Open source tools for next generation DNA sequencing analysis and visualization

Features

  • DNA sequence Analysis
  • Deep Sequencing Visualization
  • Genotype Frequency Analysis
  • Illumina Data Processing
  • Molecular Evolution

Project Activity

See All Activity >

Follow SEWAL

SEWAL Web Site

Other Useful Business Software
Gen AI apps are built with MongoDB Atlas Icon
Gen AI apps are built with MongoDB Atlas

The database for AI-powered applications.

MongoDB Atlas is the developer-friendly database used to build, scale, and run gen AI and LLM-powered apps—without needing a separate vector database. Atlas offers built-in vector search, global availability across 115+ regions, and flexible document modeling. Start building AI apps faster, all in one place.
Start Free
Rate This Project
Login To Rate This Project

User Ratings

★★★★★
★★★★
★★★
★★
1
0
0
0
0
ease 1 of 5 2 of 5 3 of 5 4 of 5 5 of 5 0 / 5
features 1 of 5 2 of 5 3 of 5 4 of 5 5 of 5 0 / 5
design 1 of 5 2 of 5 3 of 5 4 of 5 5 of 5 0 / 5
support 1 of 5 2 of 5 3 of 5 4 of 5 5 of 5 0 / 5

User Reviews

  • Sorry, was not logged in. Here I try again. Can you remove my first post? Thanks again for compiling Sewal for ubunto! Have couple questions about it: 1. Does Sewal only understand data in qseq format? I currently have different selection rounds as *.fa files and *.txt files. Our bioinformatician has already processed them (quality and barcode and correct length-sorting), can I do anything with it now using sewal? my txt files look like this: CTCCCCGTGGTTCCATTCTCCCCCTAGACATGTTGCCCTCATCCT 1 AGCCTTTTCCTTCTCGACTTTATGTCTTCCTGGCTTTTAAGCTAG 5 CTTCTGCCCGAACTGGCCCTCGCTCTACTTTCGGCGTCTCCACCT 3 2. What directory do you recommend to run sewal from? I'm currently running it from /usr/bin/. Where is default location for file output? Do you specify the location every time you process the file?
Read more reviews >

Additional Project Details

Registered

2010-04-26