mauve-users Mailing List for Mauve

Hi,

Few days ago, I upgraded my Ubuntu version 16.04 to 18.04, but after this
action the mauve viewer didn't work in my server.

So, I downloaded jre-8u162-linux-x64.tar.gz from Java Archive Downloads (
http://www.oracle.com/technetwork/java/javase/downloads/java-archive-javase8-2177648.html
),
typed tar -xzf  jre-8u162-linux-x64.tar.gz, and
changed the Mauve file in the mauve snapshot folder (JAVA_CMD=java
to JAVA_CMD=/jre-8u162-linux-x64/folder/bin/java).

Now it is working well.

Best,
Thank you,
Jun.

Hello,

my program is existed giving


Exited with error code: -2147483645


please help me on this.





Kabita

Sir,
Hope this mail will find you in sound. I was trying to align 13
apicomplexan genome using mauve. I got 6 outputs (attached without the
alignment file; its too large 297 mb and it may not necessary for current
discussion, I can provide if you think it is needed). My objective is to
create a phylogenetic tree using the alignment. Is it possible? I converted
the alignment to standard fasta format (attached) then to nexus and phylip
format for raxml and mrbayes. Everything seems ok. But the problem is my
alignment file contains 39 sequence which indicates I have exactly three
alignments inside one big alignment file. My question is, why I am getting
39 sequence instead of 13?  How can I use this alignment? Can I split it
into 3 individual fasta file and then convert them into phylip or nexus?
Thanks in advance.
Best Regards
Zillur Rahman
Phd Student at Bioinformatics Lab
University of Puerto Rico, Rio-Piedras

Hey there,

I aligned two Tuberculosis genomes with progressiveMauve with default
paramaters and got a puzzling result. (see below -I did not include the
sequence of the first block, as it is very long and not part of the problem)

I expect the sequences of the second and the last block to be aligned in
one single block as their sequences are almost the same... What could be
the reason for such a behaviour?

Thanks a lot,
Christine



#FormatVersion Mauve1
#Sequence1File GCF_000153685.2_ASM15368v2_genomic.fna
#Sequence1Format        FastA
#Sequence2File  GCF_001545055.1_ASM154505v1_genomic.fna
#Sequence2Format        FastA

> 1:103-4408223 + GCF_000153685.2_ASM15368v2_genomic.fna
....
> 2:2-4426387 + GCF_001545055.1_ASM154505v1_genomic.fna
...
=
> 1:1-102 + GCF_000153685.2_ASM15368v2_genomic.fna
TTTGTGGATAGCCATGTGGACAGTTCACCTGCCCACAACAACGGTTGTAGCTCGACCCGGAACCAAGACCCGGAACTAACGAGAACCAGGGAGATACGTCGT
=
> 1:4408224-4408224 + GCF_000153685.2_ASM15368v2_genomic.fna
A
=
> 2:1-1 + GCF_001545055.1_ASM154505v1_genomic.fna
T
=
> 2:4426388-4426489 + GCF_001545055.1_ASM154505v1_genomic.fna
ATTTGTGGATAGCCATGTGGACAGTTCACCTGCCCACAACAACGGTTGTAGCTCGACCCGGAACCAAGACCCGGAACTAACGAGAACCAGGGAGATACGTCG

Hi Mauve users

I am trying to run Mauve in Linux Ubuntu (64-bit) 16.10, with gui interface
called from terminal. Installation worked well but aligning is crashing
with error code 136. Please help!
Thank you!
Jorge

Hi Femi,
The error std::bad_alloc occurs in C++ programs when there is not
enough RAM in the machine to satisfy a memory allocation request.
I notice you are attempting an alignment of three genomes each around
2.3GB in size. It is likely that progressiveMauve will need a machine
with several hundred GB of RAM in order to do that, possibly more.
Best,
-Aaron
On Mon, 2017-05-29 at 16:40 +0200, femi abiodun elegbeleye wrote:
> 
> Hi everyone,what must I do to solved this mauve error problem.
> 
> 
> 
> trying path /home/bioifworkstation1/Desktop/mauve_snapshot_2015-02-
> 13/linux-x64/progressiveMauve
> Running alignment.
> Executing 
>   /home/bioifworkstation1/Desktop/mauve_snapshot_2015-02-13/linux-
> x64/progressiveMauve
>     --
> output=/media/bioifworkstation1/Bioinf2drive/Mauve/NewMauve1/Mauvetes
> t1
>     --output-guide-
> tree=/media/bioifworkstation1/Bioinf2drive/Mauve/NewMauve1/Mauvetest1
> .guide_tree
>     --backbone-
> output=/media/bioifworkstation1/Bioinf2drive/Mauve/NewMauve1/Mauvetes
> t1.backbone
>     /home/bioifworkstation1/Desktop/HR_fasta
>     /home/bioifworkstation1/Desktop/WR_fasta
>     /home/bioifworkstation1/Desktop/BR_fasta
> Storing raw sequence at /tmp/rawseq10955.000
> Sequence loaded successfully.
> /home/bioifworkstation1/Desktop/HR_fasta 2366941834 base pairs.
> Storing raw sequence at /tmp/rawseq10955.001
> Sequence loaded successfully.
> /home/bioifworkstation1/Desktop/WR_fasta 2464350348 base pairs.
> Storing raw sequence at /tmp/rawseq10955.002
> Sequence loaded successfully.
> /home/bioifworkstation1/Desktop/BR_fasta 2331675994 base pairs.
> Using weight 21 mers for initial seeds
> Creating sorted mer list
> Create time was: 4762 seconds.
> Creating sorted mer list
> Create time was: 5723 seconds.
> Creating sorted mer list
> Create time was: 4674 seconds.
> 0%..2%..3%..4%..5%..6%..7%..8%..9%..10%..
> 11%..12%..13%..14%..15%..16%..17%..18%..19%..20%..
> 21%..22%..23%..24%..25%..26%..27%..28%..29%..30%..
> 31%..32%..33%..34%..35%..36%..37%..38%..39%..40%..
> 41%..42%..43%..44%..45%..46%..47%..48%..49%..50%..
> 51%..52%..53%..54%..55%..56%..57%..58%..59%..60%..
> 61%..62%..63%..64%..65%..66%..67%..68%..69%..70%..
> 71%..72%..73%..74%..75%..76%..77%..78%..79%..80%..
> 81%..82%..83%..84%..85%..86%..87%..88%..89%..90%..
> 91%..92%..93%..94%..95%..96%..97%..98%..99%..100%..
> done.
> using default bp penalty: 218071
> using default bp estimate min score: 654212
> Starting with 92379629 multi-matches
> Computing genome content distance matrix...
> 
> 
> Genome conservation distance matrix: 
> 0    0.677953    0.682706
> 0.677953    0    0.152984
> 0.682706    0.152984    0
> 
> Writing guide tree to
> /media/bioifworkstation1/Bioinf2drive/Mauve/NewMauve1/Mauvetest1.guid
> e_tree
> reading tree...
> initializing alignment tree...
> Constructing seed occurrence lists for repeat detection
> Calculating pairwise breakpoint distances
> Pair 0, 1 has 23118547 initial LCBs
> Using scaled bp penalty: 7037.1
> terminate called after throwing an instance of 'std::bad_alloc'
>   what():  std::bad_alloc
> Exited with error code: 134
> 
> -------------------------------------------------------------------
> -----------
> Check out the vibrant tech community on one of the world's most
> engaging tech sites, Slashdot.org! http://sdm.link/slashdot
> _______________________________________________
> Mauve-users mailing list
> Mau...@li...
> https://lists.sourceforge.net/lists/listinfo/mauve-users
-- 
Aaron E. Darling, Ph.D.
Associate Professor, ithree institute
University of Technology Sydney
Australia

http://darlinglab.org
twitter: @koadman





UTS CRICOS Provider Code: 00099F
DISCLAIMER: This email message and any accompanying attachments may contain confidential information.
If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or
attachments. If you have received this message in error, please notify the sender immediately and delete
this message. Any views expressed in this message are those of the individual sender, except where the
sender expressly, and with authority, states them to be the views of the University of Technology Sydney.
Before opening any attachments, please check them for viruses and defects.

Think. Green. Do.

Please consider the environment before printing this email.

Hi everyone,what must I do to solved this mauve error problem.



trying path /home/bioifworkstation1/Desktop/mauve_snapshot_2015-
02-13/linux-x64/progressiveMauve
Running alignment.
Executing
  /home/bioifworkstation1/Desktop/mauve_snapshot_2015-02-13/linux-x64/
progressiveMauve
    --output=/media/bioifworkstation1/Bioinf2drive/Mauve/NewMauve1/
Mauvetest1
    --output-guide-tree=/media/bioifworkstation1/
Bioinf2drive/Mauve/NewMauve1/Mauvetest1.guide_tree
    --backbone-output=/media/bioifworkstation1/Bioinf2drive/Mauve/NewMauve1/
Mauvetest1.backbone
    /home/bioifworkstation1/Desktop/HR_fasta
    /home/bioifworkstation1/Desktop/WR_fasta
    /home/bioifworkstation1/Desktop/BR_fasta
Storing raw sequence at /tmp/rawseq10955.000
Sequence loaded successfully.
/home/bioifworkstation1/Desktop/HR_fasta 2366941834 <(236)%20694-1834> base
pairs.
Storing raw sequence at /tmp/rawseq10955.001
Sequence loaded successfully.
/home/bioifworkstation1/Desktop/WR_fasta 2464350348 <(246)%20435-0348> base
pairs.
Storing raw sequence at /tmp/rawseq10955.002
Sequence loaded successfully.
/home/bioifworkstation1/Desktop/BR_fasta 2331675994 base pairs.
Using weight 21 mers for initial seeds
Creating sorted mer list
Create time was: 4762 seconds.
Creating sorted mer list
Create time was: 5723 seconds.
Creating sorted mer list
Create time was: 4674 seconds.
0%..2%..3%..4%..5%..6%..7%..8%..9%..10%..
11%..12%..13%..14%..15%..16%..17%..18%..19%..20%..
21%..22%..23%..24%..25%..26%..27%..28%..29%..30%..
31%..32%..33%..34%..35%..36%..37%..38%..39%..40%..
41%..42%..43%..44%..45%..46%..47%..48%..49%..50%..
51%..52%..53%..54%..55%..56%..57%..58%..59%..60%..
61%..62%..63%..64%..65%..66%..67%..68%..69%..70%..
71%..72%..73%..74%..75%..76%..77%..78%..79%..80%..
81%..82%..83%..84%..85%..86%..87%..88%..89%..90%..
91%..92%..93%..94%..95%..96%..97%..98%..99%..100%..
done.
using default bp penalty: 218071
using default bp estimate min score: 654212
Starting with 92379629 multi-matches
Computing genome content distance matrix...


Genome conservation distance matrix:
0    0.677953    0.682706
0.677953    0    0.152984
0.682706    0.152984    0

Writing guide tree to /media/bioifworkstation1/Bioinf2drive/Mauve/NewMauve1/
Mauvetest1.guide_tree
reading tree...
initializing alignment tree...
Constructing seed occurrence lists for repeat detection
Calculating pairwise breakpoint distances
Pair 0, 1 has 23118547 initial LCBs
Using scaled bp penalty: 7037.1
terminate called after throwing an instance of 'std::bad_alloc'
  what():  std::bad_alloc
Exited with error code: 134

Hello, I would like to know if someone read my report sent two days ago,
and if is there anyone answering for issues on Mauve software. Thanks for
the attention.

Amaro Emiliano Trindade Silva
Professor Visitante da Pós Graduação em Farmacologia da Universidade
Federal do Ceará (UFC). Laboratório de Bioprospecção e Bioteconologia
Marinha (LABBMAR), Núcleo de Pesquisa e Desenvolvimento de Medicamentos
(NPDM), Rua Coronel Nunes de Melo, 1000, Rodolfo Teófilo,  Fortaleza - CE. CEP
60430-270
Telefone: (85)33668073; Celular - (85) 98114-2199 ou (85) 99789-2199

2017-05-15 11:58 GMT-06:00 Amaro Emiliano Trindade Silva <
atr...@gm...>:

> Hi, I've been trying to use Mauve at Mac (OS Sierra). When the alignment
> is done, I get the figure on mauve window, and can play with the view
> settings. However, every time I try to click on the link "score an assembly
> by DCJ, SNP, and GAP analysis" the program runs the scores and, when I try
> to save or roll the sidebar on the window to see the results, it freezes
> and the only way is forcing it to quit.
>
> What should I do for it not to freeze? Does it matters if I have the
> sequence files in different folders? Or if I save the results in a new
> folder? Also, what exactly means the LCB weight?
>
> Thanks a lot for the attention. Best,
>
> Amaro Emiliano Trindade Silva
> Professor Visitante da Pós Graduação em Farmacologia da Universidade
> Federal do Ceará (UFC). Laboratório de Bioprospecção e Bioteconologia
> Marinha (LABBMAR), Núcleo de Pesquisa e Desenvolvimento de Medicamentos
> (NPDM), Rua Coronel Nunes de Melo, 1000, Rodolfo Teófilo,  Fortaleza -
> CE. CEP 60430-270
> Telefone: (85)33668073; Celular - (85) 98114-2199 ou (85) 99789-2199
>

Hi, I've been trying to use Mauve at Mac (OS Sierra). When the alignment is
done, I get the figure on mauve window, and can play with the view
settings. However, every time I try to click on the link "score an assembly
by DCJ, SNP, and GAP analysis" the program runs the scores and, when I try
to save or roll the sidebar on the window to see the results, it freezes
and the only way is forcing it to quit.

What should I do for it not to freeze? Does it matters if I have the
sequence files in different folders? Or if I save the results in a new
folder? Also, what exactly means the LCB weight?

Thanks a lot for the attention. Best,

Amaro Emiliano Trindade Silva
Professor Visitante da Pós Graduação em Farmacologia da Universidade
Federal do Ceará (UFC). Laboratório de Bioprospecção e Bioteconologia
Marinha (LABBMAR), Núcleo de Pesquisa e Desenvolvimento de Medicamentos
(NPDM), Rua Coronel Nunes de Melo, 1000, Rodolfo Teófilo,  Fortaleza - CE. CEP
60430-270
Telefone: (85)33668073; Celular - (85) 98114-2199 ou (85) 99789-2199

Sounds like there is something unusual in one of your plasmid
sequences. It should take less than a minute to align a pair of
Borrelia-sized genomes, even with plasmids included. If you can send
the zipped genomes with plasmids to my personal email (off-list) I can
investigate further.
Best,
-Aaron
On Tue, 2017-04-11 at 14:26 +0000, Gab...@lg... wrote:
> Dear Aaron,
> thank you very much for the quick response. I will try that. I have
> to say that if I use only the main chromosome for the reference, the
> alignment works. So, perhaps I should explain that these are Borrelia
> genomes that I would like to align and they consist of a main
> chromosome and about 10 plasmids. If I use only the chromosom
> sequence, everything works fine. Just if I try to align the two
> complete genomes, I get this message. There is no other error
> message.
> I copied the files on my computer and started from there but the same
> happened again. Checking task manager, I can see javaw.exe but
> nothing seems to happen. However, when I try to close the window, it
> tells me that there is an alignment in progress and closing it would
> terminate the process. Is it possible that it just takes such a long
> time?
> Kind regards,
> Gabi
>  
> Gabriele Margos
> German National Reference Centre for Borrelia
> Bavarian Health and Food Safety Authority
> Veterinärstrasse 2
> 85764 Oberschleißheim
> Tel. 09131/68085883
> email: 
> gma...@gm...
> gab...@lg...
>  
>  
> Von: Aaron Darling [mailto:aar...@ut...] 
> Gesendet: Dienstag, 11. April 2017 11:28
> An: mau...@li...
> Betreff: Re: [Mauve-users] Mauve alignment not running
>  
> Hi Gabriele,
> First suggestion, try copying the sequence files from your file
> server over to the local disk (C:) and running the alignment, in
> order to rule out a network file access problem.
> If that fails, can you tell us what version of windows you are using,
> and also whether progressiveMauve.exe appears in the windows task
> manager when you run it?
> And was there any other error message that popped up? If not, can you
> try aligning the two files on another computer with a different OS
> (eg Mac) or version of Windows?
> Best,
> -Aaron
>  
> On Tue, 2017-04-11 at 07:37 +0000, Gab...@lg...
> wrote:
> Hi, I tried to make an alignment in Mauve using two fasta files. The
> alignment did not run but I got the following message:
>  
> OS name is: Windows 7 arch: amd64
> Executing:
> win64\progressiveMauve --output=\\umwelt.bayern.de\LGL-
> Users\Home\OS_L-Z\Margos_G\Dokumente\Bob Lane\CA690\Mauve
> CA690\PKo_CA690_genome_align\DN127_CA690 --output-guide-
> tree=\\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob
> Lane\CA690\Mauve CA690\PKo_CA690_genome_align\DN127_CA690.guide_tree
> --backbone-output=\\umwelt.bayern.de\LGL-Users\Home\OS_L-
> Z\Margos_G\Dokumente\Bob Lane\CA690\Mauve
> CA690\PKo_CA690_genome_align\DN127_CA690.backbone
> \\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob
> Lane\CA690\Mauve CA690\Bbis_DN127_complete_genome_reord.fasta
> \\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob
> Lane\CA690\Mauve CA690\CA690_DJ_spades_contigs_1000.fasta
>  
> What can I do?
>  
> Gabriele Margos
>  
> Gabriele Margos
> German National Reference Centre for Borrelia
> Bavarian Health and Food Safety Authority
> Veterinärstrasse 2
> 85764 Oberschleißheim
> Tel. 09131/68085883
> email: 
> gma...@gm...
> gab...@lg...
>  
>  
>  
> -- 
> Aaron E. Darling, Ph.D.
> Associate Professor, ithree institute
> University of Technology Sydney
> Australia
>  
> http://darlinglab.org
> twitter: @koadman
>  
>  
> UTS CRICOS Provider Code: 00099F DISCLAIMER: This email message and
> any accompanying attachments may contain confidential information. If
> you are not the intended recipient, do not read, use, disseminate,
> distribute or copy this message or attachments. If you have received
> this message in error, please notify the sender immediately and
> delete this message. Any views expressed in this message are those of
> the individual sender, except where the sender expressly, and with
> authority, states them to be the views of the University of
> Technology Sydney. Before opening any attachments, please check them
> for viruses and defects. Think. Green. Do. Please consider the
> environment before printing this email.
-- 
Aaron E. Darling, Ph.D.
Associate Professor, ithree institute
University of Technology Sydney
Australia

http://darlinglab.org
twitter: @koadman





UTS CRICOS Provider Code: 00099F
DISCLAIMER: This email message and any accompanying attachments may contain confidential information.
If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or
attachments. If you have received this message in error, please notify the sender immediately and delete
this message. Any views expressed in this message are those of the individual sender, except where the
sender expressly, and with authority, states them to be the views of the University of Technology Sydney.
Before opening any attachments, please check them for viruses and defects.

Think. Green. Do.

Please consider the environment before printing this email.

Dear Aaron,
thank you very much for the quick response. I will try that. I have to say that if I use only the main chromosome for the reference, the alignment works. So, perhaps I should explain that these are Borrelia genomes that I would like to align and they consist of a main chromosome and about 10 plasmids. If I use only the chromosom sequence, everything works fine. Just if I try to align the two complete genomes, I get this message. There is no other error message.
I copied the files on my computer and started from there but the same happened again. Checking task manager, I can see javaw.exe but nothing seems to happen. However, when I try to close the window, it tells me that there is an alignment in progress and closing it would terminate the process. Is it possible that it just takes such a long time?
Kind regards,
Gabi

Gabriele Margos
German National Reference Centre for Borrelia
Bavarian Health and Food Safety Authority
Veterinärstrasse 2
85764 Oberschleißheim
Tel. 09131/68085883
email:
gma...@gm...<mailto:gma...@gm...>
gab...@lg...<mailto:gab...@lg...>


Von: Aaron Darling [mailto:aar...@ut...]
Gesendet: Dienstag, 11. April 2017 11:28
An: mau...@li...
Betreff: Re: [Mauve-users] Mauve alignment not running

Hi Gabriele,
First suggestion, try copying the sequence files from your file server over to the local disk (C:) and running the alignment, in order to rule out a network file access problem.
If that fails, can you tell us what version of windows you are using, and also whether progressiveMauve.exe appears in the windows task manager when you run it?
And was there any other error message that popped up? If not, can you try aligning the two files on another computer with a different OS (eg Mac) or version of Windows?
Best,
-Aaron

On Tue, 2017-04-11 at 07:37 +0000, Gab...@lg...<mailto:Gab...@lg...> wrote:
Hi, I tried to make an alignment in Mauve using two fasta files. The alignment did not run but I got the following message:

OS name is: Windows 7 arch: amd64
Executing:
win64\progressiveMauve --output=\\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob Lane\CA690\Mauve CA690\PKo_CA690_genome_align\DN127_CA690 --output-guide-tree=\\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob Lane\CA690\Mauve CA690\PKo_CA690_genome_align\DN127_CA690.guide_tree --backbone-output=\\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob Lane\CA690\Mauve CA690\PKo_CA690_genome_align\DN127_CA690.backbone \\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob<file:///\\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob> Lane\CA690\Mauve CA690\Bbis_DN127_complete_genome_reord.fasta \\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob<file:///\\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob> Lane\CA690\Mauve CA690\CA690_DJ_spades_contigs_1000.fasta

What can I do?

Gabriele Margos

Gabriele Margos
German National Reference Centre for Borrelia
Bavarian Health and Food Safety Authority
Veterinärstrasse 2
85764 Oberschleißheim
Tel. 09131/68085883
email:
gma...@gm...<mailto:gma...@gm...>
gab...@lg...<mailto:gab...@lg...>





--

Aaron E. Darling, Ph.D.

Associate Professor, ithree institute

University of Technology Sydney

Australia



http://darlinglab.org

twitter: @koadman





________________________________
UTS CRICOS Provider Code: 00099F DISCLAIMER: This email message and any accompanying attachments may contain confidential information. If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or attachments. If you have received this message in error, please notify the sender immediately and delete this message. Any views expressed in this message are those of the individual sender, except where the sender expressly, and with authority, states them to be the views of the University of Technology Sydney. Before opening any attachments, please check them for viruses and defects. Think. Green. Do. Please consider the environment before printing this email.

Hi Gabriele,
First suggestion, try copying the sequence files from your file server
over to the local disk (C:) and running the alignment, in order to rule
out a network file access problem.
If that fails, can you tell us what version of windows you are using,
and also whether progressiveMauve.exe appears in the windows task
manager when you run it?
And was there any other error message that popped up? If not, can you
try aligning the two files on another computer with a different OS (eg
Mac) or version of Windows?
Best,
-Aaron
On Tue, 2017-04-11 at 07:37 +0000, Gab...@lg... wrote:
> Hi, I tried to make an alignment in Mauve using two fasta files. The
> alignment did not run but I got the following message:
>  
> OS name is: Windows 7 arch: amd64
> Executing:
> win64\progressiveMauve --output=\\umwelt.bayern.de\LGL-
> Users\Home\OS_L-Z\Margos_G\Dokumente\Bob Lane\CA690\Mauve
> CA690\PKo_CA690_genome_align\DN127_CA690 --output-guide-
> tree=\\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob
> Lane\CA690\Mauve CA690\PKo_CA690_genome_align\DN127_CA690.guide_tree
> --backbone-output=\\umwelt.bayern.de\LGL-Users\Home\OS_L-
> Z\Margos_G\Dokumente\Bob Lane\CA690\Mauve
> CA690\PKo_CA690_genome_align\DN127_CA690.backbone
> \\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob
> Lane\CA690\Mauve CA690\Bbis_DN127_complete_genome_reord.fasta
> \\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob
> Lane\CA690\Mauve CA690\CA690_DJ_spades_contigs_1000.fasta
>  
> What can I do?
>  
> Gabriele Margos
>  
> Gabriele Margos
> German National Reference Centre for Borrelia
> Bavarian Health and Food Safety Authority
> Veterinärstrasse 2
> 85764 Oberschleißheim
> Tel. 09131/68085883
> email: 
> gma...@gm...
> gab...@lg...
>  
> 
-- 
Aaron E. Darling, Ph.D.
Associate Professor, ithree institute
University of Technology Sydney
Australia

http://darlinglab.org
twitter: @koadman





UTS CRICOS Provider Code: 00099F
DISCLAIMER: This email message and any accompanying attachments may contain confidential information.
If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or
attachments. If you have received this message in error, please notify the sender immediately and delete
this message. Any views expressed in this message are those of the individual sender, except where the
sender expressly, and with authority, states them to be the views of the University of Technology Sydney.
Before opening any attachments, please check them for viruses and defects.

Think. Green. Do.

Please consider the environment before printing this email.

Hi, I tried to make an alignment in Mauve using two fasta files. The alignment did not run but I got the following message:

OS name is: Windows 7 arch: amd64
Executing:
win64\progressiveMauve --output=\\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob Lane\CA690\Mauve CA690\PKo_CA690_genome_align\DN127_CA690 --output-guide-tree=\\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob Lane\CA690\Mauve CA690\PKo_CA690_genome_align\DN127_CA690.guide_tree --backbone-output=\\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob Lane\CA690\Mauve CA690\PKo_CA690_genome_align\DN127_CA690.backbone \\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob Lane\CA690\Mauve CA690\Bbis_DN127_complete_genome_reord.fasta \\umwelt.bayern.de\LGL-Users\Home\OS_L-Z\Margos_G\Dokumente\Bob Lane\CA690\Mauve CA690\CA690_DJ_spades_contigs_1000.fasta

What can I do?

Gabriele Margos

Gabriele Margos
German National Reference Centre for Borrelia
Bavarian Health and Food Safety Authority
Veterinärstrasse 2
85764 Oberschleißheim
Tel. 09131/68085883
email:
gma...@gm...<mailto:gma...@gm...>
gab...@lg...<mailto:gab...@lg...>

Hi Nisha,
I notice in your screenshot that the genomes are labeled with "(no
annotations loaded)".
That means the viewer was unable to find and read the original sequence
file that was aligned.
This can happen if the files are moved around from their location after
alignment, especially if the full path name to the sequence file was
given during alignment.
Without reading the original sequence files, the viewer has no way of
knowing where the assembly contig (or chromosome in the case of fully
scaffolded chromosome assembly) boundaries are located, and therefore
can not show the vertical red bars at the boundaries.
There are at least two ways to solve the problem. One would be to
recompute the alignment with just the sequence file name (not full
path) and keep the output in the same directory, and if the files must
move, move these all together. Another approach would be to do a search
& replace in your existing alignment file to provide the correct file
paths to the two fasta files.
One comment about your objective: some of the fish lineages have
undergone whole genome duplication. progressiveMauve will only align
what its scoring function identifies as the contextually conserved copy
of a repeat, and in the case where one of the genomes has undergone a
WGD event the copy to align becomes ambiguous. It could be either copy
that gets aligned, or neither! So I suggest interpreting any results
from progressiveMauve with extreme caution if you are analysing
rearrangement rates in the presence of WGD.
-Aaron
On Mon, 2017-04-10 at 02:44 +0000, Esakimuthu Pillai Nisha PILLAI
wrote:
> Dear All,
>  
> I am using Mauve (progressive Mauve) to align whole genomes of two
> closely related genomes (grasscarp and zebrafish) and the objective
> is to determine the extent inter and intra-chromosomal
> rearrangements.
>  
> For this comparison, a seed weight of 19 and LCB weight of 2000 was
> used.  The resulting .XMFA alignment file was uploaded in the Mauve
> viewer. I am able to visualise the rearrangements between these two
> genomes.
>  
> However I couldn’t see any representation for the “inter-chromosomal
> boundaries” i.e. a line that demarcates the neighbouring chromosomes
> in the reference genome. From the Mauve viewer, Viewà Styles, the
> option for Chromosome/contig boundaries is turned on. Still, unable
> to see any lines that demarcate the chromosome boundaries (except the
> beginning and end of the whole genome). The sequences of all
> chromosomes are concatenated and the coordinates of the concatenated
> chromsomes are shown, without any marking demarcating the
> chromosomes.
>  
> I have attached a snapshot of the view (have turned off the LCB
> connecting lines for this snapshot). Can you kindly advise if there a
> way to visualise the boundary lines for each chromosome?. Also
> appreciate if you can comment on the suitability of the parameters
> (see weight and LCB weight) used by me for aligning these two
> genomes.
>  
> Thank you,
> Kind regards,
> Nisha
> 
> 
> Note: This message may contain confidential information. If this
> Email/Fax has been sent to you by mistake, please notify the sender
> and delete it immediately. Thank you.
>  ------------------------------------------------------------------
> ------------
> Check out the vibrant tech community on one of the world's most
> engaging tech sites, Slashdot.org! http://sdm.link/slashdot
> _______________________________________________
> Mauve-users mailing list
> Mau...@li...
> https://lists.sourceforge.net/lists/listinfo/mauve-users
-- 
Aaron E. Darling, Ph.D.
Associate Professor, ithree institute
University of Technology Sydney
Australia

http://darlinglab.org
twitter: @koadman





UTS CRICOS Provider Code: 00099F
DISCLAIMER: This email message and any accompanying attachments may contain confidential information.
If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or
attachments. If you have received this message in error, please notify the sender immediately and delete
this message. Any views expressed in this message are those of the individual sender, except where the
sender expressly, and with authority, states them to be the views of the University of Technology Sydney.
Before opening any attachments, please check them for viruses and defects.

Think. Green. Do.

Please consider the environment before printing this email.

Dear All,



I am using Mauve (progressive Mauve) to align whole genomes of two closely related genomes (grasscarp and zebrafish) and the objective is to determine the extent inter and intra-chromosomal rearrangements.



For this comparison, a seed weight of 19 and LCB weight of 2000 was used.  The resulting .XMFA alignment file was uploaded in the Mauve viewer. I am able to visualise the rearrangements between these two genomes.



However I couldn't see any representation for the "inter-chromosomal boundaries" i.e. a line that demarcates the neighbouring chromosomes in the reference genome. From the Mauve viewer, View--> Styles, the option for Chromosome/contig boundaries is turned on. Still, unable to see any lines that demarcate the chromosome boundaries (except the beginning and end of the whole genome). The sequences of all chromosomes are concatenated and the coordinates of the concatenated chromsomes are shown, without any marking demarcating the chromosomes.



I have attached a snapshot of the view (have turned off the LCB connecting lines for this snapshot). Can you kindly advise if there a way to visualise the boundary lines for each chromosome?. Also appreciate if you can comment on the suitability of the parameters (see weight and LCB weight) used by me for aligning these two genomes.



Thank you,
Kind regards,
Nisha


Note: This message may contain confidential information. If this Email/Fax has been sent to you by mistake, please notify the sender and delete it immediately. Thank you.

Hi Chris, no need to apologize, the list is for questions like this!
you might also find some of the web forums like biostars useful for
questions that aren't specific to mauve.
about your question, Mauve has zero support for amino acid alignment,
and it looks like the software is showing its displeasure for your data
by tossing out an incomprehensible error code. I suggest you pick up
some protein sequence alignment software. My current favorite is FSA
because it implements a mechanism for automatically fitting some of the
evolutionary parameters during alignment, but there are many, many
others.
-Aaron
On Sun, 2017-03-12 at 17:05 +0000, Chris Hastings wrote:
> Hello all,
> 
> Apologies if this is the wrong way to use this mailing list, I am
> still new to the format. 
> 
> I have been having issues with Mauve and was wondering if anyone
> could help me. 
> 
> I am trying to align 10 phage protein sequences using progressive
> mauve but have run into a number of problems, for the most part I
> have alleviated these by tweaking the format and renaming my files
> etc but today I was given the error code 1073740940 and have not been
> able to find information about it and how I can fix my issues.
> 
> Perhaps the issue is that I am using peptide sequences instead of
> nucleotide sequences but I am unsure, if no-one is able to help me
> with the error code I will try to back-translate my sequences and see
> if that works better.
> 
> Many thanks for any help,
> 
> Chris H
> -------------------------------------------------------------------
> -----------
> Announcing the Oxford Dictionaries API! The API offers world-renowned
> dictionary content that is easy and intuitive to access. Sign up for
> an
> account today to start using our lexical data to power your apps and
> projects. Get started today and enter our developer competition.
> http://sdm.link/oxford
> _______________________________________________
> Mauve-users mailing list
> Mau...@li...
> https://lists.sourceforge.net/lists/listinfo/mauve-users
-- 
Aaron E. Darling, Ph.D.
Associate Professor, ithree institute
University of Technology Sydney
Australia

http://darlinglab.org
twitter: @koadman





UTS CRICOS Provider Code: 00099F
DISCLAIMER: This email message and any accompanying attachments may contain confidential information.
If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or
attachments. If you have received this message in error, please notify the sender immediately and delete
this message. Any views expressed in this message are those of the individual sender, except where the
sender expressly, and with authority, states them to be the views of the University of Technology Sydney.
Before opening any attachments, please check them for viruses and defects.

Think. Green. Do.

Please consider the environment before printing this email.

Hello all,


Apologies if this is the wrong way to use this mailing list, I am still new to the format.


I have been having issues with Mauve and was wondering if anyone could help me.


I am trying to align 10 phage protein sequences using progressive mauve but have run into a number of problems, for the most part I have alleviated these by tweaking the format and renaming my files etc but today I was given the error code 1073740940 and have not been able to find information about it and how I can fix my issues.


Perhaps the issue is that I am using peptide sequences instead of nucleotide sequences but I am unsure, if no-one is able to help me with the error code I will try to back-translate my sequences and see if that works better.


Many thanks for any help,


Chris H

Hi Eleni,
Although progressiveMauve's algorithm is deterministic for a fixed
input, the algorithm itself contains some stochastic elements,
especially when aligning regions between the initial set of unique
alignment anchors. Therefore, changes to the input such as order of
genomes, or possibly ordering of contigs within genomes, can change the
resulting alignment.
It sounds like your one of your genomes contains a potential
rearrangement, possibly related to repeat elements, that has a score
very close to the default LCB score thresholds being used by
progressiveMauve. Although the default parameters were tuned to produce
good results on a wide range of datasets there is nothing sacred about
them, they can be changed to produce better results if necessary. I do
wonder if a positional homology alignment might miss part of the
picture on your data though, it may be worthwhile to check for repeat
structure across your genomes using another method.
Best,
-Aaron
On Wed, 2017-03-01 at 12:09 -0600, Eleni Mijalis wrote:
> Images didn't come through, sorry. Please see attached.
> 
> On Wed, Mar 1, 2017 at 12:01 PM, Eleni Mijalis <ele...@ta...
> > wrote:
> > Hey there,
> > 
> > I am having issues with getting different alignment results based
> > on the ordering of input files. 
> > 
> > I am aligning 7 genomes, and this is these are two examples of
> > alignments differing based on order:
> > 
> > 
> > 
> > 
> > As you can see, the first example gives 1 LCB spanning the entirety
> > of all the genomes, and the second example (same genomes, different
> > order) has more LCBs spanning different areas of each genome. These
> > two are just samples of what output I get based on input
> > permutation.
> > 
> > I am using default parameters, so should I adjust parameters to get
> > more consistent results? Why would ordering matter when determining
> > regions of similarity? Thanks for your help.
> > 
> > Eleni
> > 
> -------------------------------------------------------------------
> -----------
> Check out the vibrant tech community on one of the world's most
> engaging tech sites, SlashDot.org! http://sdm.link/slashdot
> _______________________________________________
> Mauve-users mailing list
> Mau...@li...
> https://lists.sourceforge.net/lists/listinfo/mauve-users
-- 
Aaron E. Darling, Ph.D.
Associate Professor, ithree institute
University of Technology Sydney
Australia

http://darlinglab.org
twitter: @koadman





UTS CRICOS Provider Code: 00099F
DISCLAIMER: This email message and any accompanying attachments may contain confidential information.
If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or
attachments. If you have received this message in error, please notify the sender immediately and delete
this message. Any views expressed in this message are those of the individual sender, except where the
sender expressly, and with authority, states them to be the views of the University of Technology Sydney.
Before opening any attachments, please check them for viruses and defects.

Think. Green. Do.

Please consider the environment before printing this email.

Hi Uwe, this information might only be implicit in the documentation.
Despite its use of MUSCLE, progressiveMauve only computes DNA-level
genome alignments. I am not aware of any software to compute protein-
level genome alignments (though it's been a while since I looked
around), possibly because the concept of a positional homology genome
alignment becomes less useful at the high levels of evolutionary
divergence that would require a switch to amino acid alignment. For
pairwise genome alignment there is a protein mode in MUMmer. For
multiple genomes you might look at gene family clustering approaches.
-Aaron
On Wed, 2017-03-08 at 13:00 +0100, Uwe Menzel wrote:
> Dear list,
> 
> as a newbie: how do I find out if progressiveMauve works on DNA or
> AA?
> The format specification provided is for DNA.
> On the other hand, Mauve uses Clustal and muscle alignment tools ...
> 
> Thanks!
> 
> 
> -------------------------------------------------------------------
> -----------
> Announcing the Oxford Dictionaries API! The API offers world-renowned
> dictionary content that is easy and intuitive to access. Sign up for
> an
> account today to start using our lexical data to power your apps and
> projects. Get started today and enter our developer competition.
> http://sdm.link/oxford
> _______________________________________________
> Mauve-users mailing list
> Mau...@li...
> https://lists.sourceforge.net/lists/listinfo/mauve-users
-- 
Aaron E. Darling, Ph.D.
Associate Professor, ithree institute
University of Technology Sydney
Australia

http://darlinglab.org
twitter: @koadman





UTS CRICOS Provider Code: 00099F
DISCLAIMER: This email message and any accompanying attachments may contain confidential information.
If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or
attachments. If you have received this message in error, please notify the sender immediately and delete
this message. Any views expressed in this message are those of the individual sender, except where the
sender expressly, and with authority, states them to be the views of the University of Technology Sydney.
Before opening any attachments, please check them for viruses and defects.

Think. Green. Do.

Please consider the environment before printing this email.

Dear list,

as a newbie: how do I find out if progressiveMauve works on DNA or AA?
The format specification provided is for DNA.
On the other hand, Mauve uses Clustal and muscle alignment tools ...

Thanks!

Images didn't come through, sorry. Please see attached.

On Wed, Mar 1, 2017 at 12:01 PM, Eleni Mijalis <ele...@ta...>
wrote:

> Hey there,
>
> I am having issues with getting different alignment results based on the
> ordering of input files.
>
> I am aligning 7 genomes, and this is these are two examples of alignments
> differing based on order:
> [image: Inline image 1]
>
> [image: Inline image 2]
>
> As you can see, the first example gives 1 LCB spanning the entirety of all
> the genomes, and the second example (same genomes, different order) has
> more LCBs spanning different areas of each genome. These two are just
> samples of what output I get based on input permutation.
>
> I am using default parameters, so should I adjust parameters to get more
> consistent results? Why would ordering matter when determining regions of
> similarity? Thanks for your help.
>
> Eleni
>

Can you check whether the directory where the sequence files are
located is writable by the compute node and has enough space to store
the sorted seed (k-mer) list? progressiveMauve does not use TMPDIR to
store those, they go in a file with the same name as the sequence file,
with a .sslist extension added. They require approximately 4.25
bytes/base, so in your case around 6GB for both sequences. That seems
like the most likely problem, but if that's not it then it would be
helpful if you could send me the sequence files somehow (google drive?
dropbox?) so I can check whether there's some kind of unexpected file
format parsing problem.
-Aaron
On Fri, 2017-02-10 at 10:50 +0100, sebastien letort wrote:
> Hi Aaron,
> 
> I have 190 GB of ram and more than 1TB of disk space available.
> I redefined TMPDIR to have enough space here too.
> The program fail again, at the same stage.
> 
> I only used one cultivar against its reference with default
> parameter.
> 
> Here are the last output lines of vmstat -S M -tn 1 before the prog
> did end.
> procs -----------memory---------- ---swap-- -----io---- --system-- 
> -----cpu------ ---timestamp---
>   2  0    621 191889     33  60193    0    0     0     0
> 2618  198  5  0 
> 95  0  0        2017-02-10 09:59:06 CET
>   2  0    621 191886     33  60196    0    0     0     0
> 2637  211  5  0 
> 95  0  0        2017-02-10 09:59:07 CET
>   2  0    621 191882     33  60200    0    0     0     0
> 2595  151  5  0 
> 95  0  0        2017-02-10 09:59:08 CET
>   2  0    621 191879     33  60203    0    0     0     0
> 2607  182  5  0 
> 95  0  0        2017-02-10 09:59:09 CET
>   2  0    621 192553     33  59538    0    0     0     0 4518
> 1093  4  0 
> 95  0  0        2017-02-10 09:59:10 CET
> 
> besst,
> Sébastien
> 
> Le 10/02/2017 à 02:31, Aaron Darling a écrit :
> > 
> > Hi Sébastien,
> > 
> > It's certainly possible to align genomes of that size with
> > progressiveMauve, but your computer will need enough RAM and disk
> > space,
> > and you will need some patience. I would suggest using entirely
> > default
> > parameters at first (--seed-family will use extra RAM & compute
> > time),
> > and it would be well worth ordering the contigs in your draft
> > genomes
> > against the reference before trying to compute a 3-way alignment.
> > In
> > terms of RAM you are likely to need 60-100GB available, with
> > similar
> > amounts of free disk space. The point at which your run failed is
> > where
> > it's trying to allocate a large block of RAM, so I suggest checking
> > that
> > first.
> > 
> > Best,
> > -Aaron
> > 
> > 
> > On Thu, 2017-02-09 at 14:07 +0100, sebastien letort wrote:
> > > 
> > > Hi everybody,
> > > 
> > > First try with progressiveMauve, and I got this error.
> > > 
> > > I'm trying to align two de novo assembly genome of Brassica napus
> > > on its
> > > reference (850 MB).
> > > It seems that something goes wrong on the first steps.
> > > 
> > > ./progressiveMauve --seed-family --seed-weight 41 $REF_FASTA
> > > $ASS_PATH/aviso.fa $ASS_PATH/tower.fa > run.log 2> run.err
> > > 
> > > This list makes reference to memory or version pb for this error.
> > > I launched the command on a cluster with a lot of memory.
> > > 
> > > ./progressiveMauve --version
> > > progressiveMauve  build date Feb 13 2015 at 05:57:13
> > > 
> > > I tried with default size for seed-weight, it didn't change the
> > > error.
> > > 
> > > Any help ?
> > > Sébastien
> > > 
> > > ------
> > > run.log
> > > Storing raw sequence at /tmp/rawseq11609.000
> > > Sequence loaded successfully.
> > > Brassica_napus_v4.1.chromosomes.fasta 850292103 base pairs.
> > > Storing raw sequence at /tmp/rawseq11609.001
> > > Sequence loaded successfully.
> > > aviso.fa 699132284 base pairs.
> > > Storing raw sequence at /tmp/rawseq11609.002
> > > Sequence loaded successfully.
> > > tower.fa 690335263 base pairs.
> > > Creating sorted mer list
> > > ****
> > > run.err
> > > Error creating sorted mer list
> > > terminate called after throwing an instance of
> > > 'genome::gnException'
> > > 
> > > (code error 134)
> > > 
> > > ---------------------------------------------------------------
> > > ---------------
> > > Check out the vibrant tech community on one of the world's most
> > > engaging tech sites, SlashDot.org! http://sdm.link/slashdot
> > > _______________________________________________
> > > Mauve-users mailing list
> > > Mau...@li...
> > > Mau...@li...>
> > > https://lists.sourceforge.net/lists/listinfo/mauve-users
> > > 
> > --
> > Aaron E. Darling, Ph.D.
> > Associate Professor, ithree institute
> > University of Technology Sydney
> > Australia
> > 
> > http://darlinglab.org
> > twitter: @koadman
> > 
> > 
> > -----------------------------------------------------------------
> > -------
> > UTS CRICOS Provider Code: 00099F DISCLAIMER: This email message and
> > any
> > accompanying attachments may contain confidential information. If
> > you
> > are not the intended recipient, do not read, use, disseminate,
> > distribute or copy this message or attachments. If you have
> > received
> > this message in error, please notify the sender immediately and
> > delete
> > this message. Any views expressed in this message are those of the
> > individual sender, except where the sender expressly, and with
> > authority, states them to be the views of the University of
> > Technology
> > Sydney. Before opening any attachments, please check them for
> > viruses
> > and defects. Think. Green. Do. Please consider the environment
> > before
> > printing this email.
> > 
> > 
> > 
> > -----------------------------------------------------------------
> > -------------
> > Check out the vibrant tech community on one of the world's most
> > engaging tech sites, SlashDot.org! http://sdm.link/slashdot
> > 
> > 
> > 
> > _______________________________________________
> > Mauve-users mailing list
> > Mau...@li...
> > https://lists.sourceforge.net/lists/listinfo/mauve-users
> > 
> -------------------------------------------------------------------
> -----------
> Check out the vibrant tech community on one of the world's most
> engaging tech sites, SlashDot.org! http://sdm.link/slashdot
> _______________________________________________
> Mauve-users mailing list
> Mau...@li...
> https://lists.sourceforge.net/lists/listinfo/mauve-users
-- 
Aaron E. Darling, Ph.D.
Associate Professor, ithree institute
University of Technology Sydney
Australia

http://darlinglab.org
twitter: @koadman





UTS CRICOS Provider Code: 00099F
DISCLAIMER: This email message and any accompanying attachments may contain confidential information.
If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or
attachments. If you have received this message in error, please notify the sender immediately and delete
this message. Any views expressed in this message are those of the individual sender, except where the
sender expressly, and with authority, states them to be the views of the University of Technology Sydney.
Before opening any attachments, please check them for viruses and defects.

Think. Green. Do.

Please consider the environment before printing this email.

Hi Aaron,

I have 190 GB of ram and more than 1TB of disk space available.
I redefined TMPDIR to have enough space here too.
The program fail again, at the same stage.

I only used one cultivar against its reference with default parameter.

Here are the last output lines of vmstat -S M -tn 1 before the prog did end.
procs -----------memory---------- ---swap-- -----io---- --system-- 
-----cpu------ ---timestamp---
  2  0    621 191889     33  60193    0    0     0     0 2618  198  5  0 
95  0  0        2017-02-10 09:59:06 CET
  2  0    621 191886     33  60196    0    0     0     0 2637  211  5  0 
95  0  0        2017-02-10 09:59:07 CET
  2  0    621 191882     33  60200    0    0     0     0 2595  151  5  0 
95  0  0        2017-02-10 09:59:08 CET
  2  0    621 191879     33  60203    0    0     0     0 2607  182  5  0 
95  0  0        2017-02-10 09:59:09 CET
  2  0    621 192553     33  59538    0    0     0     0 4518 1093  4  0 
95  0  0        2017-02-10 09:59:10 CET

besst,
Sébastien

Le 10/02/2017 à 02:31, Aaron Darling a écrit :
> Hi Sébastien,
>
> It's certainly possible to align genomes of that size with
> progressiveMauve, but your computer will need enough RAM and disk space,
> and you will need some patience. I would suggest using entirely default
> parameters at first (--seed-family will use extra RAM & compute time),
> and it would be well worth ordering the contigs in your draft genomes
> against the reference before trying to compute a 3-way alignment. In
> terms of RAM you are likely to need 60-100GB available, with similar
> amounts of free disk space. The point at which your run failed is where
> it's trying to allocate a large block of RAM, so I suggest checking that
> first.
>
> Best,
> -Aaron
>
>
> On Thu, 2017-02-09 at 14:07 +0100, sebastien letort wrote:
>> Hi everybody,
>>
>> First try with progressiveMauve, and I got this error.
>>
>> I'm trying to align two de novo assembly genome of Brassica napus on its
>> reference (850 MB).
>> It seems that something goes wrong on the first steps.
>>
>> ./progressiveMauve --seed-family --seed-weight 41 $REF_FASTA
>> $ASS_PATH/aviso.fa $ASS_PATH/tower.fa > run.log 2> run.err
>>
>> This list makes reference to memory or version pb for this error.
>> I launched the command on a cluster with a lot of memory.
>>
>> ./progressiveMauve --version
>> progressiveMauve  build date Feb 13 2015 at 05:57:13
>>
>> I tried with default size for seed-weight, it didn't change the error.
>>
>> Any help ?
>> Sébastien
>>
>> ------
>> run.log
>> Storing raw sequence at /tmp/rawseq11609.000
>> Sequence loaded successfully.
>> Brassica_napus_v4.1.chromosomes.fasta 850292103 base pairs.
>> Storing raw sequence at /tmp/rawseq11609.001
>> Sequence loaded successfully.
>> aviso.fa 699132284 base pairs.
>> Storing raw sequence at /tmp/rawseq11609.002
>> Sequence loaded successfully.
>> tower.fa 690335263 base pairs.
>> Creating sorted mer list
>> ****
>> run.err
>> Error creating sorted mer list
>> terminate called after throwing an instance of 'genome::gnException'
>>
>> (code error 134)
>>
>> ------------------------------------------------------------------------------
>> Check out the vibrant tech community on one of the world's most
>> engaging tech sites, SlashDot.org! http://sdm.link/slashdot
>> _______________________________________________
>> Mauve-users mailing list
>> Mau...@li...
>> <mailto:Mau...@li...>
>> https://lists.sourceforge.net/lists/listinfo/mauve-users
>>
> --
> Aaron E. Darling, Ph.D.
> Associate Professor, ithree institute
> University of Technology Sydney
> Australia
>
> http://darlinglab.org
> twitter: @koadman
>
>
> ------------------------------------------------------------------------
> UTS CRICOS Provider Code: 00099F DISCLAIMER: This email message and any
> accompanying attachments may contain confidential information. If you
> are not the intended recipient, do not read, use, disseminate,
> distribute or copy this message or attachments. If you have received
> this message in error, please notify the sender immediately and delete
> this message. Any views expressed in this message are those of the
> individual sender, except where the sender expressly, and with
> authority, states them to be the views of the University of Technology
> Sydney. Before opening any attachments, please check them for viruses
> and defects. Think. Green. Do. Please consider the environment before
> printing this email.
>
>
>
> ------------------------------------------------------------------------------
> Check out the vibrant tech community on one of the world's most
> engaging tech sites, SlashDot.org! http://sdm.link/slashdot
>
>
>
> _______________________________________________
> Mauve-users mailing list
> Mau...@li...
> https://lists.sourceforge.net/lists/listinfo/mauve-users
>

Hi Sébastien,
It's certainly possible to align genomes of that size with
progressiveMauve, but your computer will need enough RAM and disk
space, and you will need some patience. I would suggest using entirely
default parameters at first (--seed-family will use extra RAM & compute
time), and it would be well worth ordering the contigs in your draft
genomes against the reference before trying to compute a 3-way
alignment. In terms of RAM you are likely to need 60-100GB available,
with similar amounts of free disk space. The point at which your run
failed is where it's trying to allocate a large block of RAM, so I
suggest checking that first.
Best,
-Aaron
On Thu, 2017-02-09 at 14:07 +0100, sebastien letort wrote:
> Hi everybody,
> 
> First try with progressiveMauve, and I got this error.
> 
> I'm trying to align two de novo assembly genome of Brassica napus on
> its 
> reference (850 MB).
> It seems that something goes wrong on the first steps.
> 
> ./progressiveMauve --seed-family --seed-weight 41 $REF_FASTA 
> $ASS_PATH/aviso.fa $ASS_PATH/tower.fa > run.log 2> run.err
> 
> This list makes reference to memory or version pb for this error.
> I launched the command on a cluster with a lot of memory.
> 
> ./progressiveMauve --version
> progressiveMauve  build date Feb 13 2015 at 05:57:13
> 
> I tried with default size for seed-weight, it didn't change the
> error.
> 
> Any help ?
> Sébastien
> 
> ------
> run.log
> Storing raw sequence at /tmp/rawseq11609.000
> Sequence loaded successfully.
> Brassica_napus_v4.1.chromosomes.fasta 850292103 base pairs.
> Storing raw sequence at /tmp/rawseq11609.001
> Sequence loaded successfully.
> aviso.fa 699132284 base pairs.
> Storing raw sequence at /tmp/rawseq11609.002
> Sequence loaded successfully.
> tower.fa 690335263 base pairs.
> Creating sorted mer list
> ****
> run.err
> Error creating sorted mer list
> terminate called after throwing an instance of 'genome::gnException'
> 
> (code error 134)
> 
> -------------------------------------------------------------------
> -----------
> Check out the vibrant tech community on one of the world's most
> engaging tech sites, SlashDot.org! http://sdm.link/slashdot
> _______________________________________________
> Mauve-users mailing list
> Mau...@li...
> https://lists.sourceforge.net/lists/listinfo/mauve-users
> 
-- 
Aaron E. Darling, Ph.D.
Associate Professor, ithree institute
University of Technology Sydney
Australia

http://darlinglab.org
twitter: @koadman





UTS CRICOS Provider Code: 00099F
DISCLAIMER: This email message and any accompanying attachments may contain confidential information.
If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or
attachments. If you have received this message in error, please notify the sender immediately and delete
this message. Any views expressed in this message are those of the individual sender, except where the
sender expressly, and with authority, states them to be the views of the University of Technology Sydney.
Before opening any attachments, please check them for viruses and defects.

Think. Green. Do.

Please consider the environment before printing this email.

Hi everybody,

First try with progressiveMauve, and I got this error.

I'm trying to align two de novo assembly genome of Brassica napus on its 
reference (850 MB).
It seems that something goes wrong on the first steps.

./progressiveMauve --seed-family --seed-weight 41 $REF_FASTA 
$ASS_PATH/aviso.fa $ASS_PATH/tower.fa > run.log 2> run.err

This list makes reference to memory or version pb for this error.
I launched the command on a cluster with a lot of memory.

./progressiveMauve --version
progressiveMauve  build date Feb 13 2015 at 05:57:13

I tried with default size for seed-weight, it didn't change the error.

Any help ?
Sébastien

------
run.log
Storing raw sequence at /tmp/rawseq11609.000
Sequence loaded successfully.
Brassica_napus_v4.1.chromosomes.fasta 850292103 base pairs.
Storing raw sequence at /tmp/rawseq11609.001
Sequence loaded successfully.
aviso.fa 699132284 base pairs.
Storing raw sequence at /tmp/rawseq11609.002
Sequence loaded successfully.
tower.fa 690335263 base pairs.
Creating sorted mer list
****
run.err
Error creating sorted mer list
terminate called after throwing an instance of 'genome::gnException'

(code error 134)