Work at SourceForge, help us to make it a better place! We have an immediate need for a Support Technician in our San Francisco or Denver office.

Close

#14 fasta file/postnuc error

v3.xx
open
nobody
None
5
2013-05-21
2013-05-21
kborz
No

Hi,
I am getting a very weird error:
When I do a a self against self nucmer run
the following fasta fails parsing the query input:

xx
CTTTTCTTCCGGCATCGGGAGCGATTCAATATCGCTGCCCACTTTATCCGGGATCGGCAATACGA
ERROR: Could not parse input from 'Query File'.
Please check the filename and format, or file a bug report
ERROR: postnuc returned non-zero

on the other hand removing the last A runs fine:

xx
CTTTTCTTCCGGCATCGGGAGCGATTCAATATCGCTGCCCACTTTATCCGGGATCGGCAATACG

Thanks,
Kirill Borziak

Discussion