transdecoder-users Mailing List for TranscriptDecoder (Page 4)
Extracting likely coding regions from transcript sequences
Brought to you by:
bhaas
Menu
▾
▴
transdecoder-users — Technical support and project announcements
You can subscribe to this list here.
| 2013 |
Jan
|
Feb
|
Mar
|
Apr
|
May
|
Jun
|
Jul
|
Aug
|
Sep
|
Oct
|
Nov
|
Dec
(8) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2014 |
Jan
(12) |
Feb
(14) |
Mar
(4) |
Apr
(8) |
May
(17) |
Jun
(14) |
Jul
(21) |
Aug
(8) |
Sep
(5) |
Oct
(8) |
Nov
(1) |
Dec
(1) |
| 2015 |
Jan
(9) |
Feb
|
Mar
|
Apr
|
May
|
Jun
|
Jul
|
Aug
|
Sep
|
Oct
|
Nov
|
Dec
|
|
From: Edward G. <e.g...@im...> - 2014-05-12 04:00:10
|
Hello I've been trying to run Transdecoder with pfam searching on transcriptome assemblies that I made using Soapdenovo-Trans(SdT). With different assemblies and different PBS parameters (like where I place the data on our system's parallel shared file system etc), Transdecoder creates the temp directory with some of the intermediate files. No finished output files are ever produced. Once I got the .dat file with the pfam hits for my assembly but there were no final .pep .gff3 .cds or .bed files produced and stored anywhere. Am I missing something? Unlike Trinity, SdT plugs in Ns if there is an expected gap between the fragments of a transcript. Could these Ns be tripping up Transdecoder? NOTES: My scripts load the modules our system operators made for Transdecoder and hmmer before sending commands for Transdecoder. These are example entries from my input fasta: >centroid=Fi49merScaf_11503;seqs=3; AACTAAGGGTTTGTTGCTTTTATCAGCGAAATATATTAATGTTTTTAAATTATAGTTGACAACTTTACCGATGAACTATTGAGGTACAGCTTTTTGGGAACATATAGTCTAGTGCCAAGTCCTTCTAGTGCTTTCACACACTCGGCAATACTCTCTTCACTATCAATGTCCATGTTCCAAATTGCCGC... >centroid=Fi49merScaf_29126;seqs=1; TTGGCTGAGAGAACTTACACAAGCCACTTATCGAGCTTCTGCCCCTCCGCCCATCAACATACTTGGAGAACTAAGCAATGATGTAGCGGAAACTGCTGAACCTAGAGCTGTAAATGCTAGGACAGCGGATCTTGTTGTTAATGGAACACTGATTGAGATGAAGTTATCATTATATGTGAAGG... centroid=Fi49merScaf_29118;seqs=1; CTGACATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCAAATAGACTGTACAGCATTATAGACAGGTACCTCACAGACTTAAAAAGCCCTTAAGACTGTTTTCCTGTAAAAGAATCTCCTTTTTTAACACAGAAATTATCTACAAAATCTAATTCGGAGACCACGGTGTTAACCAAATC... Thanks Ed Dr. Edward K Gilding The Institute of Molecular Biosciences The University of Queensland Brisbane, QLD 4072 Australia O: +61 07 3346 2014 |
|
From: <Ale...@cs...> - 2014-05-03 07:25:11
|
Hello I never used it with another species. Are you sure you want to do this? If you do then certainly filter out the low confidence ORFs WRT the optio --train <string> FASTA file with ORFs to train Markov Mod for protein identification; otherwise longest non-redundant ORFs used So basically give it a FASTA file with open reading frames (ORFs i.e. CDS, codons, etc). If you don't provide --train then the longest (non-redundant) ORFs are used. If you assembly is RNASeq and is decent then I think that should be good. If you do decide to try with a different species, I'd be keen to know what the results are. I guess one metric is how many unique PFAM hits you get from a protein translation (unique so that isoforms/alleles don't exagerrate stats). Compare that with the official annotation of a related species... a -- Dr. Alexie Papanicolaou Phone: +61(0) 2 6246 4511| Mobile: +61 (0) 46 85 81 247 CSIRO Ecosystem Sciences, GPO Box 1700, Canberra 2601, ACT, Australia -- CSIRO profile<http://www.csiro.au/Organisation-Structure/Divisions/Ecosystem-Sciences/AlexiePapanicolaou.aspx> -- ResearcherID<http://www.researcherid.com/rid/A-1618-2011> -- Vision without action is dreaming -- Action without vision is waste ________________________________ From: Brian Haas [bh...@br...] Sent: Friday, 2 May 2014 10:04 PM To: 卢 汉斌 Cc: tra...@li...; Papanicolaou, Alexie (CES, Black Mountain) Subject: Re: [Transdecoder-users] File for Training Alexie - can you respond to this? It's one of the options you incorporated. thanks, ~brian On Fri, May 2, 2014 at 5:37 AM, 卢 汉斌 <lh...@gm...<mailto:lh...@gm...>> wrote: Hello, I try to find coding regions within transcripts using TransDecoder. I want to use the close species (with relatively detailed genome annotation) to train Markov Mod for protein identification. I don’t quite understand what kind of file should I transmit to “―train” option, whether the annotation protein FASTA file or annotation CDS FASTA file of the close species? Also, the annotation proteins of this close species still contain a portion of low confidence genes. Should I filter out those low confidence genes or pick up some high confidence ORFs for training Markov Mod? Thank you for you advise. Best, David ------------------------------------------------------------------------------ "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE Instantly run your Selenium tests across 300+ browser/OS combos. Get unparalleled scalability from the best Selenium testing platform available. Simple to use. Nothing to install. Get started now for free." http://p.sf.net/sfu/SauceLabs _______________________________________________ Transdecoder-users mailing list Tra...@li...<mailto:Tra...@li...> https://lists.sourceforge.net/lists/listinfo/transdecoder-users -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Brian H. <bh...@br...> - 2014-05-02 12:05:02
|
Alexie - can you respond to this? It's one of the options you incorporated. thanks, ~brian On Fri, May 2, 2014 at 5:37 AM, 卢 汉斌 <lh...@gm...> wrote: > Hello, > > I try to find coding regions within transcripts using TransDecoder. I > want to use the close species (with relatively detailed genome annotation) > to train Markov Mod for protein identification. I don’t quite understand > what kind of file should I transmit to “—train” option, whether the > annotation protein FASTA file or annotation CDS FASTA file of the close > species? > > Also, the annotation proteins of this close species still contain a > portion of low confidence genes. Should I filter out those low confidence > genes or pick up some high confidence ORFs for training Markov Mod? > > Thank you for you advise. > > Best, > David > > ------------------------------------------------------------------------------ > "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE > Instantly run your Selenium tests across 300+ browser/OS combos. Get > unparalleled scalability from the best Selenium testing platform available. > Simple to use. Nothing to install. Get started now for free." > http://p.sf.net/sfu/SauceLabs > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: 卢 汉斌 <lh...@gm...> - 2014-05-02 09:37:45
|
Hello, I try to find coding regions within transcripts using TransDecoder. I want to use the close species (with relatively detailed genome annotation) to train Markov Mod for protein identification. I don’t quite understand what kind of file should I transmit to “—train” option, whether the annotation protein FASTA file or annotation CDS FASTA file of the close species? Also, the annotation proteins of this close species still contain a portion of low confidence genes. Should I filter out those low confidence genes or pick up some high confidence ORFs for training Markov Mod? Thank you for you advise. Best, David |
|
From: Brian H. <bh...@br...> - 2014-05-01 17:19:18
|
Great! Thanks for the update! ~b On Thu, May 1, 2014 at 1:07 PM, ERIC WAFULA <ek...@ps...> wrote: > Brian, > > Thanks very much! That solved the problem. > TransDecoder now running okay. > > Eric > > > On Thu, May 1, 2014 at 11:18 AM, Brian Haas <bh...@br...>wrote: > >> Hi Eric, >> >> Try this too: >> >> make cdhit >> >> and then run the sample data. >> >> best, >> >> ~brian >> >> >> On Thu, May 1, 2014 at 9:16 AM, ERIC WAFULA <ek...@ps...> wrote: >> >>> Brian >>> >>> I am building on linux machine (centos 5.8). >>> "make parafly" completed okay, but i get an error mesaage when running >>> running the test script. something to do cd >>> >>> [ekw10@comandra sample_data]$ ./runMe.sh >>> >>> -parsing cufflinks output: transcripts.gtf >>> >>> -parsing genome fasta: test.genome.fasta >>> >>> -done parsing genome. >>> >>> // processing 7000000090838467 >>> >>> CMD: >>> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/ >>> get_top_longest_fasta_entries.pltransdecoder.tmp.nopfam/longest_orfs.cds 2000 > >>> transdecoder.tmp.nopfam/redundant_top >>> >>> CMD: >>> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est >>> -r 1 -i transdecoder.tmp.nopfam/redundant_top -o >>> transdecoder.tmp.nopfam/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null >>> >>> *Error, cmd: >>> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est >>> -r 1 -i transdecoder.tmp.nopfam/redundant_top -o >>> transdecoder.tmp.nopfam/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null >>> died with ret 256 at ../TransDecoder line 498.* >>> >>> >>> I aslo tried with my own dataset, and am getting the folllowing error: >>> >>> ekw10@comandra assembly]$ >>> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/TransDecoder >>> -t OrAe0GB1.fasta >>> >>> CMD: >>> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/ >>> get_top_longest_fasta_entries.pltransdecoder.tmp.28440/longest_orfs.cds 2000 > >>> transdecoder.tmp.28440/redundant_top >>> >>> CMD: >>> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est >>> -r 1 -i transdecoder.tmp.28440/redundant_top -o >>> transdecoder.tmp.28440/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null >>> >>> E*rror, cmd: >>> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est >>> -r 1 -i transdecoder.tmp.28440/redundant_top -o >>> transdecoder.tmp.28440/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null >>> died with ret 256 at >>> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/TransDecoder >>> line 498. * >>> >>> >>> *Eric* >>> >>> >>> On Wed, Apr 30, 2014 at 9:41 PM, Brian Haas <bh...@br...>wrote: >>> >>>> Hi Eric, >>>> >>>> Are you building this on linux or mac? If mac, I've never gotten >>>> ffindex to build on mac - only linux. >>>> >>>> In any case, you can use transdecoder without using the ffindex. You >>>> can try >>>> >>>> make parafly >>>> >>>> and then >>>> >>>> cd sample_data && runMe.sh >>>> >>>> and see if it works. >>>> >>>> best, >>>> >>>> ~brian >>>> >>>> >>>> >>>> On Wed, Apr 30, 2014 at 6:30 PM, ERIC WAFULA <ek...@ps...> wrote: >>>> >>>>> Hi Brian, >>>>> >>>>> I tried for days now install transdecoder without success. I keep >>>>> getting ffindex error to do with some kind of incompatabilty. >>>>> >>>>> sudo make >>>>> >>>>> if [[ ! -s pfam/Pfam-AB.hmm.bin ]]; then echo "Downloading PFAM >>>>> database" && wget ' >>>>> http://sourceforge.net/projects/transdecoder/files/Pfam-AB.hmm.bin/download' >>>>> -O pfam/Pfam-AB.hmm.bin; fi >>>>> >>>>> if [[ ! -e pfam/Pfam-AB.hmm.bin.h3i ]]; then echo "Preparing PFAM >>>>> database" && hmmpress pfam/Pfam-AB.hmm.bin; fi >>>>> >>>>> cd 3rd_party/ffindex && make HAVE_MPI=1 && make install >>>>> INSTALL_DIR=../../../util HAVE_MPI=1 >>>>> >>>>> make[1]: Entering directory >>>>> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3' >>>>> >>>>> make -C src -f Makefile all >>>>> >>>>> make[2]: Entering directory >>>>> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3/src' >>>>> >>>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 >>>>> -c -o ffindex_apply.o ffindex_apply.c >>>>> >>>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 >>>>> -c -o ffindex.o ffindex.c >>>>> >>>>> ffindex.c: In function 'ffindex_tree_write': >>>>> >>>>> ffindex.c:518: warning: ISO C forbids nested functions >>>>> >>>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 >>>>> -c -o ffutil.o ffutil.c >>>>> >>>>> gcc -fopenmp -Wl,-z,defs -shared -Wl,-soname,libffindex.so.0.1 -o >>>>> libffindex.so.0.1 ffindex.o ffutil.o -lc >>>>> >>>>> ln -sf libffindex.so.0.1 libffindex.so >>>>> >>>>> gcc -fopenmp -lffindex -L. ffindex_apply.o libffindex.so >>>>> libffindex.so.0.1 ffindex.h -o ffindex_apply >>>>> >>>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 >>>>> -c -o ffindex_from_fasta.o ffindex_from_fasta.c >>>>> >>>>> gcc -fopenmp -o ffindex_from_fasta ffindex_from_fasta.o -lffindex -L. >>>>> -L. -lffindex >>>>> >>>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 >>>>> -c -o ffindex_get.o ffindex_get.c >>>>> >>>>> gcc -fopenmp -o ffindex_get ffindex_get.o -lffindex -L. -L. -lffindex >>>>> >>>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 >>>>> -c -o ffindex_build.o ffindex_build.c >>>>> >>>>> gcc -fopenmp -o ffindex_build ffindex_build.o -lffindex -L. -L. >>>>> -lffindex >>>>> >>>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 >>>>> -c -o ffindex_modify.o ffindex_modify.c >>>>> >>>>> gcc -fopenmp -o ffindex_modify ffindex_modify.o -lffindex -L. -L. >>>>> -lffindex >>>>> >>>>> ar rcs libffindex.a ffutil.o ffindex.o >>>>> >>>>> gcc -fopenmp -o ffindex_unpack ffindex_unpack.o -lffindex -L. -L. >>>>> -lffindex >>>>> >>>>> mpicc -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>>>> ffindex_apply_mpi.c -o ffindex_apply_mpi.o >>>>> >>>>> ffindex_apply_mpi.c: In function 'ffindex_apply_by_entry': >>>>> >>>>> ffindex_apply_mpi.c:151: warning: format '%ld' expects type 'long >>>>> int', but argument 4 has type 'size_t' >>>>> >>>>> ffindex_apply_mpi.c:151: warning: format '%ld' expects type 'long >>>>> int', but argument 5 has type 'size_t' >>>>> >>>>> mpicc -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -o >>>>> ffindex_apply_mpi ffindex_apply_mpi.o -lffindex -L. >>>>> >>>>> */usr/bin/ld: skipping incompatible ./libffindex.so when searching for >>>>> -lffindex* >>>>> >>>>> */usr/bin/ld: skipping incompatible ./libffindex.a when searching for >>>>> -lffindex* >>>>> >>>>> */usr/bin/ld: cannot find -lffindex* >>>>> >>>>> *collect2: ld returned 1 exit status* >>>>> >>>>> *make[2]: *** [ffindex_apply_mpi] Error 1* >>>>> >>>>> *make[2]: Leaving directory >>>>> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3/src'* >>>>> >>>>> *make[1]: *** [all] Error 2* >>>>> >>>>> *make[1]: Leaving directory >>>>> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3'* >>>>> >>>>> *make: *** [ffindex] Error 2* >>>>> >>>>> Thanks for your help. >>>>> >>>>> Eric >>>>> >>>>> >>>>> -- >>>>> Eric Kenneth Wafula >>>>> Bioinformatics Programmer >>>>> Claude dePamphilis Lab >>>>> Department of Biology >>>>> Penn State University >>>>> 814-865-2449 >>>>> ek...@ps... >>>>> >>>>> >>>>> ------------------------------------------------------------------------------ >>>>> "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE >>>>> Instantly run your Selenium tests across 300+ browser/OS combos. Get >>>>> unparalleled scalability from the best Selenium testing platform >>>>> available. >>>>> Simple to use. Nothing to install. Get started now for free." >>>>> http://p.sf.net/sfu/SauceLabs >>>>> _______________________________________________ >>>>> Transdecoder-users mailing list >>>>> Tra...@li... >>>>> https://lists.sourceforge.net/lists/listinfo/transdecoder-users >>>>> >>>>> >>>> >>>> >>>> -- >>>> -- >>>> Brian J. Haas >>>> The Broad Institute >>>> http://broad.mit.edu/~bhaas >>>> >>>> >>>> >>> >>> >>> >>> -- >>> Eric Kenneth Wafula >>> Bioinformatics Programmer >>> Claude dePamphilis Lab >>> Department of Biology >>> Penn State University >>> 814-865-2449 >>> ek...@ps... >>> >> >> >> >> -- >> -- >> Brian J. Haas >> The Broad Institute >> http://broad.mit.edu/~bhaas >> >> >> > > > > -- > Eric Kenneth Wafula > Bioinformatics Programmer > Claude dePamphilis Lab > Department of Biology > Penn State University > 814-865-2449 > ek...@ps... > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: ERIC W. <ek...@ps...> - 2014-05-01 17:07:47
|
Brian, Thanks very much! That solved the problem. TransDecoder now running okay. Eric On Thu, May 1, 2014 at 11:18 AM, Brian Haas <bh...@br...>wrote: > Hi Eric, > > Try this too: > > make cdhit > > and then run the sample data. > > best, > > ~brian > > > On Thu, May 1, 2014 at 9:16 AM, ERIC WAFULA <ek...@ps...> wrote: > >> Brian >> >> I am building on linux machine (centos 5.8). >> "make parafly" completed okay, but i get an error mesaage when running >> running the test script. something to do cd >> >> [ekw10@comandra sample_data]$ ./runMe.sh >> >> -parsing cufflinks output: transcripts.gtf >> >> -parsing genome fasta: test.genome.fasta >> >> -done parsing genome. >> >> // processing 7000000090838467 >> >> CMD: >> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/ >> get_top_longest_fasta_entries.pltransdecoder.tmp.nopfam/longest_orfs.cds 2000 > >> transdecoder.tmp.nopfam/redundant_top >> >> CMD: >> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est >> -r 1 -i transdecoder.tmp.nopfam/redundant_top -o >> transdecoder.tmp.nopfam/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null >> >> *Error, cmd: >> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est >> -r 1 -i transdecoder.tmp.nopfam/redundant_top -o >> transdecoder.tmp.nopfam/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null >> died with ret 256 at ../TransDecoder line 498.* >> >> >> I aslo tried with my own dataset, and am getting the folllowing error: >> >> ekw10@comandra assembly]$ >> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/TransDecoder >> -t OrAe0GB1.fasta >> >> CMD: >> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/ >> get_top_longest_fasta_entries.pl transdecoder.tmp.28440/longest_orfs.cds >> 2000 > transdecoder.tmp.28440/redundant_top >> >> CMD: >> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est >> -r 1 -i transdecoder.tmp.28440/redundant_top -o >> transdecoder.tmp.28440/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null >> >> E*rror, cmd: >> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est >> -r 1 -i transdecoder.tmp.28440/redundant_top -o >> transdecoder.tmp.28440/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null >> died with ret 256 at >> /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/TransDecoder >> line 498. * >> >> >> *Eric* >> >> >> On Wed, Apr 30, 2014 at 9:41 PM, Brian Haas <bh...@br...>wrote: >> >>> Hi Eric, >>> >>> Are you building this on linux or mac? If mac, I've never gotten >>> ffindex to build on mac - only linux. >>> >>> In any case, you can use transdecoder without using the ffindex. You >>> can try >>> >>> make parafly >>> >>> and then >>> >>> cd sample_data && runMe.sh >>> >>> and see if it works. >>> >>> best, >>> >>> ~brian >>> >>> >>> >>> On Wed, Apr 30, 2014 at 6:30 PM, ERIC WAFULA <ek...@ps...> wrote: >>> >>>> Hi Brian, >>>> >>>> I tried for days now install transdecoder without success. I keep >>>> getting ffindex error to do with some kind of incompatabilty. >>>> >>>> sudo make >>>> >>>> if [[ ! -s pfam/Pfam-AB.hmm.bin ]]; then echo "Downloading PFAM >>>> database" && wget ' >>>> http://sourceforge.net/projects/transdecoder/files/Pfam-AB.hmm.bin/download' >>>> -O pfam/Pfam-AB.hmm.bin; fi >>>> >>>> if [[ ! -e pfam/Pfam-AB.hmm.bin.h3i ]]; then echo "Preparing PFAM >>>> database" && hmmpress pfam/Pfam-AB.hmm.bin; fi >>>> >>>> cd 3rd_party/ffindex && make HAVE_MPI=1 && make install >>>> INSTALL_DIR=../../../util HAVE_MPI=1 >>>> >>>> make[1]: Entering directory >>>> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3' >>>> >>>> make -C src -f Makefile all >>>> >>>> make[2]: Entering directory >>>> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3/src' >>>> >>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>>> -o ffindex_apply.o ffindex_apply.c >>>> >>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>>> -o ffindex.o ffindex.c >>>> >>>> ffindex.c: In function 'ffindex_tree_write': >>>> >>>> ffindex.c:518: warning: ISO C forbids nested functions >>>> >>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>>> -o ffutil.o ffutil.c >>>> >>>> gcc -fopenmp -Wl,-z,defs -shared -Wl,-soname,libffindex.so.0.1 -o >>>> libffindex.so.0.1 ffindex.o ffutil.o -lc >>>> >>>> ln -sf libffindex.so.0.1 libffindex.so >>>> >>>> gcc -fopenmp -lffindex -L. ffindex_apply.o libffindex.so >>>> libffindex.so.0.1 ffindex.h -o ffindex_apply >>>> >>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>>> -o ffindex_from_fasta.o ffindex_from_fasta.c >>>> >>>> gcc -fopenmp -o ffindex_from_fasta ffindex_from_fasta.o -lffindex -L. >>>> -L. -lffindex >>>> >>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>>> -o ffindex_get.o ffindex_get.c >>>> >>>> gcc -fopenmp -o ffindex_get ffindex_get.o -lffindex -L. -L. -lffindex >>>> >>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>>> -o ffindex_build.o ffindex_build.c >>>> >>>> gcc -fopenmp -o ffindex_build ffindex_build.o -lffindex -L. -L. >>>> -lffindex >>>> >>>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>>> -o ffindex_modify.o ffindex_modify.c >>>> >>>> gcc -fopenmp -o ffindex_modify ffindex_modify.o -lffindex -L. -L. >>>> -lffindex >>>> >>>> ar rcs libffindex.a ffutil.o ffindex.o >>>> >>>> gcc -fopenmp -o ffindex_unpack ffindex_unpack.o -lffindex -L. -L. >>>> -lffindex >>>> >>>> mpicc -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>>> ffindex_apply_mpi.c -o ffindex_apply_mpi.o >>>> >>>> ffindex_apply_mpi.c: In function 'ffindex_apply_by_entry': >>>> >>>> ffindex_apply_mpi.c:151: warning: format '%ld' expects type 'long int', >>>> but argument 4 has type 'size_t' >>>> >>>> ffindex_apply_mpi.c:151: warning: format '%ld' expects type 'long int', >>>> but argument 5 has type 'size_t' >>>> >>>> mpicc -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -o >>>> ffindex_apply_mpi ffindex_apply_mpi.o -lffindex -L. >>>> >>>> */usr/bin/ld: skipping incompatible ./libffindex.so when searching for >>>> -lffindex* >>>> >>>> */usr/bin/ld: skipping incompatible ./libffindex.a when searching for >>>> -lffindex* >>>> >>>> */usr/bin/ld: cannot find -lffindex* >>>> >>>> *collect2: ld returned 1 exit status* >>>> >>>> *make[2]: *** [ffindex_apply_mpi] Error 1* >>>> >>>> *make[2]: Leaving directory >>>> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3/src'* >>>> >>>> *make[1]: *** [all] Error 2* >>>> >>>> *make[1]: Leaving directory >>>> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3'* >>>> >>>> *make: *** [ffindex] Error 2* >>>> >>>> Thanks for your help. >>>> >>>> Eric >>>> >>>> >>>> -- >>>> Eric Kenneth Wafula >>>> Bioinformatics Programmer >>>> Claude dePamphilis Lab >>>> Department of Biology >>>> Penn State University >>>> 814-865-2449 >>>> ek...@ps... >>>> >>>> >>>> ------------------------------------------------------------------------------ >>>> "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE >>>> Instantly run your Selenium tests across 300+ browser/OS combos. Get >>>> unparalleled scalability from the best Selenium testing platform >>>> available. >>>> Simple to use. Nothing to install. Get started now for free." >>>> http://p.sf.net/sfu/SauceLabs >>>> _______________________________________________ >>>> Transdecoder-users mailing list >>>> Tra...@li... >>>> https://lists.sourceforge.net/lists/listinfo/transdecoder-users >>>> >>>> >>> >>> >>> -- >>> -- >>> Brian J. Haas >>> The Broad Institute >>> http://broad.mit.edu/~bhaas >>> >>> >>> >> >> >> >> -- >> Eric Kenneth Wafula >> Bioinformatics Programmer >> Claude dePamphilis Lab >> Department of Biology >> Penn State University >> 814-865-2449 >> ek...@ps... >> > > > > -- > -- > Brian J. Haas > The Broad Institute > http://broad.mit.edu/~bhaas > > > -- Eric Kenneth Wafula Bioinformatics Programmer Claude dePamphilis Lab Department of Biology Penn State University 814-865-2449 ek...@ps... |
|
From: Brian H. <bh...@br...> - 2014-05-01 15:18:52
|
Hi Eric, Try this too: make cdhit and then run the sample data. best, ~brian On Thu, May 1, 2014 at 9:16 AM, ERIC WAFULA <ek...@ps...> wrote: > Brian > > I am building on linux machine (centos 5.8). > "make parafly" completed okay, but i get an error mesaage when running > running the test script. something to do cd > > [ekw10@comandra sample_data]$ ./runMe.sh > > -parsing cufflinks output: transcripts.gtf > > -parsing genome fasta: test.genome.fasta > > -done parsing genome. > > // processing 7000000090838467 > > CMD: > /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/ > get_top_longest_fasta_entries.pl transdecoder.tmp.nopfam/longest_orfs.cds > 2000 > transdecoder.tmp.nopfam/redundant_top > > CMD: > /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est > -r 1 -i transdecoder.tmp.nopfam/redundant_top -o > transdecoder.tmp.nopfam/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null > > *Error, cmd: > /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est > -r 1 -i transdecoder.tmp.nopfam/redundant_top -o > transdecoder.tmp.nopfam/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null > died with ret 256 at ../TransDecoder line 498.* > > > I aslo tried with my own dataset, and am getting the folllowing error: > > ekw10@comandra assembly]$ > /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/TransDecoder > -t OrAe0GB1.fasta > > CMD: > /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/ > get_top_longest_fasta_entries.pl transdecoder.tmp.28440/longest_orfs.cds > 2000 > transdecoder.tmp.28440/redundant_top > > CMD: > /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est > -r 1 -i transdecoder.tmp.28440/redundant_top -o > transdecoder.tmp.28440/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null > > E*rror, cmd: > /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est > -r 1 -i transdecoder.tmp.28440/redundant_top -o > transdecoder.tmp.28440/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null > died with ret 256 at > /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/TransDecoder > line 498. * > > > *Eric* > > > On Wed, Apr 30, 2014 at 9:41 PM, Brian Haas <bh...@br...>wrote: > >> Hi Eric, >> >> Are you building this on linux or mac? If mac, I've never gotten ffindex >> to build on mac - only linux. >> >> In any case, you can use transdecoder without using the ffindex. You can >> try >> >> make parafly >> >> and then >> >> cd sample_data && runMe.sh >> >> and see if it works. >> >> best, >> >> ~brian >> >> >> >> On Wed, Apr 30, 2014 at 6:30 PM, ERIC WAFULA <ek...@ps...> wrote: >> >>> Hi Brian, >>> >>> I tried for days now install transdecoder without success. I keep >>> getting ffindex error to do with some kind of incompatabilty. >>> >>> sudo make >>> >>> if [[ ! -s pfam/Pfam-AB.hmm.bin ]]; then echo "Downloading PFAM >>> database" && wget ' >>> http://sourceforge.net/projects/transdecoder/files/Pfam-AB.hmm.bin/download' >>> -O pfam/Pfam-AB.hmm.bin; fi >>> >>> if [[ ! -e pfam/Pfam-AB.hmm.bin.h3i ]]; then echo "Preparing PFAM >>> database" && hmmpress pfam/Pfam-AB.hmm.bin; fi >>> >>> cd 3rd_party/ffindex && make HAVE_MPI=1 && make install >>> INSTALL_DIR=../../../util HAVE_MPI=1 >>> >>> make[1]: Entering directory >>> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3' >>> >>> make -C src -f Makefile all >>> >>> make[2]: Entering directory >>> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3/src' >>> >>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>> -o ffindex_apply.o ffindex_apply.c >>> >>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>> -o ffindex.o ffindex.c >>> >>> ffindex.c: In function 'ffindex_tree_write': >>> >>> ffindex.c:518: warning: ISO C forbids nested functions >>> >>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>> -o ffutil.o ffutil.c >>> >>> gcc -fopenmp -Wl,-z,defs -shared -Wl,-soname,libffindex.so.0.1 -o >>> libffindex.so.0.1 ffindex.o ffutil.o -lc >>> >>> ln -sf libffindex.so.0.1 libffindex.so >>> >>> gcc -fopenmp -lffindex -L. ffindex_apply.o libffindex.so >>> libffindex.so.0.1 ffindex.h -o ffindex_apply >>> >>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>> -o ffindex_from_fasta.o ffindex_from_fasta.c >>> >>> gcc -fopenmp -o ffindex_from_fasta ffindex_from_fasta.o -lffindex -L. >>> -L. -lffindex >>> >>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>> -o ffindex_get.o ffindex_get.c >>> >>> gcc -fopenmp -o ffindex_get ffindex_get.o -lffindex -L. -L. -lffindex >>> >>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>> -o ffindex_build.o ffindex_build.c >>> >>> gcc -fopenmp -o ffindex_build ffindex_build.o -lffindex -L. -L. -lffindex >>> >>> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>> -o ffindex_modify.o ffindex_modify.c >>> >>> gcc -fopenmp -o ffindex_modify ffindex_modify.o -lffindex -L. -L. >>> -lffindex >>> >>> ar rcs libffindex.a ffutil.o ffindex.o >>> >>> gcc -fopenmp -o ffindex_unpack ffindex_unpack.o -lffindex -L. -L. >>> -lffindex >>> >>> mpicc -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >>> ffindex_apply_mpi.c -o ffindex_apply_mpi.o >>> >>> ffindex_apply_mpi.c: In function 'ffindex_apply_by_entry': >>> >>> ffindex_apply_mpi.c:151: warning: format '%ld' expects type 'long int', >>> but argument 4 has type 'size_t' >>> >>> ffindex_apply_mpi.c:151: warning: format '%ld' expects type 'long int', >>> but argument 5 has type 'size_t' >>> >>> mpicc -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -o >>> ffindex_apply_mpi ffindex_apply_mpi.o -lffindex -L. >>> >>> */usr/bin/ld: skipping incompatible ./libffindex.so when searching for >>> -lffindex* >>> >>> */usr/bin/ld: skipping incompatible ./libffindex.a when searching for >>> -lffindex* >>> >>> */usr/bin/ld: cannot find -lffindex* >>> >>> *collect2: ld returned 1 exit status* >>> >>> *make[2]: *** [ffindex_apply_mpi] Error 1* >>> >>> *make[2]: Leaving directory >>> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3/src'* >>> >>> *make[1]: *** [all] Error 2* >>> >>> *make[1]: Leaving directory >>> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3'* >>> >>> *make: *** [ffindex] Error 2* >>> >>> Thanks for your help. >>> >>> Eric >>> >>> >>> -- >>> Eric Kenneth Wafula >>> Bioinformatics Programmer >>> Claude dePamphilis Lab >>> Department of Biology >>> Penn State University >>> 814-865-2449 >>> ek...@ps... >>> >>> >>> ------------------------------------------------------------------------------ >>> "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE >>> Instantly run your Selenium tests across 300+ browser/OS combos. Get >>> unparalleled scalability from the best Selenium testing platform >>> available. >>> Simple to use. Nothing to install. Get started now for free." >>> http://p.sf.net/sfu/SauceLabs >>> _______________________________________________ >>> Transdecoder-users mailing list >>> Tra...@li... >>> https://lists.sourceforge.net/lists/listinfo/transdecoder-users >>> >>> >> >> >> -- >> -- >> Brian J. Haas >> The Broad Institute >> http://broad.mit.edu/~bhaas >> >> >> > > > > -- > Eric Kenneth Wafula > Bioinformatics Programmer > Claude dePamphilis Lab > Department of Biology > Penn State University > 814-865-2449 > ek...@ps... > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: ERIC W. <ek...@ps...> - 2014-05-01 13:16:53
|
Brian I am building on linux machine (centos 5.8). "make parafly" completed okay, but i get an error mesaage when running running the test script. something to do cd [ekw10@comandra sample_data]$ ./runMe.sh -parsing cufflinks output: transcripts.gtf -parsing genome fasta: test.genome.fasta -done parsing genome. // processing 7000000090838467 CMD: /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/ get_top_longest_fasta_entries.pl transdecoder.tmp.nopfam/longest_orfs.cds 2000 > transdecoder.tmp.nopfam/redundant_top CMD: /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est -r 1 -i transdecoder.tmp.nopfam/redundant_top -o transdecoder.tmp.nopfam/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null *Error, cmd: /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est -r 1 -i transdecoder.tmp.nopfam/redundant_top -o transdecoder.tmp.nopfam/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null died with ret 256 at ../TransDecoder line 498.* I aslo tried with my own dataset, and am getting the folllowing error: ekw10@comandra assembly]$ /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/TransDecoder -t OrAe0GB1.fasta CMD: /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/ get_top_longest_fasta_entries.pl transdecoder.tmp.28440/longest_orfs.cds 2000 > transdecoder.tmp.28440/redundant_top CMD: /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est -r 1 -i transdecoder.tmp.28440/redundant_top -o transdecoder.tmp.28440/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null E*rror, cmd: /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/util/bin/cd-hit-est -r 1 -i transdecoder.tmp.28440/redundant_top -o transdecoder.tmp.28440/redundant_top.nr90 -M 0 -T 2 >/dev/null 2>/dev/null died with ret 256 at /scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/TransDecoder line 498. * *Eric* On Wed, Apr 30, 2014 at 9:41 PM, Brian Haas <bh...@br...>wrote: > Hi Eric, > > Are you building this on linux or mac? If mac, I've never gotten ffindex > to build on mac - only linux. > > In any case, you can use transdecoder without using the ffindex. You can > try > > make parafly > > and then > > cd sample_data && runMe.sh > > and see if it works. > > best, > > ~brian > > > > On Wed, Apr 30, 2014 at 6:30 PM, ERIC WAFULA <ek...@ps...> wrote: > >> Hi Brian, >> >> I tried for days now install transdecoder without success. I keep getting >> ffindex error to do with some kind of incompatabilty. >> >> sudo make >> >> if [[ ! -s pfam/Pfam-AB.hmm.bin ]]; then echo "Downloading PFAM database" >> && wget ' >> http://sourceforge.net/projects/transdecoder/files/Pfam-AB.hmm.bin/download' >> -O pfam/Pfam-AB.hmm.bin; fi >> >> if [[ ! -e pfam/Pfam-AB.hmm.bin.h3i ]]; then echo "Preparing PFAM >> database" && hmmpress pfam/Pfam-AB.hmm.bin; fi >> >> cd 3rd_party/ffindex && make HAVE_MPI=1 && make install >> INSTALL_DIR=../../../util HAVE_MPI=1 >> >> make[1]: Entering directory >> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3' >> >> make -C src -f Makefile all >> >> make[2]: Entering directory >> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3/src' >> >> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >> -o ffindex_apply.o ffindex_apply.c >> >> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >> -o ffindex.o ffindex.c >> >> ffindex.c: In function 'ffindex_tree_write': >> >> ffindex.c:518: warning: ISO C forbids nested functions >> >> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >> -o ffutil.o ffutil.c >> >> gcc -fopenmp -Wl,-z,defs -shared -Wl,-soname,libffindex.so.0.1 -o >> libffindex.so.0.1 ffindex.o ffutil.o -lc >> >> ln -sf libffindex.so.0.1 libffindex.so >> >> gcc -fopenmp -lffindex -L. ffindex_apply.o libffindex.so >> libffindex.so.0.1 ffindex.h -o ffindex_apply >> >> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >> -o ffindex_from_fasta.o ffindex_from_fasta.c >> >> gcc -fopenmp -o ffindex_from_fasta ffindex_from_fasta.o -lffindex -L. -L. >> -lffindex >> >> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >> -o ffindex_get.o ffindex_get.c >> >> gcc -fopenmp -o ffindex_get ffindex_get.o -lffindex -L. -L. -lffindex >> >> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >> -o ffindex_build.o ffindex_build.c >> >> gcc -fopenmp -o ffindex_build ffindex_build.o -lffindex -L. -L. -lffindex >> >> gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >> -o ffindex_modify.o ffindex_modify.c >> >> gcc -fopenmp -o ffindex_modify ffindex_modify.o -lffindex -L. -L. >> -lffindex >> >> ar rcs libffindex.a ffutil.o ffindex.o >> >> gcc -fopenmp -o ffindex_unpack ffindex_unpack.o -lffindex -L. -L. >> -lffindex >> >> mpicc -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c >> ffindex_apply_mpi.c -o ffindex_apply_mpi.o >> >> ffindex_apply_mpi.c: In function 'ffindex_apply_by_entry': >> >> ffindex_apply_mpi.c:151: warning: format '%ld' expects type 'long int', >> but argument 4 has type 'size_t' >> >> ffindex_apply_mpi.c:151: warning: format '%ld' expects type 'long int', >> but argument 5 has type 'size_t' >> >> mpicc -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -o >> ffindex_apply_mpi ffindex_apply_mpi.o -lffindex -L. >> >> */usr/bin/ld: skipping incompatible ./libffindex.so when searching for >> -lffindex* >> >> */usr/bin/ld: skipping incompatible ./libffindex.a when searching for >> -lffindex* >> >> */usr/bin/ld: cannot find -lffindex* >> >> *collect2: ld returned 1 exit status* >> >> *make[2]: *** [ffindex_apply_mpi] Error 1* >> >> *make[2]: Leaving directory >> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3/src'* >> >> *make[1]: *** [all] Error 2* >> >> *make[1]: Leaving directory >> `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3'* >> >> *make: *** [ffindex] Error 2* >> >> Thanks for your help. >> >> Eric >> >> >> -- >> Eric Kenneth Wafula >> Bioinformatics Programmer >> Claude dePamphilis Lab >> Department of Biology >> Penn State University >> 814-865-2449 >> ek...@ps... >> >> >> ------------------------------------------------------------------------------ >> "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE >> Instantly run your Selenium tests across 300+ browser/OS combos. Get >> unparalleled scalability from the best Selenium testing platform >> available. >> Simple to use. Nothing to install. Get started now for free." >> http://p.sf.net/sfu/SauceLabs >> _______________________________________________ >> Transdecoder-users mailing list >> Tra...@li... >> https://lists.sourceforge.net/lists/listinfo/transdecoder-users >> >> > > > -- > -- > Brian J. Haas > The Broad Institute > http://broad.mit.edu/~bhaas > > > -- Eric Kenneth Wafula Bioinformatics Programmer Claude dePamphilis Lab Department of Biology Penn State University 814-865-2449 ek...@ps... |
|
From: Brian H. <bh...@br...> - 2014-05-01 01:41:07
|
Hi Eric, Are you building this on linux or mac? If mac, I've never gotten ffindex to build on mac - only linux. In any case, you can use transdecoder without using the ffindex. You can try make parafly and then cd sample_data && runMe.sh and see if it works. best, ~brian On Wed, Apr 30, 2014 at 6:30 PM, ERIC WAFULA <ek...@ps...> wrote: > Hi Brian, > > I tried for days now install transdecoder without success. I keep getting > ffindex error to do with some kind of incompatabilty. > > sudo make > > if [[ ! -s pfam/Pfam-AB.hmm.bin ]]; then echo "Downloading PFAM database" > && wget ' > http://sourceforge.net/projects/transdecoder/files/Pfam-AB.hmm.bin/download' > -O pfam/Pfam-AB.hmm.bin; fi > > if [[ ! -e pfam/Pfam-AB.hmm.bin.h3i ]]; then echo "Preparing PFAM > database" && hmmpress pfam/Pfam-AB.hmm.bin; fi > > cd 3rd_party/ffindex && make HAVE_MPI=1 && make install > INSTALL_DIR=../../../util HAVE_MPI=1 > > make[1]: Entering directory > `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3' > > make -C src -f Makefile all > > make[2]: Entering directory > `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3/src' > > gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o > ffindex_apply.o ffindex_apply.c > > gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o > ffindex.o ffindex.c > > ffindex.c: In function 'ffindex_tree_write': > > ffindex.c:518: warning: ISO C forbids nested functions > > gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o > ffutil.o ffutil.c > > gcc -fopenmp -Wl,-z,defs -shared -Wl,-soname,libffindex.so.0.1 -o > libffindex.so.0.1 ffindex.o ffutil.o -lc > > ln -sf libffindex.so.0.1 libffindex.so > > gcc -fopenmp -lffindex -L. ffindex_apply.o libffindex.so > libffindex.so.0.1 ffindex.h -o ffindex_apply > > gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o > ffindex_from_fasta.o ffindex_from_fasta.c > > gcc -fopenmp -o ffindex_from_fasta ffindex_from_fasta.o -lffindex -L. -L. > -lffindex > > gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o > ffindex_get.o ffindex_get.c > > gcc -fopenmp -o ffindex_get ffindex_get.o -lffindex -L. -L. -lffindex > > gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o > ffindex_build.o ffindex_build.c > > gcc -fopenmp -o ffindex_build ffindex_build.o -lffindex -L. -L. -lffindex > > gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o > ffindex_modify.o ffindex_modify.c > > gcc -fopenmp -o ffindex_modify ffindex_modify.o -lffindex -L. -L. -lffindex > > ar rcs libffindex.a ffutil.o ffindex.o > > gcc -fopenmp -o ffindex_unpack ffindex_unpack.o -lffindex -L. -L. -lffindex > > mpicc -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c > ffindex_apply_mpi.c -o ffindex_apply_mpi.o > > ffindex_apply_mpi.c: In function 'ffindex_apply_by_entry': > > ffindex_apply_mpi.c:151: warning: format '%ld' expects type 'long int', > but argument 4 has type 'size_t' > > ffindex_apply_mpi.c:151: warning: format '%ld' expects type 'long int', > but argument 5 has type 'size_t' > > mpicc -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -o > ffindex_apply_mpi ffindex_apply_mpi.o -lffindex -L. > > */usr/bin/ld: skipping incompatible ./libffindex.so when searching for > -lffindex* > > */usr/bin/ld: skipping incompatible ./libffindex.a when searching for > -lffindex* > > */usr/bin/ld: cannot find -lffindex* > > *collect2: ld returned 1 exit status* > > *make[2]: *** [ffindex_apply_mpi] Error 1* > > *make[2]: Leaving directory > `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3/src'* > > *make[1]: *** [all] Error 2* > > *make[1]: Leaving directory > `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3'* > > *make: *** [ffindex] Error 2* > > Thanks for your help. > > Eric > > > -- > Eric Kenneth Wafula > Bioinformatics Programmer > Claude dePamphilis Lab > Department of Biology > Penn State University > 814-865-2449 > ek...@ps... > > > ------------------------------------------------------------------------------ > "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE > Instantly run your Selenium tests across 300+ browser/OS combos. Get > unparalleled scalability from the best Selenium testing platform available. > Simple to use. Nothing to install. Get started now for free." > http://p.sf.net/sfu/SauceLabs > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: ERIC W. <ek...@ps...> - 2014-04-30 22:30:44
|
Hi Brian, I tried for days now install transdecoder without success. I keep getting ffindex error to do with some kind of incompatabilty. sudo make if [[ ! -s pfam/Pfam-AB.hmm.bin ]]; then echo "Downloading PFAM database" && wget ' http://sourceforge.net/projects/transdecoder/files/Pfam-AB.hmm.bin/download' -O pfam/Pfam-AB.hmm.bin; fi if [[ ! -e pfam/Pfam-AB.hmm.bin.h3i ]]; then echo "Preparing PFAM database" && hmmpress pfam/Pfam-AB.hmm.bin; fi cd 3rd_party/ffindex && make HAVE_MPI=1 && make install INSTALL_DIR=../../../util HAVE_MPI=1 make[1]: Entering directory `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3' make -C src -f Makefile all make[2]: Entering directory `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3/src' gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o ffindex_apply.o ffindex_apply.c gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o ffindex.o ffindex.c ffindex.c: In function 'ffindex_tree_write': ffindex.c:518: warning: ISO C forbids nested functions gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o ffutil.o ffutil.c gcc -fopenmp -Wl,-z,defs -shared -Wl,-soname,libffindex.so.0.1 -o libffindex.so.0.1 ffindex.o ffutil.o -lc ln -sf libffindex.so.0.1 libffindex.so gcc -fopenmp -lffindex -L. ffindex_apply.o libffindex.so libffindex.so.0.1 ffindex.h -o ffindex_apply gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o ffindex_from_fasta.o ffindex_from_fasta.c gcc -fopenmp -o ffindex_from_fasta ffindex_from_fasta.o -lffindex -L. -L. -lffindex gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o ffindex_get.o ffindex_get.c gcc -fopenmp -o ffindex_get ffindex_get.o -lffindex -L. -L. -lffindex gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o ffindex_build.o ffindex_build.c gcc -fopenmp -o ffindex_build ffindex_build.o -lffindex -L. -L. -lffindex gcc -fopenmp -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c -o ffindex_modify.o ffindex_modify.c gcc -fopenmp -o ffindex_modify ffindex_modify.o -lffindex -L. -L. -lffindex ar rcs libffindex.a ffutil.o ffindex.o gcc -fopenmp -o ffindex_unpack ffindex_unpack.o -lffindex -L. -L. -lffindex mpicc -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -c ffindex_apply_mpi.c -o ffindex_apply_mpi.o ffindex_apply_mpi.c: In function 'ffindex_apply_by_entry': ffindex_apply_mpi.c:151: warning: format '%ld' expects type 'long int', but argument 4 has type 'size_t' ffindex_apply_mpi.c:151: warning: format '%ld' expects type 'long int', but argument 5 has type 'size_t' mpicc -std=c99 -O2 -g -fPIC -Wall -pedantic -D_GNU_SOURCE=1 -o ffindex_apply_mpi ffindex_apply_mpi.o -lffindex -L. */usr/bin/ld: skipping incompatible ./libffindex.so when searching for -lffindex* */usr/bin/ld: skipping incompatible ./libffindex.a when searching for -lffindex* */usr/bin/ld: cannot find -lffindex* *collect2: ld returned 1 exit status* *make[2]: *** [ffindex_apply_mpi] Error 1* *make[2]: Leaving directory `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3/src'* *make[1]: *** [all] Error 2* *make[1]: Leaving directory `/scratch/biotools/software/quality_control/transdecoder_rel16JAN2014/3rd_party/ffindex-0.9.9.3'* *make: *** [ffindex] Error 2* Thanks for your help. Eric -- Eric Kenneth Wafula Bioinformatics Programmer Claude dePamphilis Lab Department of Biology Penn State University 814-865-2449 ek...@ps... |
|
From: Brian H. <bh...@br...> - 2014-04-23 19:47:29
|
Hi Kate, Transdecoder is mentioned here: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3875132/ and described in the supplementary materials. You could also site the website: http://transdecoder.sf.net best, ~brian On Wed, Apr 23, 2014 at 3:08 PM, Kate Broadbent <sk...@gm...> wrote: > Hi, > > I am wondering how is best to cite the use of Transdecoder. Thanks! Kate > > > ------------------------------------------------------------------------------ > Start Your Social Network Today - Download eXo Platform > Build your Enterprise Intranet with eXo Platform Software > Java Based Open Source Intranet - Social, Extensible, Cloud Ready > Get Started Now And Turn Your Intranet Into A Collaboration Platform > http://p.sf.net/sfu/ExoPlatform > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Kate B. <sk...@gm...> - 2014-04-23 19:08:30
|
Hi, I am wondering how is best to cite the use of Transdecoder. Thanks! Kate |
|
From: <Ale...@cs...> - 2014-04-16 01:49:19
|
Some Qs as it is not clear in my head: * You mean a single ORF per Trinity sequence ? * What is it affecting if you have two ORFs? * What would be the metric that would score this (and makes biological sense)? * How would you deal with Trinity sequences that have two real ORFs? a ________________________________ From: Elasady, Summer [sr...@st...] Sent: Tuesday, 15 April 2014 12:49 AM To: tra...@li... Subject: [Transdecoder-users] Extract only best ORF Hello- Is there a way to have transdecoder output only a single “best” ORF? Thank you, Summer R. Elasady Baumann Lab - Bioinformatics Intern SR...@st... |
|
From: Brian H. <bh...@br...> - 2014-04-16 00:24:41
|
Hi Summer, This has been a popular request. It doesn't do it now, but we could consider it for a future release. best, ~brian On Mon, Apr 14, 2014 at 10:49 AM, Elasady, Summer <sr...@st...> wrote: > Hello- > > Is there a way to have transdecoder output only a single “best” ORF? > > Thank you, > > Summer R. Elasady > Baumann Lab - Bioinformatics Intern > SR...@st... > > > > ------------------------------------------------------------------------------ > Learn Graph Databases - Download FREE O'Reilly Book > "Graph Databases" is the definitive new guide to graph databases and their > applications. Written by three acclaimed leaders in the field, > this first edition is now available. Download your free book today! > http://p.sf.net/sfu/NeoTech > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Elasady, S. <sr...@st...> - 2014-04-14 14:50:19
|
Hello- Is there a way to have transdecoder output only a single “best” ORF? Thank you, Summer R. Elasady Baumann Lab - Bioinformatics Intern SR...@st... |
|
From: Brian H. <bh...@br...> - 2014-04-08 00:14:15
|
Hi Dawn,
'TransDecoder' is the new name for what used to be called
'transcripts_to_best_scoring_ORFs.pl'.
The permissions problem could be solved by
chmod 775 TransDecoder
and then trying to run it.
If that doesn't work, try:
perl TransDecoder
Let's see how that goes.
best,
~brian
On Mon, Apr 7, 2014 at 5:12 PM, Dawn <daw...@gm...> wrote:
> Hi,
>
> I tried to use "TransDecoder -t test.genome.fasta", but I got "Permission
> denied".
>
> Can you tell me how to solve it?
>
> Is the above command same as "transcripts_to_best_scoring_ORFs.pl -t
> transcripts.fasta"?
>
> Thanks!
> Dawn
>
>
> ------------------------------------------------------------------------------
> Put Bad Developers to Shame
> Dominate Development with Jenkins Continuous Integration
> Continuously Automate Build, Test & Deployment
> Start a new project now. Try Jenkins in the cloud.
> http://p.sf.net/sfu/13600_Cloudbees
> _______________________________________________
> Transdecoder-users mailing list
> Tra...@li...
> https://lists.sourceforge.net/lists/listinfo/transdecoder-users
>
>
--
--
Brian J. Haas
The Broad Institute
http://broad.mit.edu/~bhaas
|
|
From: Dawn <daw...@gm...> - 2014-04-07 21:12:35
|
Hi, I tried to use "TransDecoder -t test.genome.fasta", but I got "Permission denied". Can you tell me how to solve it? Is the above command same as "transcripts_to_best_scoring_ORFs.pl -t transcripts.fasta"? Thanks! Dawn |
|
From: Brian H. <bh...@br...> - 2014-03-21 15:22:30
|
Hi Summer, I'm not sure it's described anywhere yet... There appears to be some redundant info in the header. The important parts are: >cds.comp1000092_c0_seq1|m.177654 type:internal len:250 (+) comp1000092_c0_seq1:1-747(+) which can be broken down as: protein accession: cds.comp1000092_c0_seq1|m.177654 so, orf m.177654 on trinity transcript comp1000092_c0_seq1 type: internal indicates that the transcript can be translated from beginning to end of the trinity transcript sequence (no start codon or stop codon detected). Alternatively, this might indicate complete (full ORF), 3prime partial (missing stop codon) or 5prime partial (missing start codon) The length of the orf is 250 amino acids and the translation is done from the range of 1-747 on the trinity transcript, in the '+' orientation. best, ~brian On Fri, Mar 21, 2014 at 11:02 AM, Elasady, Summer <sr...@st...> wrote: > Hello- > > I'm trying to decipher the output files from Transdecoder and cannot > find any documentation on what exactly is in each column. Can you please > point me to the where this info is located? For example, in the .cds file, > I have the following headers: > > >cds.comp1000092_c0_seq1|m.177654 comp1000092_c0_seq1|g.177654 ORF > comp1000092_c0_seq1|g.177654 comp1000092_c0_seq1|m.177654 type:internal > len:250 (+) comp1000092_c0_seq1:1-747(+) > > What does it all mean? > > Thank you, > > Summer R. Elasady > Baumann Lab - Bioinformatics Intern > SR...@st... > > > > ------------------------------------------------------------------------------ > Learn Graph Databases - Download FREE O'Reilly Book > "Graph Databases" is the definitive new guide to graph databases and their > applications. Written by three acclaimed leaders in the field, > this first edition is now available. Download your free book today! > http://p.sf.net/sfu/13534_NeoTech > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Elasady, S. <sr...@st...> - 2014-03-21 15:03:01
|
Hello- I’m trying to decipher the output files from Transdecoder and cannot find any documentation on what exactly is in each column. Can you please point me to the where this info is located? For example, in the .cds file, I have the following headers: >cds.comp1000092_c0_seq1|m.177654 comp1000092_c0_seq1|g.177654 ORF comp1000092_c0_seq1|g.177654 comp1000092_c0_seq1|m.177654 type:internal len:250 (+) comp1000092_c0_seq1:1-747(+) What does it all mean? Thank you, Summer R. Elasady Baumann Lab - Bioinformatics Intern SR...@st... |
|
From: Brian H. <bh...@br...> - 2014-03-20 00:13:40
|
Hi Summer, It's likely that you're working from an older Trinity installation. If so, you can find the corresponding documentation in the $TRINITY_HOME/docs folder. It's best, though, to upgrade to a newer version. We try to keep the web documentation consistent with whatever the latest production Trinity release is. best, ~brian On Wed, Mar 19, 2014 at 6:19 PM, Elasady, Summer <sr...@st...> wrote: > Hello- > > I'm trying to run Transdecoder from within Trinity, and the instructions > say to run: > > $TRINITY_HOME/trinity-plugins/transdecoder/TransDecoder > > > However, I don't have that option in my file path. In the /transdecoder/ folder I have two perl scripts titled: > > > - > > transcripts_to_best_scoring_ORFs.pl > - > > cdna_alignment_orf_to_genome_orf.pl > > > The cdna_alignment script does not work, and when I run the transcripts to > best scoring ORFs, it does not output the final files needed for downstream > analysis, but it does output the preliminary files. I'm using Trinity from > 02.25.2013. > > Any ideas on what to do? > > Thank you, > > Summer R. Elasady > Baumann Lab - Bioinformatics Intern > SR...@st... > > > > ------------------------------------------------------------------------------ > Learn Graph Databases - Download FREE O'Reilly Book > "Graph Databases" is the definitive new guide to graph databases and their > applications. Written by three acclaimed leaders in the field, > this first edition is now available. Download your free book today! > http://p.sf.net/sfu/13534_NeoTech > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Elasady, S. <sr...@st...> - 2014-03-19 22:19:45
|
Hello- I’m trying to run Transdecoder from within Trinity, and the instructions say to run: $TRINITY_HOME/trinity-plugins/transdecoder/TransDecoder However, I don’t have that option in my file path. In the /transdecoder/ folder I have two perl scripts titled: * transcripts_to_best_scoring_ORFs.pl * cdna_alignment_orf_to_genome_orf.pl The cdna_alignment script does not work, and when I run the transcripts to best scoring ORFs, it does not output the final files needed for downstream analysis, but it does output the preliminary files. I’m using Trinity from 02.25.2013. Any ideas on what to do? Thank you, Summer R. Elasady Baumann Lab - Bioinformatics Intern SR...@st... |
|
From: Brian H. <bh...@br...> - 2014-02-26 20:32:52
|
Hi Scott, To run it and have it run pfam as part of the process, you would run: TransDecoder -t $your_transcripts.fasta --workdir $your_output_dir_name --search_pfam $transdecoder_root/pfam/Pfam-AB.hmm.bin The pfam search is executed after the ORFs have been extracted, and those ORFs with pfam hits are retained as part of the final set of predictions. best, ~brian On Wed, Feb 26, 2014 at 3:25 PM, Geib, Scott <Sco...@ar...>wrote: > Hmm, the svn and sample data don't work on the system I was working on, > but work on another workstation. Must be something with system > configuration on my end (maybe NFS?). > > > > Anyway, not your problem. > > Also I was confused a bit on how to run PFAM searches separately, outside > of Transdecoder. > > > Is this correct: > > > > ../transdecoder_rel16JAN2014/TransDecoder -t Trinity.fasta -S > --prepare_pfam > > Then I would want to run hmmscan on the longest_orf.pep file. > > > > Then what is the command to rerun Transdecoder and use the Pfam output? > The first command seemed to run Transdecoder all the way through without > using PFAM (not stopping after creation of intermediate files for > searching). > > Just run this from same folder: > > ../transdecoder_rel16JAN2014/TransDecoder -t Trinity.fasta -S --pfam_out > domtbl.out > > > > > > > > > > *From:* Brian Haas [mailto:bh...@br...] > *Sent:* Tuesday, February 25, 2014 4:24 AM > *To:* Geib, Scott > *Cc:* tra...@li... > *Subject:* Re: [Transdecoder-users] Transdecoder running error > > > > Hi Scott, > > > > It's not obvious what's going on here... Did the build of the software > go fine? (typing 'make' in the base installation directory) > > > > Is ParaFly working? You should find it in the distro at: > > > > util/bin/ParaFly > > > > Just try executing it and see if it reports the usage menu. > > > > For testing, you can go into the provided sample_data/ directory, and > there are various run-scripts to test different configurations. I just ran > the tests in our latest SVN code and it all seems to be working correctly > (on linux). > > > > If you want to try the latest SVN code, you can pull it like so: > > > > svn checkout svn://svn.code.sf.net/p/transdecoder/code-0/trunktransdecoder-code-0 > > > > best, > > > > ~brian > > > > > > On Mon, Feb 24, 2014 at 8:58 PM, Geib, Scott <Sco...@ar...> > wrote: > > I am getting error with Transdecoder and PFAM searching. Running with > transdecoder_rel16JAN2014 > > First if I run hmmscan within TD, I get the following symbolic link error > (this is stderr): > > > > CMD: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/ > get_top_longest_fasta_entries.pl transdecoder.tmp.9643/longest_orfs.cds > 2000 > transdecoder.tmp.9643/redundant_top > > CMD: /data0/opt/Clustering/cd-hit-v4.5.4-2011-03-07/cd-hit-est -r 1 -i > transdecoder.tmp.9643/redundant_top -o > transdecoder.tmp.9643/redundant_top.nr90 -M 0 -T 48 >/dev/null 2>/dev/null > > CMD: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/ > get_top_longest_fasta_entries.pl transdecoder.tmp.9643/redundant_top.nr90 > 500 > transdecoder.tmp.9643/longest_orfs.cds.top_500_longest > > CMD: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/ > compute_base_probs.pl Trinity.fasta 1 > > transdecoder.tmp.9643/base_freqs.dat > > CMD: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/ > seq_n_baseprobs_to_logliklihood_vals.pltransdecoder.tmp.9643/longest_orfs.cds.top_500_longest > transdecoder.tmp.9643/base_freqs.dat > transdecoder.tmp.9643/hexamer.scores > > CMD: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/score_CDS_liklihood_all_6_frames.pl > transdecoder.tmp.9643/longest_orfs.cds transdecoder.tmp.9643/hexamer.scores > > transdecoder.tmp.9643/longest_orfs.cds.scores > > CMD: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/ > pfam_runner.pl --pep transdecoder.tmp.9643/longest_orfs.pep --pfam_db > Pfam-A.hmm --CPU 48 -o Trinity.fasta.transdecoder.pfam.dat --workdir > transdecoder.tmp.9643 --debug > > Partitioning fasta file transdecoder.tmp.9643/longest_orfs.pep > > Processing with PFAM HMM searches... > > CMD: ParaFly -CPU 48 -c transdecoder.tmp.9643/parafly.sh --failed > transdecoder.tmp.9643/parafly.sh.failed -vv > > Can't exec "ParaFly": Too many levels of symbolic links at > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/ > pfam_runner.pl line 189. > > Error, cmd: ParaFly -CPU 48 -c transdecoder.tmp.9643/parafly.sh --failed > transdecoder.tmp.9643/parafly.sh.failed -vv died with ret -1 at > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/ > pfam_runner.pl line 192. > > Error, cmd: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/ > pfam_runner.pl --pep transdecoder.tmp.9643/longest_orfs.pep --pfam_db > Pfam-A.hmm --CPU 48 -o Trinity.fasta.transdecoder.pfam.dat --workdir > transdecoder.tmp.9643 --debug died with ret 10240 at > ../transdecoder_rel16JAN2014/TransDecoder line 498. > > > > > > So then I also tried to run TD and have it just make files for me to run > PFAM searches myself as a separate command. I submitted the following > command: > > ../transdecoder_rel16JAN2014/TransDecoder -t Trinity.fasta -S > --prepare_pfam > > And it seemed to just run through the whole TransDecoder run without > stopping (generated final files). Which file is supposed to be produced to > search against Pfam? > > > > I get the same errors when using the Transdecoder packaged with Trinity > releases as well. > > > > Thanks, > > Scott > > > > > > This electronic message contains information generated by the USDA solely > for the intended recipients. Any unauthorized interception of this message > or the use or disclosure of the information it contains may violate the law > and subject the violator to civil or criminal penalties. If you believe you > have received this message in error, please notify the sender and delete > the email immediately. > > > > ------------------------------------------------------------------------------ > Flow-based real-time traffic analytics software. Cisco certified tool. > Monitor traffic, SLAs, QoS, Medianet, WAAS etc. with NetFlow Analyzer > Customize your own dashboards, set traffic alerts and generate reports. > Network behavioral analysis & security monitoring. All-in-one tool. > > http://pubads.g.doubleclick.net/gampad/clk?id=126839071&iu=/4140/ostg.clktrk > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > > > > > > -- > -- > Brian J. Haas > The Broad Institute > http://broad.mit.edu/~bhaas > > > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Brian H. <bh...@br...> - 2014-02-26 14:26:29
|
Hi Mun Hua, responses below: On Wed, Feb 26, 2014 at 4:26 AM, mun hua <mh....@gm...> wrote: > Hi Brian, > > I am looking to: > > 1) cluster spliced transcript variants from assembled transcriptome (via > Trinity or other programs) and select the best representative as a gene. > We tend to run the abundance estimation procedure and then filter based on abundance: http://trinityrnaseq.sourceforge.net/analysis/abundance_estimation.html see towards bottom of page. > 2) translate the representative transcript and pick the longest > orf/protein sequence. > > Will TransDecoder be able to carry out both tasks or just task (2)? I > noticed there is an option to include cd-hit-est executable. Does this do > task (1) at the same time or does this serve another purpose? > > TransDecoder should pull all 'good' ORFs, rather than just the single longest one. CD-HIT is included and used as part of first identifying long orfs that are used for training a Markov model, where cd-hit removes redundant orfs from that set. You'd have to pull the longest orf for your representative transcript separately. best, ~brian > Thanks, > Mun Hua > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Brian H. <bh...@br...> - 2014-02-25 14:23:59
|
Hi Scott, It's not obvious what's going on here... Did the build of the software go fine? (typing 'make' in the base installation directory) Is ParaFly working? You should find it in the distro at: util/bin/ParaFly Just try executing it and see if it reports the usage menu. For testing, you can go into the provided sample_data/ directory, and there are various run-scripts to test different configurations. I just ran the tests in our latest SVN code and it all seems to be working correctly (on linux). If you want to try the latest SVN code, you can pull it like so: svn checkout svn://svn.code.sf.net/p/transdecoder/code-0/trunktransdecoder-code-0 best, ~brian On Mon, Feb 24, 2014 at 8:58 PM, Geib, Scott <Sco...@ar...>wrote: > I am getting error with Transdecoder and PFAM searching. Running with > transdecoder_rel16JAN2014 > > First if I run hmmscan within TD, I get the following symbolic link > error (this is stderr): > > > > CMD: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/ > get_top_longest_fasta_entries.pl transdecoder.tmp.9643/longest_orfs.cds > 2000 > transdecoder.tmp.9643/redundant_top > > CMD: /data0/opt/Clustering/cd-hit-v4.5.4-2011-03-07/cd-hit-est -r 1 -i > transdecoder.tmp.9643/redundant_top -o > transdecoder.tmp.9643/redundant_top.nr90 -M 0 -T 48 >/dev/null 2>/dev/null > > CMD: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/ > get_top_longest_fasta_entries.pl transdecoder.tmp.9643/redundant_top.nr90 > 500 > transdecoder.tmp.9643/longest_orfs.cds.top_500_longest > > CMD: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/ > compute_base_probs.pl Trinity.fasta 1 > > transdecoder.tmp.9643/base_freqs.dat > > CMD: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/ > seq_n_baseprobs_to_logliklihood_vals.pltransdecoder.tmp.9643/longest_orfs.cds.top_500_longest > transdecoder.tmp.9643/base_freqs.dat > transdecoder.tmp.9643/hexamer.scores > > CMD: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/score_CDS_liklihood_all_6_frames.pl > transdecoder.tmp.9643/longest_orfs.cds transdecoder.tmp.9643/hexamer.scores > > transdecoder.tmp.9643/longest_orfs.cds.scores > > CMD: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/ > pfam_runner.pl --pep transdecoder.tmp.9643/longest_orfs.pep --pfam_db > Pfam-A.hmm --CPU 48 -o Trinity.fasta.transdecoder.pfam.dat --workdir > transdecoder.tmp.9643 --debug > > Partitioning fasta file transdecoder.tmp.9643/longest_orfs.pep > > Processing with PFAM HMM searches... > > CMD: ParaFly -CPU 48 -c transdecoder.tmp.9643/parafly.sh --failed > transdecoder.tmp.9643/parafly.sh.failed -vv > > Can't exec "ParaFly": Too many levels of symbolic links at > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/ > pfam_runner.pl line 189. > > Error, cmd: ParaFly -CPU 48 -c transdecoder.tmp.9643/parafly.sh --failed > transdecoder.tmp.9643/parafly.sh.failed -vv died with ret -1 at > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/ > pfam_runner.pl line 192. > > Error, cmd: > /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/ > pfam_runner.pl --pep transdecoder.tmp.9643/longest_orfs.pep --pfam_db > Pfam-A.hmm --CPU 48 -o Trinity.fasta.transdecoder.pfam.dat --workdir > transdecoder.tmp.9643 --debug died with ret 10240 at > ../transdecoder_rel16JAN2014/TransDecoder line 498. > > > > > > So then I also tried to run TD and have it just make files for me to run > PFAM searches myself as a separate command. I submitted the following > command: > > ../transdecoder_rel16JAN2014/TransDecoder -t Trinity.fasta -S > --prepare_pfam > > And it seemed to just run through the whole TransDecoder run without > stopping (generated final files). Which file is supposed to be produced to > search against Pfam? > > > > I get the same errors when using the Transdecoder packaged with Trinity > releases as well. > > > > Thanks, > > Scott > > > > > This electronic message contains information generated by the USDA solely > for the intended recipients. Any unauthorized interception of this message > or the use or disclosure of the information it contains may violate the law > and subject the violator to civil or criminal penalties. If you believe you > have received this message in error, please notify the sender and delete > the email immediately. > > > ------------------------------------------------------------------------------ > Flow-based real-time traffic analytics software. Cisco certified tool. > Monitor traffic, SLAs, QoS, Medianet, WAAS etc. with NetFlow Analyzer > Customize your own dashboards, set traffic alerts and generate reports. > Network behavioral analysis & security monitoring. All-in-one tool. > > http://pubads.g.doubleclick.net/gampad/clk?id=126839071&iu=/4140/ostg.clktrk > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Geib, S. <Sco...@AR...> - 2014-02-25 02:13:38
|
I am getting error with Transdecoder and PFAM searching. Running with transdecoder_rel16JAN2014 First if I run hmmscan within TD, I get the following symbolic link error (this is stderr): CMD: /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/get_top_longest_fasta_entries.pl transdecoder.tmp.9643/longest_orfs.cds 2000 > transdecoder.tmp.9643/redundant_top CMD: /data0/opt/Clustering/cd-hit-v4.5.4-2011-03-07/cd-hit-est -r 1 -i transdecoder.tmp.9643/redundant_top -o transdecoder.tmp.9643/redundant_top.nr90 -M 0 -T 48 >/dev/null 2>/dev/null CMD: /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/get_top_longest_fasta_entries.pl transdecoder.tmp.9643/redundant_top.nr90 500 > transdecoder.tmp.9643/longest_orfs.cds.top_500_longest CMD: /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/compute_base_probs.pl Trinity.fasta 1 > transdecoder.tmp.9643/base_freqs.dat CMD: /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/seq_n_baseprobs_to_logliklihood_vals.pl transdecoder.tmp.9643/longest_orfs.cds.top_500_longest transdecoder.tmp.9643/base_freqs.dat > transdecoder.tmp.9643/hexamer.scores CMD: /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/util/score_CDS_liklihood_all_6_frames.pl transdecoder.tmp.9643/longest_orfs.cds transdecoder.tmp.9643/hexamer.scores > transdecoder.tmp.9643/longest_orfs.cds.scores CMD: /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/pfam_runner.pl --pep transdecoder.tmp.9643/longest_orfs.pep --pfam_db Pfam-A.hmm --CPU 48 -o Trinity.fasta.transdecoder.pfam.dat --workdir transdecoder.tmp.9643 --debug Partitioning fasta file transdecoder.tmp.9643/longest_orfs.pep Processing with PFAM HMM searches... CMD: ParaFly -CPU 48 -c transdecoder.tmp.9643/parafly.sh --failed transdecoder.tmp.9643/parafly.sh.failed -vv Can't exec "ParaFly": Too many levels of symbolic links at /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/pfam_runner.pl line 189. Error, cmd: ParaFly -CPU 48 -c transdecoder.tmp.9643/parafly.sh --failed transdecoder.tmp.9643/parafly.sh.failed -vv died with ret -1 at /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/pfam_runner.pl line 192. Error, cmd: /data5/Algae_RNAseq/FilterAssembly/Transdecoder/transdecoder_rel16JAN2014/pfam_runner.pl --pep transdecoder.tmp.9643/longest_orfs.pep --pfam_db Pfam-A.hmm --CPU 48 -o Trinity.fasta.transdecoder.pfam.dat --workdir transdecoder.tmp.9643 --debug died with ret 10240 at ../transdecoder_rel16JAN2014/TransDecoder line 498. So then I also tried to run TD and have it just make files for me to run PFAM searches myself as a separate command. I submitted the following command: ../transdecoder_rel16JAN2014/TransDecoder -t Trinity.fasta -S --prepare_pfam And it seemed to just run through the whole TransDecoder run without stopping (generated final files). Which file is supposed to be produced to search against Pfam? I get the same errors when using the Transdecoder packaged with Trinity releases as well. Thanks, Scott This electronic message contains information generated by the USDA solely for the intended recipients. Any unauthorized interception of this message or the use or disclosure of the information it contains may violate the law and subject the violator to civil or criminal penalties. If you believe you have received this message in error, please notify the sender and delete the email immediately. |
1 message has been excluded from this view by a project administrator.
