mummer-help — For general MUMmer questions and help.

Re: [MUMmer-help] A clarification about NUCmer

[Govinda K. <gk...@be...>]

Hi Adam,

Thanks for the quick response. It helps a lot.

Regards,
Govinda.


On 6 February 2014 08:12, Adam Phillippy <aph...@gm...> wrote:

> Hi Govinda,
> There is no minimum percent identity threshold for Nucmer and no
> guarantees on what it will find. Instead, the sensitivity and quality of
> the alignments depends on the minimum match size and cluster parameters
> chosen. The closest thing to an identity threshold are the dynamic
> programming extension scores, which are set to +3/-7. This equates to a min
> avg identity of 70% for the DP algorithm to continue extending. However,
> Nucmer will rarely find these low identity alignments, because they will
> likely not be seeded. With default parameters, Nucmer is generally
> sensitive to alignments >90% idy.
>
> If you want to cap the alignments to a certain identity, after the fact,
> you can run delta-filter with the -i option to filter alignments below your
> desired threshold.
>
> Hope this helps,
> -Adam
>
>
>
> On Tue, Feb 4, 2014 at 3:32 PM, Govinda Kamath <gk...@be...>wrote:
>
>> Hi,
>>
>> In NUCmer, what is the default percent identity threshold, above which
>> results are reported in the out.delta file? Also what is the metric (like
>> Hamming distance or Edit distance) is this calculated in?
>>
>> Thanks,
>> Govinda.
>>
>>
>> ------------------------------------------------------------------------------
>> Managing the Performance of Cloud-Based Applications
>> Take advantage of what the Cloud has to offer - Avoid Common Pitfalls.
>> Read the Whitepaper.
>>
>> http://pubads.g.doubleclick.net/gampad/clk?id=121051231&iu=/4140/ostg.clktrk
>> _______________________________________________
>> MUMmer-help mailing list
>> MUM...@li...
>> https://lists.sourceforge.net/lists/listinfo/mummer-help
>>
>>
>

Re: [MUMmer-help] A clarification about NUCmer

[Adam P. <aph...@gm...>]

Hi Govinda,
There is no minimum percent identity threshold for Nucmer and no guarantees
on what it will find. Instead, the sensitivity and quality of the
alignments depends on the minimum match size and cluster parameters chosen.
The closest thing to an identity threshold are the dynamic programming
extension scores, which are set to +3/-7. This equates to a min avg
identity of 70% for the DP algorithm to continue extending. However, Nucmer
will rarely find these low identity alignments, because they will likely
not be seeded. With default parameters, Nucmer is generally sensitive to
alignments >90% idy.

If you want to cap the alignments to a certain identity, after the fact,
you can run delta-filter with the -i option to filter alignments below your
desired threshold.

Hope this helps,
-Adam



On Tue, Feb 4, 2014 at 3:32 PM, Govinda Kamath <gk...@be...> wrote:

> Hi,
>
> In NUCmer, what is the default percent identity threshold, above which
> results are reported in the out.delta file? Also what is the metric (like
> Hamming distance or Edit distance) is this calculated in?
>
> Thanks,
> Govinda.
>
>
> ------------------------------------------------------------------------------
> Managing the Performance of Cloud-Based Applications
> Take advantage of what the Cloud has to offer - Avoid Common Pitfalls.
> Read the Whitepaper.
>
> http://pubads.g.doubleclick.net/gampad/clk?id=121051231&iu=/4140/ostg.clktrk
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help
>
>

[MUMmer-help] A clarification about NUCmer

[Govinda K. <gk...@be...>]

Hi,

In NUCmer, what is the default percent identity threshold, above which
results are reported in the out.delta file? Also what is the metric (like
Hamming distance or Edit distance) is this calculated in?

Thanks,
Govinda.

[MUMmer-help] getting started

[<bl...@pa...>]

Hi,

I want to use your package to create several big contigs out of 1000+ short read
based on two closely related genomes. 
I wanted to know what the ideal workflow should be

Thank you,
M

[MUMmer-help] abascas and nucmer not running

[Hina D. <dal...@gm...>]

Hi

I am trying to run command

> perl abacas.1.3.1.pl -r reference.fasta -q query.fasta -p 'nucmer' -c -m
-b -o output.fasta

it is saying

Enter the directory for your nucmer executables [default ./]

I have provided abascas in my $PATH env variable. What should I Do?

Thanks

H

[MUMmer-help] Fwd: mummerplot not working

[Hina D. <dal...@gm...>]

Hello friends,

I am trying map my contigs onto a reference sequence.

But mummerplot is giving me error, which I am pasting here:


$ ./mummerplot -t postscript ref_qry.filter -R ref.fasta -Q qry.fna
gnuplot 4.0 patchlevel 0
Reading delta file ref_qry.filter
Writing plot files out.fplot, out.rplot
Writing gnuplot script out.gp
Rendering plot out.ps

gnuplot> set tics scale 0
                  ^
         "out.gp", line 4686: ';' expected

WARNING: Unable to run 'gnuplot out.gp', Inappropriate ioctl for device


ref.fatsa and qry.fna are my reference and query files in fasta format.
Please help.

Thanks in advance

Hina.

Re: [MUMmer-help] MUMmer installation on MacOS 10.9.1

[Adam P. <aph...@gm...>]

Hi Roberta,
Those message all look like compiler warnings that can be safely ignored.
Did the code compile successfully? If so, you should be able to run it
without problems.

Best,
-Adam


On Mon, Dec 23, 2013 at 9:31 AM, Roberta Rezende <rob...@ic...
> wrote:

>
>
>
> Hi everybody,
>
> I’m new in bioinformatics and I’m trying to follow some ways to do
> assemblies.
> I’m using MacOS 10.9.1 mavericks and I can’t install MUMmer. During
> installation process I have the following messages …
>
> Could you help me?
>
> Thank you in advance
>
>
> *combineMUMs.cc <http://combinemums.cc/>:109:27: **warning: **conversion
> from string literal to 'char *' is*
> *      deprecated [-Wdeprecated-writable-strings]*
> char  * Error_File_Name = DEFAULT_ERROR_FILE_NAME;
> *                          ^*
> *combineMUMs.cc <http://combinemums.cc/>:26:38: **note: *expanded from
> macro 'DEFAULT_ERROR_FILE_NAME'
> #define  DEFAULT_ERROR_FILE_NAME     "witherrors.gaps"
> *                                     ^*
> *combineMUMs.cc <http://combinemums.cc/>:135:24: **warning: **conversion
> from string literal to 'char *' is*
> *      deprecated [-Wdeprecated-writable-strings]*
> char  * Query_Suffix = "Query";
> *                       ^*
> *combineMUMs.cc <http://combinemums.cc/>:145:22: **warning: **conversion
> from string literal to 'char *' is*
> *      deprecated [-Wdeprecated-writable-strings]*
> char  * Ref_Suffix = "Ref";
> *                     ^*
>
>
>
> *mgaps.cc <http://mgaps.cc/>:533:20: **warning: **conversion from string
> literal to 'char *' is*
> *      deprecated [-Wdeprecated-writable-strings]*
>            label = "#\n";
> *                   ^*
> *mgaps.cc <http://mgaps.cc/>:620:19: **warning: **conversion from string
> literal to 'char *' is*
> *      deprecated [-Wdeprecated-writable-strings]*
>           label = "#\n";
>
>
>
>
>
> *repeat-match.cc <http://repeat-match.cc/>:850:43: **warning: **'&&'
> within '||' [-Wlogical-op-parentheses]*
>                   || i > String_Separator && j > String_Separator)
> *                  ~~ ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~*
> *repeat-match.cc <http://repeat-match.cc/>:850:43: **note: *place
> parentheses around the '&&' expression to
>       silence this warning
>                   || i > String_Separator && j > String_Separator)
> *                                          ^*
>                      (                                           )
>
>
> *show-coords.cc <http://show-coords.cc/>:799:12: **warning: **conversion
> from string literal to 'char *' is*
> *      deprecated [-Wdeprecated-writable-strings]*
>     type = "NUCMER";
> *           ^*
> *show-coords.cc <http://show-coords.cc/>:801:12: **warning: **conversion
> from string literal to 'char *' is*
> *      deprecated [-Wdeprecated-writable-strings]*
>     type = "PROMER";
> *           ^*
> *show-coords.cc <http://show-coords.cc/>:803:12: **warning: **conversion
> from string literal to 'char *' is*
> *      deprecated [-Wdeprecated-writable-strings]*
>     type = "NULL";
> *           ^*
>
>
>
>
> ------------------------------------------------------------------------------
> Rapidly troubleshoot problems before they affect your business. Most IT
> organizations don't have a clear picture of how application performance
> affects their revenue. With AppDynamics, you get 100% visibility into your
> Java,.NET, & PHP application. Start your 15-day FREE TRIAL of AppDynamics
> Pro!
> http://pubads.g.doubleclick.net/gampad/clk?id=84349831&iu=/4140/ostg.clktrk
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help
>
>

[MUMmer-help] MUMmer installation on MacOS 10.9.1

[Roberta R. <rob...@ic...>]

> Hi everybody,
> 
> I’m new in bioinformatics and I’m trying to follow some ways to do assemblies.
> I’m using MacOS 10.9.1 mavericks and I can’t install MUMmer. During installation process I have the following messages …
> 
> Could you help me?
> 
> Thank you in advance
> 
> 
> combineMUMs.cc:109:27: warning: conversion from string literal to 'char *' is
>       deprecated [-Wdeprecated-writable-strings]
> char  * Error_File_Name = DEFAULT_ERROR_FILE_NAME;
>                           ^
> combineMUMs.cc:26:38: note: expanded from macro 'DEFAULT_ERROR_FILE_NAME'
> #define  DEFAULT_ERROR_FILE_NAME     "witherrors.gaps"
>                                      ^
> combineMUMs.cc:135:24: warning: conversion from string literal to 'char *' is
>       deprecated [-Wdeprecated-writable-strings]
> char  * Query_Suffix = "Query";
>                        ^
> combineMUMs.cc:145:22: warning: conversion from string literal to 'char *' is
>       deprecated [-Wdeprecated-writable-strings]
> char  * Ref_Suffix = "Ref";
>                      ^
> 
> 
> 
> mgaps.cc:533:20: warning: conversion from string literal to 'char *' is
>       deprecated [-Wdeprecated-writable-strings]
>            label = "#\n";
>                    ^
> mgaps.cc:620:19: warning: conversion from string literal to 'char *' is
>       deprecated [-Wdeprecated-writable-strings]
>           label = "#\n";
> 
> 
> 
> 
> 
> repeat-match.cc:850:43: warning: '&&' within '||' [-Wlogical-op-parentheses]
>                   || i > String_Separator && j > String_Separator)
>                   ~~ ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~
> repeat-match.cc:850:43: note: place parentheses around the '&&' expression to
>       silence this warning
>                   || i > String_Separator && j > String_Separator)
>                                           ^
>                      (                                           )
> 
> 
> show-coords.cc:799:12: warning: conversion from string literal to 'char *' is
>       deprecated [-Wdeprecated-writable-strings]
>     type = "NUCMER";
>            ^
> show-coords.cc:801:12: warning: conversion from string literal to 'char *' is
>       deprecated [-Wdeprecated-writable-strings]
>     type = "PROMER";
>            ^
> show-coords.cc:803:12: warning: conversion from string literal to 'char *' is
>       deprecated [-Wdeprecated-writable-strings]
>     type = "NULL";
>            ^

Re: [MUMmer-help] NUCmer - show-tilling

[Adam P. <aph...@gm...>]

Hi Nelly,
show-tiling "pseudomolecule" option never quite does what people want it to
do. If I recall correctly, it tries to be too clever in determining the
offset of each contig in cases where the alignments don't extend to the
very end of the sequence. Also, when the layout of two contigs overlaps, it
will arbitrarily pick one or the other to fill sequence in the
pseudomolecule.

I'd recommend instead running:

*nucmer -maxmatch reference.fasta scaffold.fasta*

*delta-filter -q out.delta > out.filter.delta*

*show-coords -THrcl output.filter.delta > output.filter.coords*
That will find the "best" alignment of each query scaffold to your
reference and dump the alignments as a set of tab delimited intervals. From
that output, and the associated mummerplot, you should be able to
reconstruct the true tiling.

Since writing show-tiling many years ago I have shied away from building
automated "pseudomolecules" because they never get it quite right, and
there is no guarantee that the reference chromosomal structure is the same
in the new genome. If you really need a pseudomolecule, you should be able
to reconstruct the relative order and orientation of your scaffolds from
the coords output.

Best,
-Adam



On Tue, Dec 17, 2013 at 9:57 AM, DESPLAT, Nelly
<Nel...@bi...>wrote:

>  Hello,
>
> I have a draft genome with multiple scaffolds (≈800 Mb) and a reference
> genome (2.5Gb).
>
> I want to determine the position and orientation of these scaffolds in
> relation to my reference genome using nucmer (MUMmer3.22).
>
> Here are my command lines, according to the documentation page here (
> http://mummer.sourceforge.net/examples/#nucmer) :
>
> *nucmer -p output -mum reference.fasta scaffold.fasta*
>
> *delta-filter -i 90 -u 0 -q -r -l 100 output.delta > output.filter*
>
> *show-coords -rcl output.filter > output.filter.coords*
>
> *show-tiling -v 50 -g -1 -p output.fasta output.filter > output.tiling*
>
> For show-tilling, I used –p option to create a pseudo molecule with the
> scaffolds.
>
> I would like understand how this programm creates the pseudo molecules
> because I have observed strange things.
>
> For example, show-tilling give me this output file :
>
> *> Chr1 *
>
> *…*
>
> *4927886          4941005          35706  13120  87.17   99.70   +
> scaffold_27425*
>
> *4976712          4989443          -5294   12732  73.63   97.01
> +         scaffold_28410*
>
> *4984150          5029997          4990    45848  93.02   98.31
> +         scaffold_2130*
>
> *5034988          5036622          8513    1635    100.00 99.88
> +         scaffold_63004*
>
> *5045136          5052379          -1891   7244    97.87   96.75
> -           scaffold_44222*
>
> *…*
>
> But when I look at the sequence at these positions in the fasta file, I
> can see that some scaffolds are missing (scaffold_2130*) *or truncated
> (scaffold_27425*)*. The scaffold_2130 seems to be replaced by a gap of
> the size of the two gaps around this scaffold (4990 + 8513).
>
> Can you please tell me how the scaffolds are used to create the chromosome
> based on the information of the tilling file?
>
> Thanks for your help.
>
>
>
> Nelly Desplat
>
>
>
> Bioinformatics Engineer
> Upstream Genomics
>
> BIOGEMMA
> Route d'Ennezat
> Site de la Garenne
> CS 90126
> 63720 CHAPPES
>
> FRANCE
>
>
>
>
> ------------------------------------------------------------------------------
> Rapidly troubleshoot problems before they affect your business. Most IT
> organizations don't have a clear picture of how application performance
> affects their revenue. With AppDynamics, you get 100% visibility into your
> Java,.NET, & PHP application. Start your 15-day FREE TRIAL of AppDynamics
> Pro!
> http://pubads.g.doubleclick.net/gampad/clk?id=84349831&iu=/4140/ostg.clktrk
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help
>
>

Re: [MUMmer-help] summary statistics for draft assembly alignments?

[Adam P. <aph...@gm...>]

Hi Jacqueline,
Sorry, dnadiff hasn't made it into the online docs yet, but there is a
description of it in the source distribution under README and
docs/dnadiff.README

I have some experience aligning bird genomes with MUMmer, and it can be
very computationally intensive. MUMmer was originally designed for
bacterial genome alignment, and thus doesn't scale all that well to large
genomes -- but it can be done.

The first question is how similar are you genomes? Nucmer doesn't perform
very well if the similarity drops below ~90% identity.

Second, you will want to run it in the "-mumreference" mode with the zebra
finch genome as the reference. This will exclude repetitive matches that
would otherwise extend the runtime too long. Also, depending on your
available memory you may need to align the chromosomes one at a time or in
batches (e.g. one finch chromosome as the reference per run of nucmer). If
you have enough RAM to do it all in one go:

> nucmer -mumreference zebrafinch.fasta yourgenome.fasta
> show-coords -THrcl out.delta > out.coords

That will produce a tab-delimited set of alignments for you to further
analyze. Usually, I would generate summary statistics like the ones you
mentioned using dnadiff, but I think that script would take too long on
your dataset (because it also reports all SNPs, etc). If you want to try
it, no guarantees, you can run it like so:

> dnadiff -d out.delta

And it will analyze the alignment (delta) file you generated previously.

The big caveat here is that by running numcer in the -mumreference mode,
many repeats will not be aligned. You'll have to keep this in mind when
compiling your statistics.

If this all seems to take too long using these tools, you can try another
aligner that scales better for large genomes, like BLAT.

Best,
-Adam




On Mon, Dec 16, 2013 at 3:10 PM, Jacqueline R M Doyle <jm...@pu...>wrote:

> Hi,
>
> I have recently done a couple different assemblies of an avian genome and
> a reviewer has suggested aligning the two assemblies to the zebra finch
> genome and seeing which assembly aligns best.  The idea here is that the
> assembly that overlaps most closely with the zebra finch genome is probably
> the best one to use for downstream analyses.  I'd like to align each
> assembly to the zebra finch genome using nucmer and then generate some
> summary statistics like number of aligned/unaligned contigs, total
> aligned/unaligned length, percent of aligned bases, etc.  What is the best
> way to go about generating this type of data?  I found references to a
> script called "dnadiff" in the email help archives, but couldn't find the
> scrip referenced in the MUMmer 3 manual.
>
> Best wishes...
>
>
> ------------------------------------------------------------------------------
> Rapidly troubleshoot problems before they affect your business. Most IT
> organizations don't have a clear picture of how application performance
> affects their revenue. With AppDynamics, you get 100% visibility into your
> Java,.NET, & PHP application. Start your 15-day FREE TRIAL of AppDynamics
> Pro!
> http://pubads.g.doubleclick.net/gampad/clk?id=84349831&iu=/4140/ostg.clktrk
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help
>

[MUMmer-help] NUCmer - show-tilling

[DESPLAT, N. <Nel...@bi...>]

Hello,
I have a draft genome with multiple scaffolds (≈800 Mb) and a reference genome (2.5Gb).
I want to determine the position and orientation of these scaffolds in relation to my reference genome using nucmer (MUMmer3.22).
Here are my command lines, according to the documentation page here (http://mummer.sourceforge.net/examples/#nucmer) :
nucmer -p output -mum reference.fasta scaffold.fasta
delta-filter -i 90 -u 0 -q -r -l 100 output.delta > output.filter
show-coords -rcl output.filter > output.filter.coords
show-tiling -v 50 -g -1 -p output.fasta output.filter > output.tiling
For show-tilling, I used -p option to create a pseudo molecule with the scaffolds.
I would like understand how this programm creates the pseudo molecules because I have observed strange things.
For example, show-tilling give me this output file :
> Chr1
...
4927886          4941005          35706  13120  87.17   99.70   +         scaffold_27425
4976712          4989443          -5294   12732  73.63   97.01   +         scaffold_28410
4984150          5029997          4990    45848  93.02   98.31   +         scaffold_2130
5034988          5036622          8513    1635    100.00 99.88   +         scaffold_63004
5045136          5052379          -1891   7244    97.87   96.75   -           scaffold_44222
...
But when I look at the sequence at these positions in the fasta file, I can see that some scaffolds are missing (scaffold_2130) or truncated (scaffold_27425). The scaffold_2130 seems to be replaced by a gap of the size of the two gaps around this scaffold (4990 + 8513).
Can you please tell me how the scaffolds are used to create the chromosome based on the information of the tilling file?
Thanks for your help.

Nelly Desplat

Bioinformatics Engineer
Upstream Genomics

BIOGEMMA
Route d'Ennezat
Site de la Garenne
CS 90126
63720 CHAPPES
FRANCE

[MUMmer-help] summary statistics for draft assembly alignments?

[Jacqueline R M D. <jm...@pu...>]

Hi,

I have recently done a couple different assemblies of an avian genome and a reviewer has suggested aligning the two assemblies to the zebra finch genome and seeing which assembly aligns best.  The idea here is that the assembly that overlaps most closely with the zebra finch genome is probably the best one to use for downstream analyses.  I'd like to align each assembly to the zebra finch genome using nucmer and then generate some summary statistics like number of aligned/unaligned contigs, total aligned/unaligned length, percent of aligned bases, etc.  What is the best way to go about generating this type of data?  I found references to a script called "dnadiff" in the email help archives, but couldn't find the scrip referenced in the MUMmer 3 manual.

Best wishes...  

[MUMmer-help] download problem on mac os

[asif j. <asi...@ya...>]

hI

i can't download this program on my mac os please help.

thanx


asif

Re: [MUMmer-help] Fwd: Mummer-help

[Adam P. <aph...@gm...>]

Hi Goutham,
See the online manual here: http://mummer.sourceforge.net/manual/

It walks you through some example runs for various use cases.

-Adam


On Tue, Nov 19, 2013 at 12:20 AM, Goutham atla <gou...@gm...>wrote:

>
> Dear All,
>
> I am planning to use Mummer for genome sequence alignment.
>
> I have human Chr6 sequence file as fasta sequence, which I would like to
> use as reference sequence. I have two other genoome sequences in fasta file
> ( multiple chromosomes and scaffolds ). I am trying to use mummer but had
> hard time figuring out the best way to use it.
>
> I would like to use it from command line. Any inputs from you people are
> welcome.
> --
> Goutham Atla
>
> <https://twitter.com/Geek_y><http://www.linkedin.com/pub/goutham-atla/22/698/974>
>
>
> ------------------------------------------------------------------------------
> Shape the Mobile Experience: Free Subscription
> Software experts and developers: Be at the forefront of tech innovation.
> Intel(R) Software Adrenaline delivers strategic insight and game-changing
> conversations that shape the rapidly evolving mobile landscape. Sign up
> now.
> http://pubads.g.doubleclick.net/gampad/clk?id=63431311&iu=/4140/ostg.clktrk
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help
>
>

[MUMmer-help] Fwd: Mummer-help

[Goutham a. <gou...@gm...>]

Dear All,

I am planning to use Mummer for genome sequence alignment.

I have human Chr6 sequence file as fasta sequence, which I would like to
use as reference sequence. I have two other genoome sequences in fasta file
( multiple chromosomes and scaffolds ). I am trying to use mummer but had
hard time figuring out the best way to use it.

I would like to use it from command line. Any inputs from you people are
welcome.
-- 
Goutham Atla

<https://twitter.com/Geek_y><http://www.linkedin.com/pub/goutham-atla/22/698/974>

[MUMmer-help] Nucmer problem - ERROR: postnuc returned non-zero

[Felipe L. <fel...@ya...>]

I think that you can help me.

The output and command line at terminal is:

$ nucmer --prefix=8A_8B contigs_copd8A.fasta contigs_copd8B.fasta 
1: PREPARING DATA
2,3: RUNNING mummer AND CREATING CLUSTERS
# reading input file "8A_8B.ntref" of length 1976286
# construct suffix tree for sequence of length 1976286
# (maximum reference length is 536870908)
# (maximum query length is 4294967295)
# process 19762 characters per dot
#....................................................................................................
# CONSTRUCTIONTIME /usr/bin/mummer 8A_8B.ntref 0.44
# reading input file "/media/Iomega_HDD/snps_copd8/contigs_copd8B.fasta" of length 1900897
# matching query-file "/media/Iomega_HDD/snps_copd8/contigs_copd8B.fasta"
# against subject-file "8A_8B.ntref"
# COMPLETETIME /usr/bin/mummer 8A_8B.ntref 1.51
# SPACE /usr/bin/mummer 8A_8B.ntref 3.78
4: FINISHING DATA
ERROR: Could not parse input from 'Query File'. 
Please check the filename and format, or file a bug report
ERROR: postnuc returned non-zero


The error file contains:

20131022|121048|  4492| ERROR: postnuc returned non-zero


The .delta file contains:

/media/Iomega_HDD/snps_copd8/contigs_copd8A.fasta /media/Iomega_HDD/snps_copd8/contigs_copd8B.fasta
NUCMER

The .nucmer file

>allcontigs /media/Iomega_HDD/snps_copd8/contigs_copd8A.fasta
tgcccgccgagccagcgttcgagatggtcgaggaccgcccggtcggcttcgtcgagatcc
tcgcgggccgcctctgcggcatagcggaacacctcgcgatcctgcaccgagcgaccgcag
ataccgcccagggtcaggtcgcggctggccaggtcggcccgcgccacccgcaaaagaccc

tgggcgaggttctccaggtcaccggcgaggcttcccgccaggaccagttggc....



 
Felipe Lira
Spanish National Center of Biotechnology - CNB/ CSIC
Microbial Biotechnology Department
Fellow of http://obrasocial.lacaixa.es/

Antes de imprimir este mensaje piense bien si es realmente necesario hacerlo.
Before you print this e-mail, think well if it is really necessary.

[MUMmer-help] TIGR::Foundation in nucmer?

[Jiuhai Z. <zha...@ho...>]

Hi,
I have a problem in nucmer, promer and mapview.the error is like :
Can't locate object method "new" via package "TIGR::Foundation" (perhaps you forgot to load "TIGR::Foundation"?) at /Users/jiuhai/bin/MUMmer3.23/nucmer line 157.
Can anyone help to correct it
 jiuhai 		 	   		  

[MUMmer-help] gnuplot error

[Otieno, J. R. <jr...@st...>]

Hi,

I am getting this error message when trying to generate a mummerplot:

        gnuplot 4.6 patchlevel 0
        Reading delta file output.delta
        Writing plot files out.fplot, out.rplot
        Writing gnuplot script out.gp
        Forking mouse listener
        Rendering plot to screen
        Cannot open load file '-geometry'
        "-geometry", line 0: util.c: No such file or directory

        WARNING: Unable to run 'gnuplot -geometry 500x500+0+0 -title mummerplot out.gp', Inappropriate ioctl for device
        Error: target STRING not available


Below is the command I used:


       /XXX/XXX/Desktop/Software/MUMmer3.23/mummerplot output.delta

Please help.

regards,

James

[MUMmer-help] Mapview Error with GFF Files

[John F W. <jwo...@bi...>]

Hello,

Im trying to use mapview to visualize a nucleotide sequence alignment of
several contigs to a reference with the following command:

mapview -n 1 -f pdf -p $name $name.coords
saccharomyces_cerevisiae_R64-1-1_20110208.gff

with $name representing the prefix used for the delta file and all other
downstream files from the alignment

I receive the following error:
4: FINISHING DATA

  ERROR in the input files ! The reference seq ID can't be found in GFF
files !
      The first column in the GFF file should be the ID of the reference
seq.
      The alignments file should provide the same info in the column before
the last one.

      Here are some example records for the GFF file:

      gnl|FlyBase|X     Dmel3   initial-exon    2155    2413    .       -
    .       X_CG3038.1
      gnl|FlyBase|X     Dmel3   last-exon       1182    2077    .       -
    .       X_CG3038.1
      ...
      The fields are :
      <seq_ID> <source> <exon type> <start> <end> <score> <strand> <frame>
<gene_name>

The Ref entry has the header:
>chrMito

While the GFF entries look like this:
chrMito SGD chromosome 1 85779 . . .
ID=chrMito;dbxref=NCBI:NC_001224;Name=chrMito


GFF file is too large to upload, please contact me directly for gff and
reference file.

Can anyone provide any insight into why it can't find the reference
sequence ID?

Re: [MUMmer-help] mummerplot problem: bad perl interpreter

[Adam P. <aph...@gm...>]

Hi Oliver,
Is this a MUMmer install that you performed, or did it come bundled with
PAGIT? It should be compatible with a number of perl versions. I suspect
the top line of the script that points it to the perl interpreter was
somehow changed. If nucmer is working, just replace the first line of
mummerplot with whatever the first line of nucmer says, e.g.

#!/usr/bin/perl

Best,
-Adam




On Mon, Aug 5, 2013 at 4:24 AM, Oliver Balmer <oli...@un...>wrote:

> Hi
>
> I am trying to run mummerplot on a nucmer .delta file but keep getting
> the error message "....../PAGIT.V1.64bit/PAGIT/bin/mummerplot:
> /software/perl-5.8.8/bin/perl: bad interpreter: No such file or
> directory". Is mummerplot looking for a specific version of perl in a
> specific place that I have missed pointing to? Any other perl scripts
> (and nucmer) run without problems. Any suggestions how I can find out
> what the exact problem is and how to solve it? I did adjust and source
> the file PAGIT/sourceme.pagit, which I suspected would hold all
> instructions where to look for specific pieces of software.
>
> Thanks, Oliver
>
>
>
> ------------------------------------------------------------------------------
> Get your SQL database under version control now!
> Version control is standard for application code, but databases havent
> caught up. So what steps can you take to put your SQL databases under
> version control? Why should you start doing it? Read more to find out.
> http://pubads.g.doubleclick.net/gampad/clk?id=49501711&iu=/4140/ostg.clktrk
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help
>

[MUMmer-help] mummerplot problem: bad perl interpreter

[Oliver B. <oli...@un...>]

Hi

I am trying to run mummerplot on a nucmer .delta file but keep getting 
the error message "....../PAGIT.V1.64bit/PAGIT/bin/mummerplot: 
/software/perl-5.8.8/bin/perl: bad interpreter: No such file or 
directory". Is mummerplot looking for a specific version of perl in a 
specific place that I have missed pointing to? Any other perl scripts 
(and nucmer) run without problems. Any suggestions how I can find out 
what the exact problem is and how to solve it? I did adjust and source 
the file PAGIT/sourceme.pagit, which I suspected would hold all 
instructions where to look for specific pieces of software.

Thanks, Oliver

[MUMmer-help] mapview -f option

[karen p. <kar...@uc...>]

Hi,

The mapview -f command for formatting the output doesn't seem to work. The
default .fig is fine but once I add "-f pdf", no output files are produced.
Does anyone know what I can do to produce files I can view?

Thanks,

-- 
Karen Power BSc PhD

Re: [MUMmer-help] NUCmer dotplot orientation

[Sanjeev K. S. <San...@hu...>]

Dear All,
Regarding my query that mummer/NUCmer is generating dotplots in an inverted direction, I have found that dropping '--layout' option from the mummer command fixes this issue.
Regards,
Sanjeev



________________________________________________________



This email is from the James Hutton Institute, however the views

expressed by the sender are not necessarily the views of the James Hutton

Institute and its subsidiaries. This email and any attachments are confidential and 

are intended solely for the use of the recipient(s) to whom they are addressed.

If you are not the intended recipient, you should not read, copy, disclose or rely on 

any information contained in this email, and we would ask you to contact the 

sender immediately and delete the email from your system.  Although the James 

Hutton Institute has taken reasonable precautions to ensure no viruses are present 

in this email, neither the Institute nor the sender accepts any responsibility for any 

viruses, and it is your responsibility to scan the email and any attachments.



The James Hutton Institute is a Scottish charitable company limited by guarantee.

Registered in Scotland No. SC374831

Registered Office: The James Hutton Institute, Invergowrie Dundee DD2 5DA. 

Charity No. SC041796

Re: [MUMmer-help] 6/4/2013 6:07:45 PM

[Sanjeev K. S. <San...@hu...>]

Dear Satish,
Thanks for your reply! However, the link you sent returns 'Page not available'.
Could you please send it again or write your feedback in the email text?
Regards,
Sanjeev
  

> -----Original Message-----
> From: satishkumar Ranganathan Ganakammal
> [mailto:bio...@gm...]
> Sent: 04 June 2013 18:08
> To: tal...@ch...; mil...@ll...;
> mol...@gm...; mha...@cs...;
> mon...@wa...; mum...@li...;
> bel...@ug...; mz...@em...; nco...@ne...
> Subject: Re: [MUMmer-help] 6/4/2013 6:07:45 PM
> 
> http://sanantoniolocksmithkingdom.com/fji/cvfsgldlydfvcqjriwyp.nyio
> 
> ------------------------------------------------------------------------------
> How ServiceNow helps IT people transform IT departments:
> 1. A cloud service to automate IT design, transition and operations 2.
> Dashboards that offer high-level views of enterprise services 3. A single
> system of record for all IT processes http://p.sf.net/sfu/servicenow-d2d-j
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help

________________________________________________________

This email is from the James Hutton Institute, however the views
expressed by the sender are not necessarily the views of the James Hutton
Institute and its subsidiaries. This email and any attachments are confidential and 
are intended solely for the use of the recipient(s) to whom they are addressed.
If you are not the intended recipient, you should not read, copy, disclose or rely on 
any information contained in this email, and we would ask you to contact the 
sender immediately and delete the email from your system.  Although the James 
Hutton Institute has taken reasonable precautions to ensure no viruses are present 
in this email, neither the Institute nor the sender accepts any responsibility for any 
viruses, and it is your responsibility to scan the email and any attachments.

The James Hutton Institute is a Scottish charitable company limited by guarantee.
Registered in Scotland No. SC374831
Registered Office: The James Hutton Institute, Invergowrie Dundee DD2 5DA. 
Charity No. SC041796

Re: [MUMmer-help] 6/4/2013 6:07:45 PM

[satishkumar R. G. <bio...@gm...>]

http://sanantoniolocksmithkingdom.com/fji/cvfsgldlydfvcqjriwyp.nyio