Illumina Data Processing
- Molecular Evolution
Follow SEWAL
Other Useful Business Software
AI-generated apps that pass security review
Retool lets you generate dashboards, admin panels, and workflows directly on your data. Type something like “Build me a revenue dashboard on my Stripe data” and get a working app with security, permissions, and compliance built in from day one. Whether on our cloud or self-hosted, create the internal software your team needs without compromising enterprise standards or control.
Rate This Project
Login To Rate This Project
User Reviews
-
Sorry, was not logged in. Here I try again. Can you remove my first post? Thanks again for compiling Sewal for ubunto! Have couple questions about it: 1. Does Sewal only understand data in qseq format? I currently have different selection rounds as *.fa files and *.txt files. Our bioinformatician has already processed them (quality and barcode and correct length-sorting), can I do anything with it now using sewal? my txt files look like this: CTCCCCGTGGTTCCATTCTCCCCCTAGACATGTTGCCCTCATCCT 1 AGCCTTTTCCTTCTCGACTTTATGTCTTCCTGGCTTTTAAGCTAG 5 CTTCTGCCCGAACTGGCCCTCGCTCTACTTTCGGCGTCTCCACCT 3 2. What directory do you recommend to run sewal from? I'm currently running it from /usr/bin/. Where is default location for file output? Do you specify the location every time you process the file?
