mummer-help — For general MUMmer questions and help.

[MUMmer-help] nucmer error

[Wymant, C. <c.w...@im...>]

Dear MUMmer help,

>From a clean install of MUMmer, running
$ nucmer --maxmatch test1.fa test2.fa
gives the output
1: PREPARING DATA
sh: 1: Syntax error: "(" unexpected
ERROR: prenuc returned non-zero
regardless of what is in the fasta files; for example just
>MySequence
ACTG
still gives the error. Changing the --maxmatch option does not help. Please advise.

Thanks,
Chris Wymant

[MUMmer-help] MUMmer on a v5.9 redhat

[Clement D. <ccl...@gm...>]

Hello,
>
I'm trying to install MUMmer on a computer under Redhat version 5.9 and ar
> version 2.17
>
> Can you tell me which version of MUMmer I should download to be able to
> install it please ?
> I've tried the last one and I got the following errors when I typed make
> install :
>
> /usr/bin/g++ -O3 show-diff.cc tigrinc.o delta.o -o
> /home/clement.delestre/scripts/Softs/MUMmer3.23/show-diff; chmod 755
> /home/clement.delestre/scripts/Softs/MUMmer3.23/show-diff
> make[1]: quittant le répertoire «
> /home/clement.delestre/scripts/Softs/MUMmer3.23/src/tigr »
> cd /home/clement.delestre/scripts/Softs/MUMmer3.23/scripts; make all
> make[1]: entrant dans le répertoire «
> /home/clement.delestre/scripts/Softs/MUMmer3.23/scripts »
> /bin/sed  -e 's?__CSH_PATH?/bin/csh?g' \
>                 -e
> 's?__BIN_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23?g' \
>                 -e
> 's?__SCRIPT_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23/scripts?g' \
>                 exact-tandems.csh >
> /home/clement.delestre/scripts/Softs/MUMmer3.23/exact-tandems
> chmod 755 /home/clement.delestre/scripts/Softs/MUMmer3.23/exact-tandems
> /bin/sed  -e 's?__PERL_PATH?/usr/bin/perl?g' \
>                 -e
> 's?__SCRIPT_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23/scripts?g' \
>                 mapview.pl >
> /home/clement.delestre/scripts/Softs/MUMmer3.23/mapview
> chmod 755 /home/clement.delestre/scripts/Softs/MUMmer3.23/mapview
> /bin/sed  -e 's?__PERL_PATH?/usr/bin/perl?g' \
>                 -e
> 's?__SCRIPT_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23/scripts?g' \
>                 -e
> 's?__BIN_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23?g' \
>                 mummerplot.pl >
> /home/clement.delestre/scripts/Softs/MUMmer3.23/mummerplot
> chmod 755 /home/clement.delestre/scripts/Softs/MUMmer3.23/mummerplot
> /bin/sed  -e 's?__PERL_PATH?/usr/bin/perl?g' \
>                 -e
> 's?__SCRIPT_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23/scripts?g' \
>                 -e
> 's?__AUX_BIN_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23/aux_bin?g'
> \
>                 -e
> 's?__BIN_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23?g' \
>                  nucmer.pl >
> /home/clement.delestre/scripts/Softs/MUMmer3.23/nucmer
> chmod 755 /home/clement.delestre/scripts/Softs/MUMmer3.23/nucmer
> /bin/sed  -e 's?__PERL_PATH?/usr/bin/perl?g' \
>                 -e
> 's?__SCRIPT_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23/scripts?g' \
>                 -e
> 's?__AUX_BIN_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23/aux_bin?g'
> \
>                 -e
> 's?__BIN_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23?g' \
>                 promer.pl >
> /home/clement.delestre/scripts/Softs/MUMmer3.23/promer
> chmod 755 /home/clement.delestre/scripts/Softs/MUMmer3.23/promer
> /bin/sed  -e 's?__CSH_PATH?/bin/csh?g' \
>                 -e
> 's?__BIN_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23?g' \
>                 run-mummer1.csh >
> /home/clement.delestre/scripts/Softs/MUMmer3.23/run-mummer1
> chmod 755 /home/clement.delestre/scripts/Softs/MUMmer3.23/run-mummer1
> /bin/sed  -e 's?__CSH_PATH?/bin/csh?g' \
>                 -e
> 's?__BIN_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23?g' \
>                 run-mummer3.csh >
> /home/clement.delestre/scripts/Softs/MUMmer3.23/run-mummer3
> chmod 755 /home/clement.delestre/scripts/Softs/MUMmer3.23/run-mummer3
> /bin/sed  -e 's?__PERL_PATH?/usr/bin/perl?g' \
>                 nucmer2xfig.pl >
> /home/clement.delestre/scripts/Softs/MUMmer3.23/nucmer2xfig
> chmod 755 /home/clement.delestre/scripts/Softs/MUMmer3.23/nucmer2xfig
> /bin/sed -e 's?__PERL_PATH?/usr/bin/perl?g' \
>                -e
> 's?__SCRIPT_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23/scripts?g' \
>                -e
> 's?__BIN_DIR?/home/clement.delestre/scripts/Softs/MUMmer3.23?g' \
>                  dnadiff.pl >
> /home/clement.delestre/scripts/Softs/MUMmer3.23/dnadiff
> chmod 755 /home/clement.delestre/scripts/Softs/MUMmer3.23/dnadiff
> make[1]: quittant le répertoire «
> /home/clement.delestre/scripts/Softs/MUMmer3.23/scripts »
>
> If it can help you :
>
> [root@illumina07 MUMmer3.23]# uname -a
> Linux illumina07 2.6.18-348.el5 #1 SMP Wed Nov 28 21:22:00 EST 2012 x86_64
> x86_64 x86_64 GNU/Linux
>
>
> Thank you
> --
>
>
> *Clément DELESTRE**ViroScan3d*
> 8, Avenue Rockefeller
> 3ème Étage, Aile B
> 69373 LYON cedex 08
> +33(0) 478-772-889
> ViroScan3D - SAS au capital de 20 000 euros - SIRET 752 876 995 RCS
> Bourg-en-Bresse - Siège social: 11 allée des acacias, 01 600 TREVOUX
>

Re: [MUMmer-help] show-diff documentation?

[Adam P. <aph...@gm...>]

Timothy,
The GAP feature annotates two adjacent, and possibly, overlapping
alignments. If the difference is negative on the reference, the alignments
overlap on the reference. If the difference is negative on the query, the
alignments overlap on the query. Overlapping alignments are a sign of
duplications. See the attached reference, which may make things clearer.
When the alignments overlap in both the reference and query, it's a tandem
expansion/collapse event (e.g. ARRB -> ARRRB in the examples).

DUP features are for when the duplicated sequence is contained in its own
separate alignment. Examples of this type would be the "Collapse w/
Insertion" alignments shown in the attachment (ARB -> ARIRB in the
examples).

BRK is when the beginning or end of a query sequence doesn't map to the
reference. All the other features report a junction between two adjacent
alignments. BRK reports the case of an alignment not extending all the way
to the beginning or end of a sequence.

Hope this helps,
-Adam


On Thu, Feb 12, 2015 at 11:34 PM, Timothy Wu <2h...@gm...> wrote:

> Hi,
>
> Could someone help me with this question I posted at BioStar?
>
> Thanks.
>
> https://www.biostars.org/p/130363/
>
> Timothy
>
>
>
>
> On Thu, Dec 11, 2014 at 3:24 PM, Timothy Wu <2h...@gm...> wrote:
>
>> Dear Adam,
>>
>> Yes that was indeed me. That email account is not stable as of lately.
>> I've been missing many emails from many people. Thanks for your help I
>> appreciate it. That top-level README is easy to miss but definitely more
>> descriptive.
>>
>> Everything else is clear, however, I am not sure about GAP.
>>
>> "gap-length-R is the length of the alignment gap in the reference". I
>> don't understand when itself (or gap-legnth-Q for that matter) is negative,
>> where gap_end - gap_start is negative. (Why is the coordinates for end
>> smaller than start?) Hence I don't follow where it says "If gap-diff is
>> positive, sequence has been inserted in the reference", and the rest of the
>> explanations.
>>
>> GAP is suppose to be different from BRK or DUP, why is it talking about
>> tandem duplications, and not label it as DUP? (BTW what does BRK stands
>> for?)
>>
>> Thanks for your help. :)
>>
>> Timothy
>>
>>
>>
>> Timothy
>>
>>
>> On Fri, Nov 21, 2014 at 12:45 AM, Adam Phillippy <aph...@gm...>
>> wrote:
>>
>>> Timothy,
>>> The documentation for show-diff is in the top-level README (in
>>> MUMmer/README). I also believe I responded with additional information to
>>> an email you sent directly to me yesterday. (or at least to someone who
>>> happens to have your same name!)
>>>
>>> Best,
>>> -Adam
>>>
>>>
>>> On Wed, Nov 19, 2014 at 9:35 PM, Timothy Wu <2h...@gm...> wrote:
>>>
>>>> Hi,
>>>>
>>>> I would like to know if there is any documentation for show-diff. I
>>>> find it difficult to understand. The documentation to dnadiff told us to
>>>> see documentation for various tools, but I can't find any doc for
>>>> show-diff. I've read the stuff with the -h flag but I still find it hard to
>>>> digest. Any help appreciated, thanks.
>>>>
>>>> Timothy
>>>>
>>>>
>>>> ------------------------------------------------------------------------------
>>>> Download BIRT iHub F-Type - The Free Enterprise-Grade BIRT Server
>>>> from Actuate! Instantly Supercharge Your Business Reports and Dashboards
>>>> with Interactivity, Sharing, Native Excel Exports, App Integration &
>>>> more
>>>> Get technology previously reserved for billion-dollar corporations, FREE
>>>>
>>>> http://pubads.g.doubleclick.net/gampad/clk?id=157005751&iu=/4140/ostg.clktrk
>>>> _______________________________________________
>>>> MUMmer-help mailing list
>>>> MUM...@li...
>>>> https://lists.sourceforge.net/lists/listinfo/mummer-help
>>>>
>>>>
>>>
>>
>

Re: [MUMmer-help] delta-filter parameters for out of order matches

[Adam P. <aph...@gm...>]

I think the problem is the -u option. Just don't use it. Since you are
mapping multiple BACs to the same chromosome, it will be throwing away
alignments from different BACs that map to the same position on the
chromosome. You don't want this. -g should automatically throw away
contained alignments (from the same BAC), so it should effectively filter
out the alignments you don't want.

Best,
-Adam


On Fri, Feb 13, 2015 at 12:15 AM, Surya Saha <ss...@co...> wrote:

> Hi Adam,
>
> I discovered something interesting doing this round of tests. Consider
> this excerpt from the .delta file produced by nucmer where BAC2:501-1001 is
> aligned out of order on CHR01.
> >CHR01 BAC2 20000 1500
> 183 683 501 1001 0 0 0
> 0
> 3001 3500 1 500 0 0 0
> 0
> 4001 4500 1001 1500 0 0 0
> 0
> >CHR01 BAC5 20000 5050
> 683 3500 51 2868 0 0 0
> 0
> 4001 5000 2869 3868 0 0 0
> 0
>
> Using delta-filter -g removes the out of order alignment so thats good.
> >CHR01 BAC2 20000 1500
> 3001 3500 1 500 0 0 0
> 0
> 4001 4500 1001 1500 0 0 0
> 0
> >CHR01 BAC5 20000 5050
> 683 3500 51 2868 0 0 0
> 0
> 4001 5000 2869 3868 0 0 0
> 0
>
> Now if I add the -u flag to remove the non-unique alignments (delta-filter
> -g -u 99), I expect none of the alignments to show up but the offending
> alignment reappears
> >CHR01 BAC2 20000 1500
> 183 683 501 1001 0 0 0
> 0
>
> The order of precedence is "-i -l -u -q -r -g -m -1" so -g should chuck
> this alignment out even if -u allows it. Am I missing something? Thanks
> much.
>
> -Surya
>
>
>
>
> On Thu, Feb 12, 2015 at 3:06 PM, Adam Phillippy <aph...@gm...>
> wrote:
>
>> Hi Surya,
>> Can you give me an example of an alignment (just the coords) that you
>> want to be filtered, but is left by delta-filter -g?
>>
>> -Adam
>>
>>
>> On Thu, Feb 12, 2015 at 12:24 AM, Surya Saha <ss...@co...> wrote:
>>
>>> Hi Adam,
>>>
>>> The delta-filter -g option with -u does not filter out the offending
>>> alignments in all cases. I think I will parse the delta file from nucmer to
>>> identify these out of order alignments unless there is a better option.
>>> Thank you for the prompt response!
>>>
>>> Best,
>>> Surya
>>> .
>>>
>>> On Wed, Feb 11, 2015 at 4:42 PM, Adam Phillippy <aph...@gm...>
>>> wrote:
>>>
>>>> Hi Surya,
>>>> See if the delta-filter -g option does what you want. That option will
>>>> enforce that the relative ordering of alignments on both the reference and
>>>> query is consistent.
>>>>
>>>> Best,
>>>> -Adam
>>>>
>>>>
>>>> On Wed, Feb 11, 2015 at 1:24 PM, Surya Saha <ss...@co...> wrote:
>>>>
>>>>> Hi Adam et al.,
>>>>>
>>>>> I am trying to use nucmer/delta-filter (v3.23) to align BACs to a
>>>>> chromosome with gaps (Ns) with a goal to find BACs that span gaps. I want
>>>>> to filter out any imperfect alignments. This also means any BAC that aligns
>>>>> out of order on the chromosome.
>>>>> Here is an example with out of order alignments (100% identity)
>>>>> BAC:100-200 aligns to CHR:500-600
>>>>> BAC:201-300 aligns to CHR:1001-1100
>>>>> BAC:301-400 aligns to 701-800
>>>>>
>>>>> I am trying to optimize delta-filter parameters for screening these
>>>>> out. I can screen out all alignments where a region of the chromosome is
>>>>> covered by multiple BACs with -u (99-100). Any ideas how to screen out the
>>>>> out of order alignments with delta-filter? Thanks!
>>>>>
>>>>>
>>>>> -Surya
>>>>>
>>>>>
>>>>> --
>>>>>
>>>>> Surya Saha
>>>>> Sol Genomics Network,
>>>>> Boyce Thompson Institute, Ithaca, NY, USA.
>>>>> Plant Pathology and Plant-Microbe Biology Section,
>>>>> Cornell University, NY, USA.
>>>>> http://www.linkedin.com/in/suryasaha
>>>>> https://twitter.com/SahaSurya
>>>>>
>>>>>
>>>>> ------------------------------------------------------------------------------
>>>>> Dive into the World of Parallel Programming. The Go Parallel Website,
>>>>> sponsored by Intel and developed in partnership with Slashdot Media,
>>>>> is your
>>>>> hub for all things parallel software development, from weekly thought
>>>>> leadership blogs to news, videos, case studies, tutorials and more.
>>>>> Take a
>>>>> look and join the conversation now. http://goparallel.sourceforge.net/
>>>>> _______________________________________________
>>>>> MUMmer-help mailing list
>>>>> MUM...@li...
>>>>> https://lists.sourceforge.net/lists/listinfo/mummer-help
>>>>>
>>>>>
>>>>
>>>
>>>
>>> --
>>>
>>> Surya Saha
>>> Sol Genomics Network,
>>> Boyce Thompson Institute, Ithaca, NY, USA.
>>> Plant Pathology and Plant-Microbe Biology Section,
>>> Cornell University, NY, USA.
>>> http://www.linkedin.com/in/suryasaha
>>> https://twitter.com/SahaSurya
>>>
>>
>>
>
>
> --
>
> Surya Saha
> Sol Genomics Network,
> Boyce Thompson Institute, Ithaca, NY, USA.
> Plant Pathology and Plant-Microbe Biology Section,
> Cornell University, NY, USA.
> http://www.linkedin.com/in/suryasaha
> https://twitter.com/SahaSurya
>

Re: [MUMmer-help] delta-filter parameters for out of order matches

[Surya S. <ss...@co...>]

Hi Adam,

I discovered something interesting doing this round of tests. Consider this
excerpt from the .delta file produced by nucmer where BAC2:501-1001 is
aligned out of order on CHR01.
>CHR01 BAC2 20000 1500
183 683 501 1001 0 0 0
0
3001 3500 1 500 0 0 0
0
4001 4500 1001 1500 0 0 0
0
>CHR01 BAC5 20000 5050
683 3500 51 2868 0 0 0
0
4001 5000 2869 3868 0 0 0
0

Using delta-filter -g removes the out of order alignment so thats good.
>CHR01 BAC2 20000 1500
3001 3500 1 500 0 0 0
0
4001 4500 1001 1500 0 0 0
0
>CHR01 BAC5 20000 5050
683 3500 51 2868 0 0 0
0
4001 5000 2869 3868 0 0 0
0

Now if I add the -u flag to remove the non-unique alignments (delta-filter
-g -u 99), I expect none of the alignments to show up but the offending
alignment reappears
>CHR01 BAC2 20000 1500
183 683 501 1001 0 0 0
0

The order of precedence is "-i -l -u -q -r -g -m -1" so -g should chuck
this alignment out even if -u allows it. Am I missing something? Thanks
much.

-Surya




On Thu, Feb 12, 2015 at 3:06 PM, Adam Phillippy <aph...@gm...>
wrote:

> Hi Surya,
> Can you give me an example of an alignment (just the coords) that you want
> to be filtered, but is left by delta-filter -g?
>
> -Adam
>
>
> On Thu, Feb 12, 2015 at 12:24 AM, Surya Saha <ss...@co...> wrote:
>
>> Hi Adam,
>>
>> The delta-filter -g option with -u does not filter out the offending
>> alignments in all cases. I think I will parse the delta file from nucmer to
>> identify these out of order alignments unless there is a better option.
>> Thank you for the prompt response!
>>
>> Best,
>> Surya
>> .
>>
>> On Wed, Feb 11, 2015 at 4:42 PM, Adam Phillippy <aph...@gm...>
>> wrote:
>>
>>> Hi Surya,
>>> See if the delta-filter -g option does what you want. That option will
>>> enforce that the relative ordering of alignments on both the reference and
>>> query is consistent.
>>>
>>> Best,
>>> -Adam
>>>
>>>
>>> On Wed, Feb 11, 2015 at 1:24 PM, Surya Saha <ss...@co...> wrote:
>>>
>>>> Hi Adam et al.,
>>>>
>>>> I am trying to use nucmer/delta-filter (v3.23) to align BACs to a
>>>> chromosome with gaps (Ns) with a goal to find BACs that span gaps. I want
>>>> to filter out any imperfect alignments. This also means any BAC that aligns
>>>> out of order on the chromosome.
>>>> Here is an example with out of order alignments (100% identity)
>>>> BAC:100-200 aligns to CHR:500-600
>>>> BAC:201-300 aligns to CHR:1001-1100
>>>> BAC:301-400 aligns to 701-800
>>>>
>>>> I am trying to optimize delta-filter parameters for screening these
>>>> out. I can screen out all alignments where a region of the chromosome is
>>>> covered by multiple BACs with -u (99-100). Any ideas how to screen out the
>>>> out of order alignments with delta-filter? Thanks!
>>>>
>>>>
>>>> -Surya
>>>>
>>>>
>>>> --
>>>>
>>>> Surya Saha
>>>> Sol Genomics Network,
>>>> Boyce Thompson Institute, Ithaca, NY, USA.
>>>> Plant Pathology and Plant-Microbe Biology Section,
>>>> Cornell University, NY, USA.
>>>> http://www.linkedin.com/in/suryasaha
>>>> https://twitter.com/SahaSurya
>>>>
>>>>
>>>> ------------------------------------------------------------------------------
>>>> Dive into the World of Parallel Programming. The Go Parallel Website,
>>>> sponsored by Intel and developed in partnership with Slashdot Media, is
>>>> your
>>>> hub for all things parallel software development, from weekly thought
>>>> leadership blogs to news, videos, case studies, tutorials and more.
>>>> Take a
>>>> look and join the conversation now. http://goparallel.sourceforge.net/
>>>> _______________________________________________
>>>> MUMmer-help mailing list
>>>> MUM...@li...
>>>> https://lists.sourceforge.net/lists/listinfo/mummer-help
>>>>
>>>>
>>>
>>
>>
>> --
>>
>> Surya Saha
>> Sol Genomics Network,
>> Boyce Thompson Institute, Ithaca, NY, USA.
>> Plant Pathology and Plant-Microbe Biology Section,
>> Cornell University, NY, USA.
>> http://www.linkedin.com/in/suryasaha
>> https://twitter.com/SahaSurya
>>
>
>


-- 

Surya Saha
Sol Genomics Network,
Boyce Thompson Institute, Ithaca, NY, USA.
Plant Pathology and Plant-Microbe Biology Section,
Cornell University, NY, USA.
http://www.linkedin.com/in/suryasaha
https://twitter.com/SahaSurya

Re: [MUMmer-help] show-diff documentation?

[Timothy Wu <2h...@gm...>]

Hi,

Could someone help me with this question I posted at BioStar?

Thanks.

https://www.biostars.org/p/130363/

Timothy



On Thu, Dec 11, 2014 at 3:24 PM, Timothy Wu <2h...@gm...> wrote:

> Dear Adam,
>
> Yes that was indeed me. That email account is not stable as of lately.
> I've been missing many emails from many people. Thanks for your help I
> appreciate it. That top-level README is easy to miss but definitely more
> descriptive.
>
> Everything else is clear, however, I am not sure about GAP.
>
> "gap-length-R is the length of the alignment gap in the reference". I
> don't understand when itself (or gap-legnth-Q for that matter) is negative,
> where gap_end - gap_start is negative. (Why is the coordinates for end
> smaller than start?) Hence I don't follow where it says "If gap-diff is
> positive, sequence has been inserted in the reference", and the rest of the
> explanations.
>
> GAP is suppose to be different from BRK or DUP, why is it talking about
> tandem duplications, and not label it as DUP? (BTW what does BRK stands
> for?)
>
> Thanks for your help. :)
>
> Timothy
>
>
>
> Timothy
>
>
> On Fri, Nov 21, 2014 at 12:45 AM, Adam Phillippy <aph...@gm...>
> wrote:
>
>> Timothy,
>> The documentation for show-diff is in the top-level README (in
>> MUMmer/README). I also believe I responded with additional information to
>> an email you sent directly to me yesterday. (or at least to someone who
>> happens to have your same name!)
>>
>> Best,
>> -Adam
>>
>>
>> On Wed, Nov 19, 2014 at 9:35 PM, Timothy Wu <2h...@gm...> wrote:
>>
>>> Hi,
>>>
>>> I would like to know if there is any documentation for show-diff. I find
>>> it difficult to understand. The documentation to dnadiff told us to see
>>> documentation for various tools, but I can't find any doc for show-diff.
>>> I've read the stuff with the -h flag but I still find it hard to digest.
>>> Any help appreciated, thanks.
>>>
>>> Timothy
>>>
>>>
>>> ------------------------------------------------------------------------------
>>> Download BIRT iHub F-Type - The Free Enterprise-Grade BIRT Server
>>> from Actuate! Instantly Supercharge Your Business Reports and Dashboards
>>> with Interactivity, Sharing, Native Excel Exports, App Integration & more
>>> Get technology previously reserved for billion-dollar corporations, FREE
>>>
>>> http://pubads.g.doubleclick.net/gampad/clk?id=157005751&iu=/4140/ostg.clktrk
>>> _______________________________________________
>>> MUMmer-help mailing list
>>> MUM...@li...
>>> https://lists.sourceforge.net/lists/listinfo/mummer-help
>>>
>>>
>>
>

Re: [MUMmer-help] delta-filter parameters for out of order matches

[Adam P. <aph...@gm...>]

Hi Surya,
Can you give me an example of an alignment (just the coords) that you want
to be filtered, but is left by delta-filter -g?

-Adam


On Thu, Feb 12, 2015 at 12:24 AM, Surya Saha <ss...@co...> wrote:

> Hi Adam,
>
> The delta-filter -g option with -u does not filter out the offending
> alignments in all cases. I think I will parse the delta file from nucmer to
> identify these out of order alignments unless there is a better option.
> Thank you for the prompt response!
>
> Best,
> Surya
> .
>
> On Wed, Feb 11, 2015 at 4:42 PM, Adam Phillippy <aph...@gm...>
> wrote:
>
>> Hi Surya,
>> See if the delta-filter -g option does what you want. That option will
>> enforce that the relative ordering of alignments on both the reference and
>> query is consistent.
>>
>> Best,
>> -Adam
>>
>>
>> On Wed, Feb 11, 2015 at 1:24 PM, Surya Saha <ss...@co...> wrote:
>>
>>> Hi Adam et al.,
>>>
>>> I am trying to use nucmer/delta-filter (v3.23) to align BACs to a
>>> chromosome with gaps (Ns) with a goal to find BACs that span gaps. I want
>>> to filter out any imperfect alignments. This also means any BAC that aligns
>>> out of order on the chromosome.
>>> Here is an example with out of order alignments (100% identity)
>>> BAC:100-200 aligns to CHR:500-600
>>> BAC:201-300 aligns to CHR:1001-1100
>>> BAC:301-400 aligns to 701-800
>>>
>>> I am trying to optimize delta-filter parameters for screening these out.
>>> I can screen out all alignments where a region of the chromosome is covered
>>> by multiple BACs with -u (99-100). Any ideas how to screen out the out of
>>> order alignments with delta-filter? Thanks!
>>>
>>>
>>> -Surya
>>>
>>>
>>> --
>>>
>>> Surya Saha
>>> Sol Genomics Network,
>>> Boyce Thompson Institute, Ithaca, NY, USA.
>>> Plant Pathology and Plant-Microbe Biology Section,
>>> Cornell University, NY, USA.
>>> http://www.linkedin.com/in/suryasaha
>>> https://twitter.com/SahaSurya
>>>
>>>
>>> ------------------------------------------------------------------------------
>>> Dive into the World of Parallel Programming. The Go Parallel Website,
>>> sponsored by Intel and developed in partnership with Slashdot Media, is
>>> your
>>> hub for all things parallel software development, from weekly thought
>>> leadership blogs to news, videos, case studies, tutorials and more. Take
>>> a
>>> look and join the conversation now. http://goparallel.sourceforge.net/
>>> _______________________________________________
>>> MUMmer-help mailing list
>>> MUM...@li...
>>> https://lists.sourceforge.net/lists/listinfo/mummer-help
>>>
>>>
>>
>
>
> --
>
> Surya Saha
> Sol Genomics Network,
> Boyce Thompson Institute, Ithaca, NY, USA.
> Plant Pathology and Plant-Microbe Biology Section,
> Cornell University, NY, USA.
> http://www.linkedin.com/in/suryasaha
> https://twitter.com/SahaSurya
>

Re: [MUMmer-help] delta-filter parameters for out of order matches

[Surya S. <ss...@co...>]

Hi Adam,

The delta-filter -g option with -u does not filter out the offending
alignments in all cases. I think I will parse the delta file from nucmer to
identify these out of order alignments unless there is a better option.
Thank you for the prompt response!

Best,
Surya
.

On Wed, Feb 11, 2015 at 4:42 PM, Adam Phillippy <aph...@gm...>
wrote:

> Hi Surya,
> See if the delta-filter -g option does what you want. That option will
> enforce that the relative ordering of alignments on both the reference and
> query is consistent.
>
> Best,
> -Adam
>
>
> On Wed, Feb 11, 2015 at 1:24 PM, Surya Saha <ss...@co...> wrote:
>
>> Hi Adam et al.,
>>
>> I am trying to use nucmer/delta-filter (v3.23) to align BACs to a
>> chromosome with gaps (Ns) with a goal to find BACs that span gaps. I want
>> to filter out any imperfect alignments. This also means any BAC that aligns
>> out of order on the chromosome.
>> Here is an example with out of order alignments (100% identity)
>> BAC:100-200 aligns to CHR:500-600
>> BAC:201-300 aligns to CHR:1001-1100
>> BAC:301-400 aligns to 701-800
>>
>> I am trying to optimize delta-filter parameters for screening these out.
>> I can screen out all alignments where a region of the chromosome is covered
>> by multiple BACs with -u (99-100). Any ideas how to screen out the out of
>> order alignments with delta-filter? Thanks!
>>
>>
>> -Surya
>>
>>
>> --
>>
>> Surya Saha
>> Sol Genomics Network,
>> Boyce Thompson Institute, Ithaca, NY, USA.
>> Plant Pathology and Plant-Microbe Biology Section,
>> Cornell University, NY, USA.
>> http://www.linkedin.com/in/suryasaha
>> https://twitter.com/SahaSurya
>>
>>
>> ------------------------------------------------------------------------------
>> Dive into the World of Parallel Programming. The Go Parallel Website,
>> sponsored by Intel and developed in partnership with Slashdot Media, is
>> your
>> hub for all things parallel software development, from weekly thought
>> leadership blogs to news, videos, case studies, tutorials and more. Take a
>> look and join the conversation now. http://goparallel.sourceforge.net/
>> _______________________________________________
>> MUMmer-help mailing list
>> MUM...@li...
>> https://lists.sourceforge.net/lists/listinfo/mummer-help
>>
>>
>


-- 

Surya Saha
Sol Genomics Network,
Boyce Thompson Institute, Ithaca, NY, USA.
Plant Pathology and Plant-Microbe Biology Section,
Cornell University, NY, USA.
http://www.linkedin.com/in/suryasaha
https://twitter.com/SahaSurya

Re: [MUMmer-help] delta-filter parameters for out of order matches

[Adam P. <aph...@gm...>]

Hi Surya,
See if the delta-filter -g option does what you want. That option will
enforce that the relative ordering of alignments on both the reference and
query is consistent.

Best,
-Adam


On Wed, Feb 11, 2015 at 1:24 PM, Surya Saha <ss...@co...> wrote:

> Hi Adam et al.,
>
> I am trying to use nucmer/delta-filter (v3.23) to align BACs to a
> chromosome with gaps (Ns) with a goal to find BACs that span gaps. I want
> to filter out any imperfect alignments. This also means any BAC that aligns
> out of order on the chromosome.
> Here is an example with out of order alignments (100% identity)
> BAC:100-200 aligns to CHR:500-600
> BAC:201-300 aligns to CHR:1001-1100
> BAC:301-400 aligns to 701-800
>
> I am trying to optimize delta-filter parameters for screening these out. I
> can screen out all alignments where a region of the chromosome is covered
> by multiple BACs with -u (99-100). Any ideas how to screen out the out of
> order alignments with delta-filter? Thanks!
>
>
> -Surya
>
>
> --
>
> Surya Saha
> Sol Genomics Network,
> Boyce Thompson Institute, Ithaca, NY, USA.
> Plant Pathology and Plant-Microbe Biology Section,
> Cornell University, NY, USA.
> http://www.linkedin.com/in/suryasaha
> https://twitter.com/SahaSurya
>
>
> ------------------------------------------------------------------------------
> Dive into the World of Parallel Programming. The Go Parallel Website,
> sponsored by Intel and developed in partnership with Slashdot Media, is
> your
> hub for all things parallel software development, from weekly thought
> leadership blogs to news, videos, case studies, tutorials and more. Take a
> look and join the conversation now. http://goparallel.sourceforge.net/
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help
>
>

[MUMmer-help] delta-filter parameters for out of order matches

[Surya S. <ss...@co...>]

Hi Adam et al.,

I am trying to use nucmer/delta-filter (v3.23) to align BACs to a
chromosome with gaps (Ns) with a goal to find BACs that span gaps. I want
to filter out any imperfect alignments. This also means any BAC that aligns
out of order on the chromosome.
Here is an example with out of order alignments (100% identity)
BAC:100-200 aligns to CHR:500-600
BAC:201-300 aligns to CHR:1001-1100
BAC:301-400 aligns to 701-800

I am trying to optimize delta-filter parameters for screening these out. I
can screen out all alignments where a region of the chromosome is covered
by multiple BACs with -u (99-100). Any ideas how to screen out the out of
order alignments with delta-filter? Thanks!


-Surya


-- 

Surya Saha
Sol Genomics Network,
Boyce Thompson Institute, Ithaca, NY, USA.
Plant Pathology and Plant-Microbe Biology Section,
Cornell University, NY, USA.
http://www.linkedin.com/in/suryasaha
https://twitter.com/SahaSurya

Re: [MUMmer-help] Portable shebang in MUMmer Perl scripts

[Adam P. <aph...@gm...>]

Hi Joel,
Thanks for the note. I plan to clean-up/update the MUMmer distribution
later this year and will consider this fix.

Best,
-Adam


On Tue, Feb 3, 2015 at 4:12 PM, Joel Fillon, Mr <joe...@mc...>
wrote:

> Hi MUMmer developers,
>
> I don't know if MUMmer is still supported,
> but if yes, I have a small suggestion:
>
> We use MUMmer with our own Perl version which we load as a module,
> instead of default system Perl.
>
> Therefore, we have PERL5LIB clash issues when MUMmer Perl scripts have a
> shebang like:
> "#!/usr/bin/perl" or "#!/usr/bin/perl -w"
> instead of "#!/usr/bin/env perl".
>
> Could you please modify the first shebang line of the following Perl
> scripts with
> "#!/usr/bin/env perl"?
>
> mapview
> mummerplot
> nucmer
> promer
> nucmer2xfig
> dnadiff
>
> Thanks for your help.
> Joël
> _____________________________________________________
> Joël Fillon
> McGill University and Génome Québec Innovation Centre
> 740, Dr. Penfield Avenue, Room 4200
> Montréal (QC) H3A 0G1
> CANADA
>
> Phone: 514-398-3311 ext. 00721
> E-mail: joe...@mc...
>
>
> ------------------------------------------------------------------------------
> Dive into the World of Parallel Programming. The Go Parallel Website,
> sponsored by Intel and developed in partnership with Slashdot Media, is
> your
> hub for all things parallel software development, from weekly thought
> leadership blogs to news, videos, case studies, tutorials and more. Take a
> look and join the conversation now. http://goparallel.sourceforge.net/
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help
>

[MUMmer-help] Portable shebang in MUMmer Perl scripts

[Joel F. M. <joe...@mc...>]

Hi MUMmer developers,

I don't know if MUMmer is still supported,
but if yes, I have a small suggestion:

We use MUMmer with our own Perl version which we load as a module,
instead of default system Perl.

Therefore, we have PERL5LIB clash issues when MUMmer Perl scripts have a
shebang like:
"#!/usr/bin/perl" or "#!/usr/bin/perl -w"
instead of "#!/usr/bin/env perl".

Could you please modify the first shebang line of the following Perl
scripts with
"#!/usr/bin/env perl"?

mapview
mummerplot
nucmer
promer
nucmer2xfig
dnadiff

Thanks for your help.
Joël
_____________________________________________________
Joël Fillon
McGill University and Génome Québec Innovation Centre
740, Dr. Penfield Avenue, Room 4200
Montréal (QC) H3A 0G1
CANADA

Phone: 514-398-3311 ext. 00721
E-mail: joe...@mc...

Re: [MUMmer-help] delta-filter parameters

[Adam P. <aph...@gm...>]

Hi Helene,
-r and -q are not necessarily equivalent to -g. Here's a little more detail:

-m is equivalent to the union of alignments found by running both -r and -q
separately

-1 is the equivalent of the intersection of alignments found by running
both -r and -q separately

-g is best though of as a global alignment. All alignments will be
consistently ordered in both the reference and query, and no inversions are
allowed.

For what it's worth, I typically use -m for genome comparisons (because it
preserves paralogous alignments), and -q for mapping reads or contigs to a
reference (because it will allow for structural variants).

Best,
-Adam


On Wed, Jan 28, 2015 at 3:45 AM, Hélène Chiapello <
hel...@to...> wrote:

> Hello
>
> I used nucmer to align pair of closed bacteria genomes.
> I have a question regarding delta-filter parameters:
> are the "-r -q" and "-g" options equivalent ?
> My undersanding is that the "-g" option assumes collinear
> genomes and do not allow for inversion and translocation,
> while the "-r -q" option allow one to one mapping with possible
> "local" inversions.
> Is that correct ?
>
> Thanks in advance
>
> Helene
>
>
>
> ------------------------------------------------------------------------------
> Dive into the World of Parallel Programming. The Go Parallel Website,
> sponsored by Intel and developed in partnership with Slashdot Media, is
> your
> hub for all things parallel software development, from weekly thought
> leadership blogs to news, videos, case studies, tutorials and more. Take a
> look and join the conversation now. http://goparallel.sourceforge.net/
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help
>

[MUMmer-help] delta-filter parameters

[Hélène C. <hel...@to...>]

Hello

I used nucmer to align pair of closed bacteria genomes.
I have a question regarding delta-filter parameters:
are the "-r -q" and "-g" options equivalent ?
My undersanding is that the "-g" option assumes collinear
genomes and do not allow for inversion and translocation,
while the "-r -q" option allow one to one mapping with possible
"local" inversions.
Is that correct ?

Thanks in advance

Helene

Re: [MUMmer-help] Show coords output last column

[Adam P. <aph...@gm...>]

Hi Nishadi,
I assume you are referring to the output with the -o commands? According to
the manual:

The -o annotations will appear in the final column of the output. The
descriptions reference the reference sequence, *e.g.* [END] means the
overlap is on the end of the reference sequence and [CONTAINED] means the
reference sequence is contained by the query sequence.

Looking at the code, it allows some wiggle for alignments that don't extend
to the very last base of a sequence, as long as it ends within a distance
<5% of the overlap length. It's not a very useful or flexible feature. If
you require a different definition of an overlap, it is easy to compute
directly from start/stop/length information in the other columns.

Best,
-Adam



On Wed, Jan 21, 2015 at 8:30 AM, Nishadi De Silva <nd...@sa...> wrote:

>  Hello
>
>  I am trying to work out how the last column in the show-coords output
> (e.g. IDENTITY, CONTAINED, CONTAINS) is determined but have failed to find
> any documentation on this online. I'd really be grateful if you could point
> me at some definitions as to how this information is deduced (in
> particular, how it deduces that one contig is contained in another).
>
>  Nishadi
>
> -- The Wellcome Trust Sanger Institute is operated by Genome Research
> Limited, a charity registered in England with number 1021457 and a company
> registered in England with number 2742969, whose registered office is 215
> Euston Road, London, NW1 2BE.
>
>
> ------------------------------------------------------------------------------
> New Year. New Location. New Benefits. New Data Center in Ashburn, VA.
> GigeNET is offering a free month of service with a new server in Ashburn.
> Choose from 2 high performing configs, both with 100TB of bandwidth.
> Higher redundancy.Lower latency.Increased capacity.Completely compliant.
> http://p.sf.net/sfu/gigenet
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help
>
>

[MUMmer-help] Show coords output last column

[Nishadi De S. <nd...@sa...>]

Hello

I am trying to work out how the last column in the show-coords output (e.g. IDENTITY, CONTAINED, CONTAINS) is determined but have failed to find any documentation on this online. I'd really be grateful if you could point me at some definitions as to how this information is deduced (in particular, how it deduces that one contig is contained in another).

Nishadi



-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

Re: [MUMmer-help] show-diff documentation?

[Timothy Wu <2h...@gm...>]

Dear Adam,

Yes that was indeed me. That email account is not stable as of lately. I've
been missing many emails from many people. Thanks for your help I
appreciate it. That top-level README is easy to miss but definitely more
descriptive.

Everything else is clear, however, I am not sure about GAP.

"gap-length-R is the length of the alignment gap in the reference". I don't
understand when itself (or gap-legnth-Q for that matter) is negative, where
gap_end - gap_start is negative. (Why is the coordinates for end smaller
than start?) Hence I don't follow where it says "If gap-diff is positive,
sequence has been inserted in the reference", and the rest of the
explanations.

GAP is suppose to be different from BRK or DUP, why is it talking about
tandem duplications, and not label it as DUP? (BTW what does BRK stands
for?)

Thanks for your help. :)

Timothy



Timothy

On Fri, Nov 21, 2014 at 12:45 AM, Adam Phillippy <aph...@gm...>
wrote:

> Timothy,
> The documentation for show-diff is in the top-level README (in
> MUMmer/README). I also believe I responded with additional information to
> an email you sent directly to me yesterday. (or at least to someone who
> happens to have your same name!)
>
> Best,
> -Adam
>
>
> On Wed, Nov 19, 2014 at 9:35 PM, Timothy Wu <2h...@gm...> wrote:
>
>> Hi,
>>
>> I would like to know if there is any documentation for show-diff. I find
>> it difficult to understand. The documentation to dnadiff told us to see
>> documentation for various tools, but I can't find any doc for show-diff.
>> I've read the stuff with the -h flag but I still find it hard to digest.
>> Any help appreciated, thanks.
>>
>> Timothy
>>
>>
>> ------------------------------------------------------------------------------
>> Download BIRT iHub F-Type - The Free Enterprise-Grade BIRT Server
>> from Actuate! Instantly Supercharge Your Business Reports and Dashboards
>> with Interactivity, Sharing, Native Excel Exports, App Integration & more
>> Get technology previously reserved for billion-dollar corporations, FREE
>>
>> http://pubads.g.doubleclick.net/gampad/clk?id=157005751&iu=/4140/ostg.clktrk
>> _______________________________________________
>> MUMmer-help mailing list
>> MUM...@li...
>> https://lists.sourceforge.net/lists/listinfo/mummer-help
>>
>>
>

[MUMmer-help] To Mask or not to Mask, that is (one of) the question(s)

[Jason H. <jas...@zo...>]

Hello Mummers,

I have three main clusters of questions relating to finishing a 500 Mbp eukaryotic diploid heterozygous genome composed of about 40% repetitive elements.

1) My analysis of the assembly suggests that perhaps as much of 100Mp of the assembly is contigs that have been assembled as haplotypes and should be merged if I want this to be a haploid assembly. I would like to use mummer/nucmer to compare the assembly against itself and look for overlapping regions that can be merged. Since I’m looking for anchor points that are not unique I assume I have to use the —maxmatch and —no simplify options. Would you suggest I use a masked genome to prevent the highly repetitive elements from aligning? If I use a masked genome should I edit the scoring matrix to extend through N’s for free? Is there a better approach to identifying merge-able contigs?

2) I would like to compare my assemblies with a related species whose genome is published. It is divergent enough that PROMER is definitely the way to go. Ideally I would like an easy to visualize synteny map which would be composed of long lines for clustered matching genes. Since this is a eukaryote with large repetitive and intergenic regions what parameters would you suggest for mixmatch, mincluster, breaklen, diagdiff/diagfactor, and maxgap? I have been tweaking them but am not completely clear about which part of the pipeline each is relevant for, especially diagdiff/diagfactor.

3) I have MummerGPU installed and a tesla/kepler card to power it. What modifications should I make to the nucmer and proper scripts to implement it?

Thanks for taking the time to read this!

Best regards,
Jason

[MUMmer-help] nucmer error

[nelcaster7 <nel...@gm...>]

Hi all,



I am new to mummer/nucmer and to test whether it works for my data, I have
input 3 wheat fasta sequences (query) and align it against rice sequence
data (all.seq) from MSU7 as a reference seq. I am using this command:



nucmer -maxmatch -c 100 -p nucmer all.con Wheat_Genes_3fasta_anna.fasta



Unfortunately, I am getting these results at the end of the process:



4: FINISHING DATA

sh: nucmer.mgaps: No such file or directory

ERROR: postnuc returned non-zero



And it returned no results.



Any help you could offer is highly appreciated.



Thanks

Enzo

Re: [MUMmer-help] show-diff documentation?

[Adam P. <aph...@gm...>]

Timothy,
The documentation for show-diff is in the top-level README (in
MUMmer/README). I also believe I responded with additional information to
an email you sent directly to me yesterday. (or at least to someone who
happens to have your same name!)

Best,
-Adam


On Wed, Nov 19, 2014 at 9:35 PM, Timothy Wu <2h...@gm...> wrote:

> Hi,
>
> I would like to know if there is any documentation for show-diff. I find
> it difficult to understand. The documentation to dnadiff told us to see
> documentation for various tools, but I can't find any doc for show-diff.
> I've read the stuff with the -h flag but I still find it hard to digest.
> Any help appreciated, thanks.
>
> Timothy
>
>
> ------------------------------------------------------------------------------
> Download BIRT iHub F-Type - The Free Enterprise-Grade BIRT Server
> from Actuate! Instantly Supercharge Your Business Reports and Dashboards
> with Interactivity, Sharing, Native Excel Exports, App Integration & more
> Get technology previously reserved for billion-dollar corporations, FREE
>
> http://pubads.g.doubleclick.net/gampad/clk?id=157005751&iu=/4140/ostg.clktrk
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help
>
>

[MUMmer-help] show-diff documentation?

[Timothy Wu <2h...@gm...>]

Hi,

I would like to know if there is any documentation for show-diff. I find it
difficult to understand. The documentation to dnadiff told us to see
documentation for various tools, but I can't find any doc for show-diff.
I've read the stuff with the -h flag but I still find it hard to digest.
Any help appreciated, thanks.

Timothy

Re: [MUMmer-help] nucmer misses alignments with less input sequences

[Adam P. <aph...@gm...>]

Michael,
Thank you for the detailed report. I will be sure to take a look at this.

-Adam


On Mon, Oct 13, 2014 at 12:03 PM, Michael Hiller <hi...@mp...> wrote:

> Hi,
>
> I am using nucmer to align DNA sequences and during some playing around
> with my input data, I noticed the following bug or strange behavior:
>
>
> I aligned two small files (input.fa with sequence "a" and "b" against
> input2.fa with sequence "c") and found a hit between "a" and "c"
>
> cat input.fa
>  >a
>
> GTGTCTTTGGTGCACTGGATGTAGATGGATTCTTGCGCCCATTCACGATTGTGGTAGAAGGGCTAGTAAAGGTGGAGTGGATAATCCAACCCGCAACTCCGATATGAATGGCCGTCTTTTGATCAGCCGCATATTAGACTTAACGTGCTCAAAAACACGGTTCATAATCCTTGATTATGCTGTTGACCAGCTTGCTGGCCAGTGTAGGATCAATTCGTTTATTATATAAGTCCTGCAGTCAAAGATCAGTAAGAAATTATTGATTGCTTTCTAACGTTTTTTCCCTTTCATGAAGTGCTTGGGGTTTTGCCAAAGAAATCCTTTAGCCTTTAGTAGTAAATAAGCAGACTAGAGTCCACATACATCGACAATATATCAGCTTCTGCTGGCGGCGAATCAGAGGGGCCGCTGTCGCCTCCACCTATGAGGCCCCTCAGGGCGAGCTGGCTCCATTGGGAGTAGATGGAACACTGGCGGCTTCAGTGGGTTAGACCTGTGTAATAGAGACACGCCAGATTTGCACCCTGCCCCTGGTGGTGCACTGTCGCCAATCGCCCAAGCGTGGCGACACCTTGATCCTGGCCTGTTCCCGATTGGGCAATCGGGCCTGGGGGGCAGTCGTTCCAGGCCCAAATTAGCTGCATTGCATCGTGTGGCATCACTGGCGCACCTGCAGTGGCGCCTCCGGCCCTCGCCTTCCTGCTCCTACTGTGTCAGCCAGTGCATTCACGCATCTATCCATAGAGATACATTTGGGTGTGCCTGGGCTTTCGCACCAGCGATTAACTTTTTGCTGCCAGTTTCCTCCTTGGCTTACTGCAGGCGGCAAGATGGAACAGCAGAATGTCAGCTGACATTCGTTCACAAAAGATCATGAAACTAACACCAGGGCCGGAATTGTAGAGATGTATCCACTTCCTTGTGTGTTTAGGAACTAACACAAGTTGGTGGATGGGTGGTAGTAACAATGACAGAAGAATTGCCACCCGG
>  >b
>
> AAAAGAGAGCATTTATGCTTTTGAATTTAACTTAAGTTTGATGCACTAAAATAATAAAGGTATTCGATGTACTGTTCTATTTAAGTGCATAAAACTATTTTTTGTAAGGGTGCTATATCCTTTTTTCAGATAGATTCTTTGTTGATTCTCTTCCTTTTGATAAGAAGGAGTAGTTCCTGGTCAAGAGGCTAAAGTGTGGAAATGACCACATTTTCCACACTTTCTGCCAACCAGTGACAACATATCATAGGTGGCTAGCAGTGCAGAAAGAAGTCAAAAAGGTGTCCTGGCTTCAGGTTAGCCTCCTCCAGCCTAGCCAACAAAATGTGACTGCTTTGAATTCTCTGTAAACAAGAGAATTCATAAAAGCCATAAAACCAAAAAAAAAAACTCTGCACACTTCCAAGCAGGAGCTGTAGCTGGCAGATGTAGATCTAAGTTGGGTTTTATCCAGCTAGGGCCAATTATCCTCTCCTGTTCTGTTAGCCAAATTGTGGGATTCTCTAAAAGCCCAGAAATTACTCGCTGATAGAGTTGGAAACACCTAGACAAAGGGCTAAAAAGTTCAGGAGCATTAAAAAATGGTATTCCTGCATTGAACAGTACTCGCCCTCCAAAGAATTCATCTATTTGAAGGTTAAAAATGTGGGATCAAATATAAAAGTAGATCCTTAACCCAATACCAATGTGTGTTTACGCAACATTAAGGCTTTTATTTACAAGATTTGGGAGAAGAGAAGATGGATGAAGGCTGTTGAGTAAAATAATGAAACAGATGAATTTTTCCCCTTGAAAACAGAGACACAGGTTAAACCAGGAGGGGTTGGAGAATAGCCAATGGTTAACATGTATGCCCAACTGATGAGATGTTTTTAAAGATGATAAAGAGAAGGAGGGTTCCTTCCTGGTTGAGTAGAAACGGAGGGTGGCTTTTTTGAAGAGGAGCGAAA
> cat input2.fa
>  >c
>
> TATAAATAGCTAAATACATAACTAATGTTATGAATTCTTCTAGAAAATGTCAAGAAGTCATTGCAATTTATTTCTCGCTTGCAACTTTGAAACAATATTGTATGCTTTAGGTTCCACTTTCCACTTTTTTCTTGCCTCTGTCTGGTTGATTATTTTTGTGTCAGTGGTGCCACCTCGTGGAGTTTAAGTTTTACTGGCAAACTCTCCTTTTAAAATAAACACAGTGTAGTATTATTATATGGGAAAGAGAACAGGATTCTTGTGCATTCAGTAGTTATACAGAACACCTGCTTAAATTTTGTCTTTGGTACAACTATTAGAAGCACAGAAGTCCTTCTAACTGTACTAAAGTGGATCATTGCAAAGTCATTATGAAAAGAATTCTAACAAAACGCATACATTGCAACAGAATGAAAACATGGCAATTCTTGTATTTTATAACCCATCCAAAACTTGTGTTAGTTCCTAAACACAAGGAATGGAGTACATCTACAGTTCTGTTAGTTCATGATTTTTGTGAACATGTCAGTGACATTCTGCTGTTCCATCTTGCCGCCTGCAGTAGCCAAGAGAAGTGGCAGCAAAAAGTTAATCACTGGTGCAAACCCAGCAACCAAATTATCTCTATGGATAATGGTGAAGGCACTGGCTGACACAGTAGGAGATGAAGGCGAGGCGAGGCGAGGCCATGCAGTGCGCAGTGATGCACAGATGCAATCAGCTAATTGGGCCTGAACGATGCCCCAGGCCCGATTGCCCAATCGAACAGGCAGGATCAATGTGTCGCAGTGGCCGGGACA
> nucmer --maxmatch -l 11 -b 1000 -g 1000 input.fa input2.fa ; show-coords
> out.delta
>
> gives:
> NUCMER
>
>      [S1]     [E1]  |     [S2]     [E2]  |  [LEN 1]  [LEN 2]  |  [%
> IDY]  | [TAGS]
>
> =====================================================================================
>       565      985  |      787      420  |      421 368  |    83.89  |
> a    c
>
>
>
> Now, if I remove sequence "b" from input.fa that shows no alignment, the
> alignment between "a" and "c" is not found anymore
>
> cat input.fa
>  >a
>
> GTGTCTTTGGTGCACTGGATGTAGATGGATTCTTGCGCCCATTCACGATTGTGGTAGAAGGGCTAGTAAAGGTGGAGTGGATAATCCAACCCGCAACTCCGATATGAATGGCCGTCTTTTGATCAGCCGCATATTAGACTTAACGTGCTCAAAAACACGGTTCATAATCCTTGATTATGCTGTTGACCAGCTTGCTGGCCAGTGTAGGATCAATTCGTTTATTATATAAGTCCTGCAGTCAAAGATCAGTAAGAAATTATTGATTGCTTTCTAACGTTTTTTCCCTTTCATGAAGTGCTTGGGGTTTTGCCAAAGAAATCCTTTAGCCTTTAGTAGTAAATAAGCAGACTAGAGTCCACATACATCGACAATATATCAGCTTCTGCTGGCGGCGAATCAGAGGGGCCGCTGTCGCCTCCACCTATGAGGCCCCTCAGGGCGAGCTGGCTCCATTGGGAGTAGATGGAACACTGGCGGCTTCAGTGGGTTAGACCTGTGTAATAGAGACACGCCAGATTTGCACCCTGCCCCTGGTGGTGCACTGTCGCCAATCGCCCAAGCGTGGCGACACCTTGATCCTGGCCTGTTCCCGATTGGGCAATCGGGCCTGGGGGGCAGTCGTTCCAGGCCCAAATTAGCTGCATTGCATCGTGTGGCATCACTGGCGCACCTGCAGTGGCGCCTCCGGCCCTCGCCTTCCTGCTCCTACTGTGTCAGCCAGTGCATTCACGCATCTATCCATAGAGATACATTTGGGTGTGCCTGGGCTTTCGCACCAGCGATTAACTTTTTGCTGCCAGTTTCCTCCTTGGCTTACTGCAGGCGGCAAGATGGAACAGCAGAATGTCAGCTGACATTCGTTCACAAAAGATCATGAAACTAACACCAGGGCCGGAATTGTAGAGATGTATCCACTTCCTTGTGTGTTTAGGAACTAACACAAGTTGGTGGATGGGTGGTAGTAACAATGACAGAAGAATTGCCACCCGG
> cat input2.fa
>  >c
>
> TATAAATAGCTAAATACATAACTAATGTTATGAATTCTTCTAGAAAATGTCAAGAAGTCATTGCAATTTATTTCTCGCTTGCAACTTTGAAACAATATTGTATGCTTTAGGTTCCACTTTCCACTTTTTTCTTGCCTCTGTCTGGTTGATTATTTTTGTGTCAGTGGTGCCACCTCGTGGAGTTTAAGTTTTACTGGCAAACTCTCCTTTTAAAATAAACACAGTGTAGTATTATTATATGGGAAAGAGAACAGGATTCTTGTGCATTCAGTAGTTATACAGAACACCTGCTTAAATTTTGTCTTTGGTACAACTATTAGAAGCACAGAAGTCCTTCTAACTGTACTAAAGTGGATCATTGCAAAGTCATTATGAAAAGAATTCTAACAAAACGCATACATTGCAACAGAATGAAAACATGGCAATTCTTGTATTTTATAACCCATCCAAAACTTGTGTTAGTTCCTAAACACAAGGAATGGAGTACATCTACAGTTCTGTTAGTTCATGATTTTTGTGAACATGTCAGTGACATTCTGCTGTTCCATCTTGCCGCCTGCAGTAGCCAAGAGAAGTGGCAGCAAAAAGTTAATCACTGGTGCAAACCCAGCAACCAAATTATCTCTATGGATAATGGTGAAGGCACTGGCTGACACAGTAGGAGATGAAGGCGAGGCGAGGCGAGGCCATGCAGTGCGCAGTGATGCACAGATGCAATCAGCTAATTGGGCCTGAACGATGCCCCAGGCCCGATTGCCCAATCGAACAGGCAGGATCAATGTGTCGCAGTGGCCGGGACA
> nucmer --maxmatch -l 11 -b 1000 -g 1000 input.fa input2.fa ; show-coords
> out.delta
>
> gives:
> NUCMER
>
>      [S1]     [E1]  |     [S2]     [E2]  |  [LEN 1]  [LEN 2]  |  [%
> IDY]  | [TAGS]
>
> =====================================================================================
>
>
>
> I called mummer and mgaps manually on the .ntref file and it seems that
> while mummer outputs something, mgaps removes the alignment.
>
> Could you please have a look if this is a bug, and if not tell me which
> mgaps parameters would keep that alignment?
>
>
> Thanks a lot
> - Michael
>
>
>
>
>
>
>
> ------------------------------------------------------------------------------
> Meet PCI DSS 3.0 Compliance Requirements with EventLog Analyzer
> Achieve PCI DSS 3.0 Compliant Status with Out-of-the-box PCI DSS Reports
> Are you Audit-Ready for PCI DSS 3.0 Compliance? Download White paper
> Comply to PCI DSS 3.0 Requirement 10 and 11.5 with EventLog Analyzer
> http://p.sf.net/sfu/Zoho
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help
>

[MUMmer-help] nucmer misses alignments with less input sequences

[Michael H. <hi...@mp...>]

Hi,

I am using nucmer to align DNA sequences and during some playing around 
with my input data, I noticed the following bug or strange behavior:


I aligned two small files (input.fa with sequence "a" and "b" against 
input2.fa with sequence "c") and found a hit between "a" and "c"

cat input.fa
 >a
GTGTCTTTGGTGCACTGGATGTAGATGGATTCTTGCGCCCATTCACGATTGTGGTAGAAGGGCTAGTAAAGGTGGAGTGGATAATCCAACCCGCAACTCCGATATGAATGGCCGTCTTTTGATCAGCCGCATATTAGACTTAACGTGCTCAAAAACACGGTTCATAATCCTTGATTATGCTGTTGACCAGCTTGCTGGCCAGTGTAGGATCAATTCGTTTATTATATAAGTCCTGCAGTCAAAGATCAGTAAGAAATTATTGATTGCTTTCTAACGTTTTTTCCCTTTCATGAAGTGCTTGGGGTTTTGCCAAAGAAATCCTTTAGCCTTTAGTAGTAAATAAGCAGACTAGAGTCCACATACATCGACAATATATCAGCTTCTGCTGGCGGCGAATCAGAGGGGCCGCTGTCGCCTCCACCTATGAGGCCCCTCAGGGCGAGCTGGCTCCATTGGGAGTAGATGGAACACTGGCGGCTTCAGTGGGTTAGACCTGTGTAATAGAGACACGCCAGATTTGCACCCTGCCCCTGGTGGTGCACTGTCGCCAATCGCCCAAGCGTGGCGACACCTTGATCCTGGCCTGTTCCCGATTGGGCAATCGGGCCTGGGGGGCAGTCGTTCCAGGCCCAAATTAGCTGCATTGCATCGTGTGGCATCACTGGCGCACCTGCAGTGGCGCCTCCGGCCCTCGCCTTCCTGCTCCTACTGTGTCAGCCAGTGCATTCACGCATCTATCCATAGAGATACATTTGGGTGTGCCTGGGCTTTCGCACCAGCGATTAACTTTTTGCTGCCAGTTTCCTCCTTGGCTTACTGCAGGCGGCAAGATGGAACAGCAGAATGTCAGCTGACATTCGTTCACAAAAGATCATGAAACTAACACCAGGGCCGGAATTGTAGAGATGTATCCACTTCCTTGTGTGTTTAGGAACTAACACAAGTTGGTGGATGGGTGGTAGTAACAATGACAGAAGAATTGCCACCCGG
 >b
AAAAGAGAGCATTTATGCTTTTGAATTTAACTTAAGTTTGATGCACTAAAATAATAAAGGTATTCGATGTACTGTTCTATTTAAGTGCATAAAACTATTTTTTGTAAGGGTGCTATATCCTTTTTTCAGATAGATTCTTTGTTGATTCTCTTCCTTTTGATAAGAAGGAGTAGTTCCTGGTCAAGAGGCTAAAGTGTGGAAATGACCACATTTTCCACACTTTCTGCCAACCAGTGACAACATATCATAGGTGGCTAGCAGTGCAGAAAGAAGTCAAAAAGGTGTCCTGGCTTCAGGTTAGCCTCCTCCAGCCTAGCCAACAAAATGTGACTGCTTTGAATTCTCTGTAAACAAGAGAATTCATAAAAGCCATAAAACCAAAAAAAAAAACTCTGCACACTTCCAAGCAGGAGCTGTAGCTGGCAGATGTAGATCTAAGTTGGGTTTTATCCAGCTAGGGCCAATTATCCTCTCCTGTTCTGTTAGCCAAATTGTGGGATTCTCTAAAAGCCCAGAAATTACTCGCTGATAGAGTTGGAAACACCTAGACAAAGGGCTAAAAAGTTCAGGAGCATTAAAAAATGGTATTCCTGCATTGAACAGTACTCGCCCTCCAAAGAATTCATCTATTTGAAGGTTAAAAATGTGGGATCAAATATAAAAGTAGATCCTTAACCCAATACCAATGTGTGTTTACGCAACATTAAGGCTTTTATTTACAAGATTTGGGAGAAGAGAAGATGGATGAAGGCTGTTGAGTAAAATAATGAAACAGATGAATTTTTCCCCTTGAAAACAGAGACACAGGTTAAACCAGGAGGGGTTGGAGAATAGCCAATGGTTAACATGTATGCCCAACTGATGAGATGTTTTTAAAGATGATAAAGAGAAGGAGGGTTCCTTCCTGGTTGAGTAGAAACGGAGGGTGGCTTTTTTGAAGAGGAGCGAAA
cat input2.fa
 >c
TATAAATAGCTAAATACATAACTAATGTTATGAATTCTTCTAGAAAATGTCAAGAAGTCATTGCAATTTATTTCTCGCTTGCAACTTTGAAACAATATTGTATGCTTTAGGTTCCACTTTCCACTTTTTTCTTGCCTCTGTCTGGTTGATTATTTTTGTGTCAGTGGTGCCACCTCGTGGAGTTTAAGTTTTACTGGCAAACTCTCCTTTTAAAATAAACACAGTGTAGTATTATTATATGGGAAAGAGAACAGGATTCTTGTGCATTCAGTAGTTATACAGAACACCTGCTTAAATTTTGTCTTTGGTACAACTATTAGAAGCACAGAAGTCCTTCTAACTGTACTAAAGTGGATCATTGCAAAGTCATTATGAAAAGAATTCTAACAAAACGCATACATTGCAACAGAATGAAAACATGGCAATTCTTGTATTTTATAACCCATCCAAAACTTGTGTTAGTTCCTAAACACAAGGAATGGAGTACATCTACAGTTCTGTTAGTTCATGATTTTTGTGAACATGTCAGTGACATTCTGCTGTTCCATCTTGCCGCCTGCAGTAGCCAAGAGAAGTGGCAGCAAAAAGTTAATCACTGGTGCAAACCCAGCAACCAAATTATCTCTATGGATAATGGTGAAGGCACTGGCTGACACAGTAGGAGATGAAGGCGAGGCGAGGCGAGGCCATGCAGTGCGCAGTGATGCACAGATGCAATCAGCTAATTGGGCCTGAACGATGCCCCAGGCCCGATTGCCCAATCGAACAGGCAGGATCAATGTGTCGCAGTGGCCGGGACA
nucmer --maxmatch -l 11 -b 1000 -g 1000 input.fa input2.fa ; show-coords 
out.delta

gives:
NUCMER

     [S1]     [E1]  |     [S2]     [E2]  |  [LEN 1]  [LEN 2]  |  [% 
IDY]  | [TAGS]
=====================================================================================
      565      985  |      787      420  |      421 368  |    83.89  | 
a    c



Now, if I remove sequence "b" from input.fa that shows no alignment, the 
alignment between "a" and "c" is not found anymore

cat input.fa
 >a
GTGTCTTTGGTGCACTGGATGTAGATGGATTCTTGCGCCCATTCACGATTGTGGTAGAAGGGCTAGTAAAGGTGGAGTGGATAATCCAACCCGCAACTCCGATATGAATGGCCGTCTTTTGATCAGCCGCATATTAGACTTAACGTGCTCAAAAACACGGTTCATAATCCTTGATTATGCTGTTGACCAGCTTGCTGGCCAGTGTAGGATCAATTCGTTTATTATATAAGTCCTGCAGTCAAAGATCAGTAAGAAATTATTGATTGCTTTCTAACGTTTTTTCCCTTTCATGAAGTGCTTGGGGTTTTGCCAAAGAAATCCTTTAGCCTTTAGTAGTAAATAAGCAGACTAGAGTCCACATACATCGACAATATATCAGCTTCTGCTGGCGGCGAATCAGAGGGGCCGCTGTCGCCTCCACCTATGAGGCCCCTCAGGGCGAGCTGGCTCCATTGGGAGTAGATGGAACACTGGCGGCTTCAGTGGGTTAGACCTGTGTAATAGAGACACGCCAGATTTGCACCCTGCCCCTGGTGGTGCACTGTCGCCAATCGCCCAAGCGTGGCGACACCTTGATCCTGGCCTGTTCCCGATTGGGCAATCGGGCCTGGGGGGCAGTCGTTCCAGGCCCAAATTAGCTGCATTGCATCGTGTGGCATCACTGGCGCACCTGCAGTGGCGCCTCCGGCCCTCGCCTTCCTGCTCCTACTGTGTCAGCCAGTGCATTCACGCATCTATCCATAGAGATACATTTGGGTGTGCCTGGGCTTTCGCACCAGCGATTAACTTTTTGCTGCCAGTTTCCTCCTTGGCTTACTGCAGGCGGCAAGATGGAACAGCAGAATGTCAGCTGACATTCGTTCACAAAAGATCATGAAACTAACACCAGGGCCGGAATTGTAGAGATGTATCCACTTCCTTGTGTGTTTAGGAACTAACACAAGTTGGTGGATGGGTGGTAGTAACAATGACAGAAGAATTGCCACCCGG
cat input2.fa
 >c
TATAAATAGCTAAATACATAACTAATGTTATGAATTCTTCTAGAAAATGTCAAGAAGTCATTGCAATTTATTTCTCGCTTGCAACTTTGAAACAATATTGTATGCTTTAGGTTCCACTTTCCACTTTTTTCTTGCCTCTGTCTGGTTGATTATTTTTGTGTCAGTGGTGCCACCTCGTGGAGTTTAAGTTTTACTGGCAAACTCTCCTTTTAAAATAAACACAGTGTAGTATTATTATATGGGAAAGAGAACAGGATTCTTGTGCATTCAGTAGTTATACAGAACACCTGCTTAAATTTTGTCTTTGGTACAACTATTAGAAGCACAGAAGTCCTTCTAACTGTACTAAAGTGGATCATTGCAAAGTCATTATGAAAAGAATTCTAACAAAACGCATACATTGCAACAGAATGAAAACATGGCAATTCTTGTATTTTATAACCCATCCAAAACTTGTGTTAGTTCCTAAACACAAGGAATGGAGTACATCTACAGTTCTGTTAGTTCATGATTTTTGTGAACATGTCAGTGACATTCTGCTGTTCCATCTTGCCGCCTGCAGTAGCCAAGAGAAGTGGCAGCAAAAAGTTAATCACTGGTGCAAACCCAGCAACCAAATTATCTCTATGGATAATGGTGAAGGCACTGGCTGACACAGTAGGAGATGAAGGCGAGGCGAGGCGAGGCCATGCAGTGCGCAGTGATGCACAGATGCAATCAGCTAATTGGGCCTGAACGATGCCCCAGGCCCGATTGCCCAATCGAACAGGCAGGATCAATGTGTCGCAGTGGCCGGGACA
nucmer --maxmatch -l 11 -b 1000 -g 1000 input.fa input2.fa ; show-coords 
out.delta

gives:
NUCMER

     [S1]     [E1]  |     [S2]     [E2]  |  [LEN 1]  [LEN 2]  |  [% 
IDY]  | [TAGS]
=====================================================================================



I called mummer and mgaps manually on the .ntref file and it seems that 
while mummer outputs something, mgaps removes the alignment.

Could you please have a look if this is a bug, and if not tell me which 
mgaps parameters would keep that alignment?


Thanks a lot
- Michael

[MUMmer-help] pdf output for mapview

[Wang, X. <xf...@ku...>]

Dear there,

I am trying use 'mapview' to display the sequence alignment in PDF format. But, there is nothing generated. The code looks like this:$ mapview -n 1 -f fig -p test test.coords, although there is "test_0.fig" generated when I run the code like this $ mapview -n 1 -p test test.coords or $ mapview -n 1 -f fig -p test test.coords. Also, there is nothing for "-f ps" ($ mapview -n 1 -f ps -p test test.coords).

I tried 2 versions: MUMmer3.22 and MUMmer3.23.

Could someone give me some help?

Thanks a lot!

Best,

Xiaofei

Re: [MUMmer-help] Question about using .gff3 files in mapview.

[Adam P. <aph...@gm...>]

Hi Kurt,
My apologies, but MapView has not be maintained for many years and is a
very unstable script. The original developer is no longer affiliated with
the project. This issue keeps arising on the mailing list, so I will plan
on removing it from the next release.

Best,
-Adam



On Tue, Aug 19, 2014 at 1:53 PM, Wollenberg, Kurt (NIH/NIAID) [C] <
wol...@ni...> wrote:

> Hello:
>
> I am trying to run a map view analysis based on the tutorial and am
> getting a frustrating error when I try to include the .gff3 file for my
> reference sequence. I'm getting the error "The reference seq ID can't be
> found in the GFF files !". I have gone into my .gff3 file (downloaded the
> GenBank(full) file in gff3 format from GenBank) and my promer.coords file
> and made sure that the first ID under [TAGS] in .coords is identical to the
> entry in the first column of my .gff3 file. I'm still getting this error no
> matter how I try to make these match. Has anyone else out there run into
> this and is there a known solution? Am I trying to match the wrong fields?
>
> Cheers,
> Kurt Wollenberg, Ph.D.
> Contractor - MSC, Inc.
> Phylogenetics Specialist
> Computational Biology Section
> Bioinformatics and Computational Biosciences Branch (BCBB)
> OCICB/OSMO/OD/NIAID/NIH
>
> 31 Center Drive, Room 3B62
> Bethesda, MD 20892-0485
> Office 301-402-8628
> http://bioinformatics.niaid.nih.gov<http://bioinformatics.niaid.nih.gov/>
> (Within NIH)
> http://exon.niaid.nih.gov<http://exon.niaid.nih.gov/> (Public)
>
> Disclaimer:
> The information in this e-mail and any of its attachments is confidential
> and may contain sensitive information. It should not be used by anyone who
> is not the original intended recipient. If you have received this e-mail in
> error please inform the sender and delete it from your mailbox or any other
> storage devices. National Institute of Allergy and Infectious Diseases
> shall
> not accept liability for any statements made that are sender's own and not
> expressly made on behalf of the NIAID by one of its representatives
>
>
> ------------------------------------------------------------------------------
> _______________________________________________
> MUMmer-help mailing list
> MUM...@li...
> https://lists.sourceforge.net/lists/listinfo/mummer-help
>