Name | Modified | Size | Downloads / Week |
---|---|---|---|
o2n-sam2sites | 2017-02-09 | 204.5 kB | |
seq_tool_fq_rc.pl | 2017-02-09 | 2.2 kB | |
seq_clipper.tgz | 2017-02-09 | 10.4 kB | |
pairaln-1.0.rar | 2017-02-09 | 61.5 kB | |
o2n-seq README.txt | 2017-02-09 | 2.1 kB | |
fq-line-merge.pl | 2017-02-09 | 685 Bytes | |
o2n-merge-base-5.pl | 2017-02-09 | 1.6 kB | |
adaptor.pl | 2017-02-09 | 833 Bytes | |
Totals: 8 Items | 283.8 kB | 0 |
Before use, please 1) Install bwa, samtools, Trimmomatic 2) Make file of seq_clipper and pairaln 1. Remove the first five bases and intermediate adaptor from the read pairs (read 1 and read 2). perl -e '{while($line1=<>){$line2=<>;@a=split(//,$line2);$line3=<>;$line4=<>;@b=split(//,$line4);print $line1;print join("",@a[5..$#a]);print $line3;print join("",@b[5..$#b]);}}' FILE_1_clean.fq | seq_clipper -f FQ -a AGATCAGTCGTTCACCGACT -a AGATCAGTCGTACGTGCTTA > FILE.R1.fq perl -e '{while($line1=<>){$line2=<>;@a=split(//,$line2);$line3=<>;$line4=<>;@b=split(//,$line4);print $line1;print join("",@a[5..$#a]);print $line3;print join("",@b[5..$#b]);}}' FILE_2_clean.fq | seq_clipper -f FQ -a AGATCAGTCGTTCACCGACT -a AGATCAGTCGTACGTGCTTA > FILE.R2.fq perl seq_tool_fq_rc.pl FILE.R2.fq perl adaptor.pl FILE.R1.fq RC_FILE.R2.fq 2. Filter out low-quality read pairs. java -jar trimmomatic-0.33.jar PE -threads 4 -phred33 -trimlog adp-FILE-trim.log adp-FILE.R1.fq adp-RC_FILE.R2.fq adp-FILE.R1-p.fq adp-FILE.R1-u.fq adp-RC_FILE.R2-p.fq adp-RC_FILE.R2-u.fq TRAILING:20 SLIDINGWINDOW:4:20 MINLEN:36 AVGQUAL:20 3. Determine the consensus sequence from read 1 and read 2 by aligning them to each other. perl fq-line-merge.pl adp-FILE.R1-p.fq adp-RC_FILE.R2-p.fq adp-FILE-trim.m.fq pairaln -M 1 -X -3 -O -150 -E -150 -T 0 -a adp-FILE-trim.m.fq > adp-FILE-trim.m.aln.fq 4. Assign quality scores for the consensus sequence according to the bases of read 1 and read 2. perl o2n-merge-base-5.pl adp-FILE-trim.m.aln.fq > adp-FILE-trim.o2n 5. Map the consensus sequence with modified quality to the reference genome and perform variance calling. bwa aln -t 4 $DB adp-FILE-trim.o2n > adp-FILE-trim.aln bwa samse $DB adp-FILE-trim.aln adp-FILE-trim.o2n > adp-FILE-trim.sam samtools view -bt $DB.fai adp-FILE-trim.sam > adp-FILE-trim.bam samtools sort adp-FILE-trim.bam adp-FILE-trim.srt samtools index adp-FILE-trim.srt.bam samtools view adp-FILE-trim.srt.bam | o2n-sam2sites > adp-FILE-trim.pileup NOTE: This pairaln modified from smartdenove assembler developed by Jue Ruan.