Re: [Bio-bwa-help] wrong mapping
Status: Beta
Brought to you by:
lh3lh3
From: Shawn D. <sdr...@sa...> - 2014-07-17 15:28:58
|
Both alignments have a flag of 4 which means "unaligned". So in terms of the way those alignments would be interpreted by any downstream tools they are unaligned. I don't know the details but things happen at different stages within BWA so at times their can be seemingly conflicting info in an alignment however the flag field is trustworthy. I believe the SAM spec says if the flag is 4 you shouldn't trust any other fields. That appears to be good advise in this case. On Jul 17, 2014 3:13 AM, "Cloelia Dard-Dascot" < clo...@cg...> wrote: > Hi > i found out a weird behaving of BWA where it maps on the wrong part > > Here my reads which cause the problem pb.fastq: > @M01342:47:000000000-A9VMJ:1:2110:28593:14009 1:N:0:1 > ATCGGACCAGGCTTCATTCCC > + > CBCCCCCCCFCCGGGGGGGGG > @M01342:47:000000000-A9VMJ:1:2112:10072:14449 1:N:0:1 > ATCGGACCAGGCTTCATTCCC > + > AAABABBBBFAAFGGGGGGGG > > here is my reference genome brassica_pb.fa (actually they are micro RNA > but it should work also, right?) > >bna-miR167c_MIMAT0005628_Brassica_napus_miR167c > TGAAGCTGCCAGCATGATCTA > >bna-miR166a_MIMAT0005629_Brassica_napus_miR166a > TCGGACCAGGCTTCATTCCCC > > here are my commands: > /home/ctuser/Documents/programmes/bwa-0.7.10/bwa index brassica_pb.fa > /home/ctuser/Documents/programmes/bwa-0.7.10/bwa aln -t 12 -n 0 -k 0 > brassica_pb.fa pb.fastq > ./res_BWA_pb_newVersion/pb.sai > /home/ctuser/Documents/programmes/bwa-0.7.10/bwa samse brassica_pb.fa > ./res_BWA_pb_newVersion/pb.sai $f > ./res_BWA_pb_newVersion/pb.sam > > here is my sam file: > @SQ SN:bna-miR167c_MIMAT0005628_Brassica_napus_miR167c LN:21 > @SQ SN:bna-miR166a_MIMAT0005629_Brassica_napus_miR166a LN:21 > @PG ID:bwa PN:bwa VN:0.7.10-r789 > CL:/home/ctuser/Documents/programmes/bwa-0.7.10/bwa samse brassica_pb.fa > ./res_BWA_pb_newVersion/pb.sai pb.fastq > M01342:47:000000000-A9VMJ:1:2110:28593:14009 4 > bna-miR167c_MIMAT0005628_Brassica_napus_miR167c 21 25 21M * 0 0 > ATCGGACCAGGCTTCATTCCC CBCCCCCCCFCCGGGGGGGGG XT:A:U NM:i:0 X0:i:1 X1:i:0 > XM:i:0 XO:i:0 XG:i:0 MD:Z:21 > M01342:47:000000000-A9VMJ:1:2112:10072:14449 4 > bna-miR167c_MIMAT0005628_Brassica_napus_miR167c 21 25 21M * 0 0 > ATCGGACCAGGCTTCATTCCC AAABABBBBFAAFGGGGGGGG XT:A:U NM:i:0 X0:i:1 X1:i:0 > XM:i:0 XO:i:0 XG:i:0 MD:Z:21 > > we can see that both of the reads have been mapped to the first mir but > it should not have been mapped at all (or maybe to the second mir but I > have put into parameter no mismatch)!! > I tried three different versions of BWA (0.7.5, 0.6.1 and 0.7.10) but > same behaviour. > Did I do something wrong? > I must say it usually work fine and found the right mir but for two > cases includind this one, it found the mir just before the right one. Is > there a problem of length? > Thank for any help > > > > > ------------------------------------------------------------------------------ > Want fast and easy access to all the code in your enterprise? Index and > search up to 200,000 lines of code with a free copy of Black Duck > Code Sight - the same software that powers the world's largest code > search on Ohloh, the Black Duck Open Hub! Try it now. > http://p.sf.net/sfu/bds > _______________________________________________ > Bio-bwa-help mailing list > Bio...@li... > https://lists.sourceforge.net/lists/listinfo/bio-bwa-help > > |