transdecoder-users Mailing List for TranscriptDecoder (Page 3)
Extracting likely coding regions from transcript sequences
Brought to you by:
bhaas
Menu
▾
▴
transdecoder-users — Technical support and project announcements
You can subscribe to this list here.
| 2013 |
Jan
|
Feb
|
Mar
|
Apr
|
May
|
Jun
|
Jul
|
Aug
|
Sep
|
Oct
|
Nov
|
Dec
(8) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2014 |
Jan
(12) |
Feb
(14) |
Mar
(4) |
Apr
(8) |
May
(17) |
Jun
(14) |
Jul
(21) |
Aug
(8) |
Sep
(5) |
Oct
(8) |
Nov
(1) |
Dec
(1) |
| 2015 |
Jan
(9) |
Feb
|
Mar
|
Apr
|
May
|
Jun
|
Jul
|
Aug
|
Sep
|
Oct
|
Nov
|
Dec
|
|
From: Brian H. <bh...@br...> - 2014-07-04 11:58:00
|
Greetings all, The latest release of TransDecoder is now available: http://sourceforge.net/projects/transdecoder/files/TransDecoder_r20140704.tar.gz/download including minor changes from the previous release to ensure better compatibility with other projects, including Trinity, PASA, and Trinotate Release notes: -added 'make simple' to build just the essential components involving parafly and cdhit -removed the 'cds.' prefix from the pep and cds sequence accessions. -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Brian H. <bh...@br...> - 2014-07-02 15:56:42
|
Hi Scott. We use the very liberal BSD Open Source license: Copyright (c) 2012, The Broad Institute, Inc. All rights reserved. Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: <C2><B7> Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. <C2><B7> Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. <C2><B7> Neither the name of the Broad Institute nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission.** THIS SOFTWARE IS PROVIDED BY THE BROAD INSTITUTE ''AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE BROAD INSTITUTE BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES(INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. On Wed, Jul 2, 2014 at 11:50 AM, Shorkey, Scott <Sco...@ag...> wrote: > Good afternoon, > > I'm a system administrator from Agriculture and Agri-Food Canada, a > department of the Government of Canada. Our scientists are interested in > using TransDecoder, but our department policy requires that we determine > the licensing of a software package before it may be used on our systems. > What license is TransDecoder released under, or, if it is not released > under any formal license, can you verify that it is free to utilize for > research purposes? > > Scott Shorkey > Bioinformatics System Administrator > Agriculture and Agri-Food Canada | Agriculture et Agroalimentaire Canada > KW Neatby Bldg | éd. KW Neatby > 960 Carling Ave| 960, avenue Carling > Ottawa, ON | Ottawa (ON) K1A 0C6 > E-mail Address / Adresse courriel: Sco...@ag... > Telephone | Téléphone 613-759-6409 > Government of Canada | Gouvernement du Canada > > > ------------------------------------------------------------------------------ > Open source business process management suite built on Java and Eclipse > Turn processes into business applications with Bonita BPM Community Edition > Quickly connect people, data, and systems into organized workflows > Winner of BOSSIE, CODIE, OW2 and Gartner awards > http://p.sf.net/sfu/Bonitasoft > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Shorkey, S. <Sco...@AG...> - 2014-07-02 15:50:22
|
Good afternoon, I'm a system administrator from Agriculture and Agri-Food Canada, a department of the Government of Canada. Our scientists are interested in using TransDecoder, but our department policy requires that we determine the licensing of a software package before it may be used on our systems. What license is TransDecoder released under, or, if it is not released under any formal license, can you verify that it is free to utilize for research purposes? Scott Shorkey Bioinformatics System Administrator Agriculture and Agri-Food Canada | Agriculture et Agroalimentaire Canada KW Neatby Bldg | éd. KW Neatby 960 Carling Ave| 960, avenue Carling Ottawa, ON | Ottawa (ON) K1A 0C6 E-mail Address / Adresse courriel: Sco...@ag... Telephone | Téléphone 613-759-6409 Government of Canada | Gouvernement du Canada |
|
From: Martin M. <mmo...@gm...> - 2014-06-25 07:23:34
|
Hi Alexie, hmm, I thought it is calling BLASTP already. I don't think it is worth to come up with yet another package but I understand your reasonings. Best, Martin Ale...@cs... wrote: > Hi Martin > > >> Yes, I don't mind it would resurrected mistakenly truly dead genes (pseudogenes). > I think that might be a bit out of the scope of the TransDecoder program as a lot of people would mind. Creating a second software that uses the TransDecoder output and the transcriptome assembly sounds like a better way to do it. > > a > > ________________________________________ > From: Martin MOKREJŠ [mmo...@gm...] > Sent: Tuesday, 24 June 2014 11:11 PM > To: tra...@li... > Subject: Re: [Transdecoder-users] Using BLASTN evidence for CDS predictions > > Martin MOKREJŠ wrote: >> Hi, >> I wonder whether TransDecoder could also run blastn against a somewhat related genome/transcriptome >> and considered the matching regions. They will be matching exons and the UTRs won't be conserved. >> >> Further, could TransDecoder ignore a STOP codon and merge two ORFs if the macthes are in adjacent >> frames on the same target strand? > > Aha, forgot to explain a bit more: the alignment to DNA will reveal gaps in either strand so quite helpful > hint for an artificial insertion/deletion. It should be easy for TransDecoder to realize that at that position > is likely an error. Yes, I don't mind it would resurrected mistakenly truly dead genes (pseudogenes). > > Martin |
|
From: <Ale...@cs...> - 2014-06-25 01:39:53
|
Hi Martin >Yes, I don't mind it would resurrected mistakenly truly dead genes (pseudogenes). I think that might be a bit out of the scope of the TransDecoder program as a lot of people would mind. Creating a second software that uses the TransDecoder output and the transcriptome assembly sounds like a better way to do it. a ________________________________________ From: Martin MOKREJŠ [mmo...@gm...] Sent: Tuesday, 24 June 2014 11:11 PM To: tra...@li... Subject: Re: [Transdecoder-users] Using BLASTN evidence for CDS predictions Martin MOKREJŠ wrote: > Hi, > I wonder whether TransDecoder could also run blastn against a somewhat related genome/transcriptome > and considered the matching regions. They will be matching exons and the UTRs won't be conserved. > > Further, could TransDecoder ignore a STOP codon and merge two ORFs if the macthes are in adjacent > frames on the same target strand? Aha, forgot to explain a bit more: the alignment to DNA will reveal gaps in either strand so quite helpful hint for an artificial insertion/deletion. It should be easy for TransDecoder to realize that at that position is likely an error. Yes, I don't mind it would resurrected mistakenly truly dead genes (pseudogenes). Martin ------------------------------------------------------------------------------ Open source business process management suite built on Java and Eclipse Turn processes into business applications with Bonita BPM Community Edition Quickly connect people, data, and systems into organized workflows Winner of BOSSIE, CODIE, OW2 and Gartner awards http://p.sf.net/sfu/Bonitasoft _______________________________________________ Transdecoder-users mailing list Tra...@li... https://lists.sourceforge.net/lists/listinfo/transdecoder-users |
|
From: Martin M. <mmo...@gm...> - 2014-06-24 13:12:28
|
Martin MOKREJŠ wrote: > Hi, > I wonder whether TransDecoder could also run blastn against a somewhat related genome/transcriptome > and considered the matching regions. They will be matching exons and the UTRs won't be conserved. > > Further, could TransDecoder ignore a STOP codon and merge two ORFs if the macthes are in adjacent > frames on the same target strand? Aha, forgot to explain a bit more: the alignment to DNA will reveal gaps in either strand so quite helpful hint for an artificial insertion/deletion. It should be easy for TransDecoder to realize that at that position is likely an error. Yes, I don't mind it would resurrected mistakenly truly dead genes (pseudogenes). Martin |
|
From: Martin M. <mmo...@gm...> - 2014-06-24 13:08:38
|
Hi, I wonder whether TransDecoder could also run blastn against a somewhat related genome/transcriptome and considered the matching regions. They will be matching exons and the UTRs won't be conserved. Further, could TransDecoder ignore a STOP codon and merge two ORFs if the macthes are in adjacent frames on the same target strand? At least ideas for the future, Martin |
|
From: Brian H. <bh...@br...> - 2014-06-11 01:58:01
|
Hi David, All orfs found to have pfam hits should be included in the final transdecoder.pep output file. If this is not the case, then there could be a bug that we weren't aware of. If you take your 'missing' transcripts and run them through transdecoder separately, is it not picking them up and reporting them in the final output? If there's a bug, we'll need some example data to help troubleshoot it. many thanks, ~brian On Tue, Jun 10, 2014 at 9:42 AM, 卢 汉斌 <lh...@gm...> wrote: > Hello everyone, > > I use the following command to find coding region in my trinity assembly: > > TransDecoder -t target_transcripts.fasta --reuse --search_pfam /path_to_transdecoder/pfam/Pfam-AB.hmm.bin --CPU 5 > > > It generates several output files. Next, I want to find the transcripts that contain the domain I interested. I search the target_transcripts.transdecorder.pfam.dat ( .domtbl ) file for lines that contain the name of the domain I am interested. A typical record is display as follow: > > > DUF640 PF04852.7 133 Unigene0069328|m.26647 - 127 1.2e-50 172.2 0.1 1 1 5.6e-55 2e-50 171.6 0.1 39 133 1 95 1 95 0.99 Protein of unknown function (DUF640) > > I get the ids ( "Unigene0069328|m.26647" in the example line ) and pick up those protein sequences in the target_transcripts.transdecorder.pep file, output of the TransDecoder. However, many records I found in the pfam.dat cannot be found in .pep file. > > I select several "missing sequences" and predict their coding region on NCBI. They all have ORFs and the domain I interested. So why are these sequences not transformed to peptide sequences and record in the TransDecoder output file —— target_transcripts.transdecorder.pep. > > Thank you for your help. > > Best, > David Lu > > > > ------------------------------------------------------------------------------ > HPCC Systems Open Source Big Data Platform from LexisNexis Risk Solutions > Find What Matters Most in Your Big Data with HPCC Systems > Open Source. Fast. Scalable. Simple. Ideal for Dirty Data. > Leverages Graph Analysis for Fast Processing & Easy Data Exploration > http://p.sf.net/sfu/hpccsystems > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: 卢 汉斌 <lh...@gm...> - 2014-06-10 13:42:21
|
Hello everyone, I use the following command to find coding region in my trinity assembly: TransDecoder -t target_transcripts.fasta --reuse --search_pfam /path_to_transdecoder/pfam/Pfam-AB.hmm.bin --CPU 5 It generates several output files. Next, I want to find the transcripts that contain the domain I interested. I search the target_transcripts.transdecorder.pfam.dat ( .domtbl ) file for lines that contain the name of the domain I am interested. A typical record is display as follow: DUF640 PF04852.7 133 Unigene0069328|m.26647 - 127 1.2e-50 172.2 0.1 1 1 5.6e-55 2e-50 171.6 0.1 39 133 1 95 1 95 0.99 Protein of unknown function (DUF640) I get the ids ( "Unigene0069328|m.26647" in the example line ) and pick up those protein sequences in the target_transcripts.transdecorder.pep file, output of the TransDecoder. However, many records I found in the pfam.dat cannot be found in .pep file. I select several "missing sequences" and predict their coding region on NCBI. They all have ORFs and the domain I interested. So why are these sequences not transformed to peptide sequences and record in the TransDecoder output file —— target_transcripts.transdecorder.pep. Thank you for your help. Best, David Lu |
|
From: Brian H. <bh...@br...> - 2014-06-07 18:53:29
|
Gotcha! Thanks for the update. Note - beware of using the inchworm contigs. The inchworm output can be useful, but it's really intended to be an intermediate, that the rest of Trinity fine-tunes in various ways. best, ~brian On Sat, Jun 7, 2014 at 1:59 PM, Brown, Matthew <mw...@ms...> wrote: > Hi Brian, > It is the occurrence of ";" in the headers. Everything seems to be working > fine now. I just added a script to handle the replacement of ";" to ":" in > my fasta inputs. > > Best, > Matt > > > Matthew W. Brown, Ph.D. > Assistant Professor > Biological Sciences > Mississippi State University > 008 Harned Hall > Mississippi State, MS 39762 > 662-325-2406 > http://mwb250.biology.msstate.edu > > ------------------------------ > *From:* Brown, Matthew > *Sent:* Saturday, June 7, 2014 12:49 PM > *To:* Brian Haas > *Cc:* tra...@li... > *Subject:* RE: [Transdecoder-users] Transdecoder died with ret 6400 at > line 498 > > Hi Brian, > > It turns out to be the headers. I was using an inchworm output header > that seems to be the problem. I scripted a header change to simplify the > headers. I am not sure at the moment what the problem is, be it whitespace > or non-alphanumeric characters (i.e., ";" or ":"). I will do some tests and > report back. > > Best, > Matt > > > Matthew W. Brown, Ph.D. > Assistant Professor > Biological Sciences > Mississippi State University > 008 Harned Hall > Mississippi State, MS 39762 > 662-325-2406 > http://mwb250.biology.msstate.edu > > ------------------------------ > *From:* Brian Haas <bh...@br...> > *Sent:* Saturday, June 7, 2014 9:27 AM > *To:* Brown, Matthew > *Cc:* tra...@li... > *Subject:* Re: [Transdecoder-users] Transdecoder died with ret 6400 at > line 498 > > Hi Matt, > > Can you try pulling our latest dev code: > > svn checkout svn://svn.code.sf.net/p/transdecoder/code-0/trunk > transdecoder-code-0 > > and see if it still errors out? If so, we'll take it from there. > > best, > > ~brian > > > > > On Sat, Jun 7, 2014 at 10:08 AM, Brown, Matthew <mw...@ms...> > wrote: > >> Dear Brian, >> >> My transdecoder install seems to work up until an error that I can not >> overcome during the best candidate selection. Do you have any suggestions? >> >> Error, no gene obj retrieved based on identifier a2;23981|m.1 at >> /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/../PerlLib/Gene_obj_indexer.pm >> line 61, <$fh> line 1. >> Gene_obj_indexer::get_gene('Gene_obj_indexer=HASH(0x1df59a0)', >> 'a2;23981|m.1') called at >> /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/ >> gene_list_to_gff.pl line 29 >> Error, cmd: /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/ >> gene_list_to_gff.pl >> transdecoder.tmp.25824/longest_orfs.cds.scores.selected >> transdecoder.tmp.25824/longest_orfs.gff3.inx > >> transdecoder.tmp.25824/longest_orfs.cds.best_candidates.gff3 died with ret >> 6400 at /home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/TransDecoder line >> 498. >> >> Thank you in advance! >> Matt >> >> Matthew W. Brown, Ph.D. >> Assistant Professor >> Biological Sciences >> Mississippi State University >> 008 Harned Hall >> Mississippi State, MS 39762 >> 662-325-2406 >> http://mwb250.biology.msstate.edu >> >> >> >> ------------------------------------------------------------------------------ >> Learn Graph Databases - Download FREE O'Reilly Book >> "Graph Databases" is the definitive new guide to graph databases and their >> applications. Written by three acclaimed leaders in the field, >> this first edition is now available. Download your free book today! >> http://p.sf.net/sfu/NeoTech >> _______________________________________________ >> Transdecoder-users mailing list >> Tra...@li... >> https://lists.sourceforge.net/lists/listinfo/transdecoder-users >> >> > > > -- > -- > Brian J. Haas > The Broad Institute > http://broad.mit.edu/~bhaas > > > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Brown, M. <mw...@ms...> - 2014-06-07 17:59:44
|
Hi Brian, It is the occurrence of ";" in the headers. Everything seems to be working fine now. I just added a script to handle the replacement of ";" to ":" in my fasta inputs. Best, Matt Matthew W. Brown, Ph.D. Assistant Professor Biological Sciences Mississippi State University 008 Harned Hall Mississippi State, MS 39762 662-325-2406 http://mwb250.biology.msstate.edu<http://mwb250.biology.msstate.edu/> ________________________________ From: Brown, Matthew Sent: Saturday, June 7, 2014 12:49 PM To: Brian Haas Cc: tra...@li... Subject: RE: [Transdecoder-users] Transdecoder died with ret 6400 at line 498 Hi Brian, It turns out to be the headers. I was using an inchworm output header that seems to be the problem. I scripted a header change to simplify the headers. I am not sure at the moment what the problem is, be it whitespace or non-alphanumeric characters (i.e., ";" or ":"). I will do some tests and report back. Best, Matt Matthew W. Brown, Ph.D. Assistant Professor Biological Sciences Mississippi State University 008 Harned Hall Mississippi State, MS 39762 662-325-2406 http://mwb250.biology.msstate.edu<http://mwb250.biology.msstate.edu/> ________________________________ From: Brian Haas <bh...@br...> Sent: Saturday, June 7, 2014 9:27 AM To: Brown, Matthew Cc: tra...@li... Subject: Re: [Transdecoder-users] Transdecoder died with ret 6400 at line 498 Hi Matt, Can you try pulling our latest dev code: svn checkout svn://svn.code.sf.net/p/transdecoder/code-0/trunk<http://svn.code.sf.net/p/transdecoder/code-0/trunk> transdecoder-code-0 and see if it still errors out? If so, we'll take it from there. best, ~brian On Sat, Jun 7, 2014 at 10:08 AM, Brown, Matthew <mw...@ms...<mailto:mw...@ms...>> wrote: Dear Brian, My transdecoder install seems to work up until an error that I can not overcome during the best candidate selection. Do you have any suggestions? Error, no gene obj retrieved based on identifier a2;23981|m.1 at /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/../PerlLib/Gene_obj_indexer.pm line 61, <$fh> line 1. Gene_obj_indexer::get_gene('Gene_obj_indexer=HASH(0x1df59a0)', 'a2;23981|m.1') called at /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/gene_list_to_gff.pl<http://gene_list_to_gff.pl> line 29 Error, cmd: /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/gene_list_to_gff.pl<http://gene_list_to_gff.pl> transdecoder.tmp.25824/longest_orfs.cds.scores.selected transdecoder.tmp.25824/longest_orfs.gff3.inx > transdecoder.tmp.25824/longest_orfs.cds.best_candidates.gff3 died with ret 6400 at /home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/TransDecoder line 498. Thank you in advance! Matt Matthew W. Brown, Ph.D. Assistant Professor Biological Sciences Mississippi State University 008 Harned Hall Mississippi State, MS 39762 662-325-2406<tel:662-325-2406> http://mwb250.biology.msstate.edu<http://mwb250.biology.msstate.edu/> ------------------------------------------------------------------------------ Learn Graph Databases - Download FREE O'Reilly Book "Graph Databases" is the definitive new guide to graph databases and their applications. Written by three acclaimed leaders in the field, this first edition is now available. Download your free book today! http://p.sf.net/sfu/NeoTech _______________________________________________ Transdecoder-users mailing list Tra...@li...<mailto:Tra...@li...> https://lists.sourceforge.net/lists/listinfo/transdecoder-users -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Brown, M. <mw...@ms...> - 2014-06-07 17:49:41
|
Hi Brian, It turns out to be the headers. I was using an inchworm output header that seems to be the problem. I scripted a header change to simplify the headers. I am not sure at the moment what the problem is, be it whitespace or non-alphanumeric characters (i.e., ";" or ":"). I will do some tests and report back. Best, Matt Matthew W. Brown, Ph.D. Assistant Professor Biological Sciences Mississippi State University 008 Harned Hall Mississippi State, MS 39762 662-325-2406 http://mwb250.biology.msstate.edu<http://mwb250.biology.msstate.edu/> ________________________________ From: Brian Haas <bh...@br...> Sent: Saturday, June 7, 2014 9:27 AM To: Brown, Matthew Cc: tra...@li... Subject: Re: [Transdecoder-users] Transdecoder died with ret 6400 at line 498 Hi Matt, Can you try pulling our latest dev code: svn checkout svn://svn.code.sf.net/p/transdecoder/code-0/trunk<http://svn.code.sf.net/p/transdecoder/code-0/trunk> transdecoder-code-0 and see if it still errors out? If so, we'll take it from there. best, ~brian On Sat, Jun 7, 2014 at 10:08 AM, Brown, Matthew <mw...@ms...<mailto:mw...@ms...>> wrote: Dear Brian, My transdecoder install seems to work up until an error that I can not overcome during the best candidate selection. Do you have any suggestions? Error, no gene obj retrieved based on identifier a2;23981|m.1 at /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/../PerlLib/Gene_obj_indexer.pm line 61, <$fh> line 1. Gene_obj_indexer::get_gene('Gene_obj_indexer=HASH(0x1df59a0)', 'a2;23981|m.1') called at /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/gene_list_to_gff.pl<http://gene_list_to_gff.pl> line 29 Error, cmd: /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/gene_list_to_gff.pl<http://gene_list_to_gff.pl> transdecoder.tmp.25824/longest_orfs.cds.scores.selected transdecoder.tmp.25824/longest_orfs.gff3.inx > transdecoder.tmp.25824/longest_orfs.cds.best_candidates.gff3 died with ret 6400 at /home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/TransDecoder line 498. Thank you in advance! Matt Matthew W. Brown, Ph.D. Assistant Professor Biological Sciences Mississippi State University 008 Harned Hall Mississippi State, MS 39762 662-325-2406<tel:662-325-2406> http://mwb250.biology.msstate.edu<http://mwb250.biology.msstate.edu/> ------------------------------------------------------------------------------ Learn Graph Databases - Download FREE O'Reilly Book "Graph Databases" is the definitive new guide to graph databases and their applications. Written by three acclaimed leaders in the field, this first edition is now available. Download your free book today! http://p.sf.net/sfu/NeoTech _______________________________________________ Transdecoder-users mailing list Tra...@li...<mailto:Tra...@li...> https://lists.sourceforge.net/lists/listinfo/transdecoder-users -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Brown, M. <mw...@ms...> - 2014-06-07 17:23:14
|
Hi Brian,
I pulled off the trunk and recompiled. Same issue though:
Error, no gene obj retrieved based on identifier a2;23981|m.1 at /misc/home/mbrown/SOFTWARE/transdecoder_rel7JUN2014/util/../PerlLib/Gene_obj_indexer.pm line 61, <$fh> line 1.
Gene_obj_indexer::get_gene('Gene_obj_indexer=HASH(0xf499e0)', 'a2;23981|m.1') called at /misc/home/mbrown/SOFTWARE/transdecoder_rel7JUN2014/util/gene_list_to_gff.pl line 29
Error, cmd: /misc/home/mbrown/SOFTWARE/transdecoder_rel7JUN2014/util/gene_list_to_gff.pl transdecoder.tmp.49169/longest_orfs.cds.scores.selected transdecoder.tmp.49169/longest_orfs.gff3.inx > transdecoder.tmp.49169/longest_orfs.cds.best_candidates.gff3 died with ret 6400 at /misc/home/mbrown/SOFTWARE/transdecoder_rel7JUN2014/TransDecoder line 505.
Matthew W. Brown, Ph.D.
Assistant Professor
Biological Sciences
Mississippi State University
008 Harned Hall
Mississippi State, MS 39762
662-325-2406
http://mwb250.biology.msstate.edu<http://mwb250.biology.msstate.edu/>
________________________________
From: Brian Haas <bh...@br...>
Sent: Saturday, June 7, 2014 9:27 AM
To: Brown, Matthew
Cc: tra...@li...
Subject: Re: [Transdecoder-users] Transdecoder died with ret 6400 at line 498
Hi Matt,
Can you try pulling our latest dev code:
svn checkout svn://svn.code.sf.net/p/transdecoder/code-0/trunk<http://svn.code.sf.net/p/transdecoder/code-0/trunk> transdecoder-code-0
and see if it still errors out? If so, we'll take it from there.
best,
~brian
On Sat, Jun 7, 2014 at 10:08 AM, Brown, Matthew <mw...@ms...<mailto:mw...@ms...>> wrote:
Dear Brian,
My transdecoder install seems to work up until an error that I can not overcome during the best candidate selection. Do you have any suggestions?
Error, no gene obj retrieved based on identifier a2;23981|m.1 at /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/../PerlLib/Gene_obj_indexer.pm line 61, <$fh> line 1.
Gene_obj_indexer::get_gene('Gene_obj_indexer=HASH(0x1df59a0)', 'a2;23981|m.1') called at /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/gene_list_to_gff.pl<http://gene_list_to_gff.pl> line 29
Error, cmd: /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/gene_list_to_gff.pl<http://gene_list_to_gff.pl> transdecoder.tmp.25824/longest_orfs.cds.scores.selected transdecoder.tmp.25824/longest_orfs.gff3.inx > transdecoder.tmp.25824/longest_orfs.cds.best_candidates.gff3 died with ret 6400 at /home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/TransDecoder line 498.
Thank you in advance!
Matt
Matthew W. Brown, Ph.D.
Assistant Professor
Biological Sciences
Mississippi State University
008 Harned Hall
Mississippi State, MS 39762
662-325-2406<tel:662-325-2406>
http://mwb250.biology.msstate.edu<http://mwb250.biology.msstate.edu/>
------------------------------------------------------------------------------
Learn Graph Databases - Download FREE O'Reilly Book
"Graph Databases" is the definitive new guide to graph databases and their
applications. Written by three acclaimed leaders in the field,
this first edition is now available. Download your free book today!
http://p.sf.net/sfu/NeoTech
_______________________________________________
Transdecoder-users mailing list
Tra...@li...<mailto:Tra...@li...>
https://lists.sourceforge.net/lists/listinfo/transdecoder-users
--
--
Brian J. Haas
The Broad Institute
http://broad.mit.edu/~bhaas
|
|
From: Brian H. <bh...@br...> - 2014-06-07 14:27:09
|
Hi Matt, Can you try pulling our latest dev code: svn checkout svn://svn.code.sf.net/p/transdecoder/code-0/trunk transdecoder-code-0 and see if it still errors out? If so, we'll take it from there. best, ~brian On Sat, Jun 7, 2014 at 10:08 AM, Brown, Matthew <mw...@ms...> wrote: > Dear Brian, > > My transdecoder install seems to work up until an error that I can not > overcome during the best candidate selection. Do you have any suggestions? > > Error, no gene obj retrieved based on identifier a2;23981|m.1 at > /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/../PerlLib/Gene_obj_indexer.pm > line 61, <$fh> line 1. > Gene_obj_indexer::get_gene('Gene_obj_indexer=HASH(0x1df59a0)', > 'a2;23981|m.1') called at > /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/ > gene_list_to_gff.pl line 29 > Error, cmd: /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/ > gene_list_to_gff.pl > transdecoder.tmp.25824/longest_orfs.cds.scores.selected > transdecoder.tmp.25824/longest_orfs.gff3.inx > > transdecoder.tmp.25824/longest_orfs.cds.best_candidates.gff3 died with ret > 6400 at /home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/TransDecoder line > 498. > > Thank you in advance! > Matt > > Matthew W. Brown, Ph.D. > Assistant Professor > Biological Sciences > Mississippi State University > 008 Harned Hall > Mississippi State, MS 39762 > 662-325-2406 > http://mwb250.biology.msstate.edu > > > > ------------------------------------------------------------------------------ > Learn Graph Databases - Download FREE O'Reilly Book > "Graph Databases" is the definitive new guide to graph databases and their > applications. Written by three acclaimed leaders in the field, > this first edition is now available. Download your free book today! > http://p.sf.net/sfu/NeoTech > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Brown, M. <mw...@ms...> - 2014-06-07 14:22:54
|
Dear Brian,
My transdecoder install seems to work up until an error that I can not overcome during the best candidate selection. Do you have any suggestions?
Error, no gene obj retrieved based on identifier a2;23981|m.1 at /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/../PerlLib/Gene_obj_indexer.pm line 61, <$fh> line 1.
Gene_obj_indexer::get_gene('Gene_obj_indexer=HASH(0x1df59a0)', 'a2;23981|m.1') called at /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/gene_list_to_gff.pl line 29
Error, cmd: /misc/home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/util/gene_list_to_gff.pl transdecoder.tmp.25824/longest_orfs.cds.scores.selected transdecoder.tmp.25824/longest_orfs.gff3.inx > transdecoder.tmp.25824/longest_orfs.cds.best_candidates.gff3 died with ret 6400 at /home/mbrown/SOFTWARE/transdecoder_rel16JAN2014/TransDecoder line 498.
Thank you in advance!
Matt
Matthew W. Brown, Ph.D.
Assistant Professor
Biological Sciences
Mississippi State University
008 Harned Hall
Mississippi State, MS 39762
662-325-2406
http://mwb250.biology.msstate.edu<http://mwb250.biology.msstate.edu/>
|
|
From: Brian H. <bh...@br...> - 2014-06-06 16:46:12
|
Hi Joel, I'm wondering if we already resolve this issue in our development code, as it's changed from the version you're using. If you want to give it a try, you can pull it like so: svn checkout svn://svn.code.sf.net/p/transdecoder/code-0/trunk transdecoder-code-0 best, ~brian On Fri, Jun 6, 2014 at 11:34 AM, Joel Fillon, Mr <joe...@mc...> wrote: > Hi Brian, > > When I rerun transdecoder in a directory where it was already run, I get > an error during symlink creation: > ln: creating symbolic link `Trinity.fasta.transdecoder.pfam.dat.domtbl': > File exists > > Not a big deal; I can delete the symlink first but maybe you could do it > in the same way you overwrite other files. > > I guess it's in: > > trinityrnaseq_r20140413p1/trinity-plugins/TransDecoder_r20131110/ > pfam_runner.pl > > lines 183 and 210: replace > > &process_cmd("ln -s $pfam_out $pfam_out.domtbl"); > > by > > &process_cmd("ln -s -f $pfam_out $pfam_out.domtbl"); > > Thanks for your work! > Best > Joël > > ------------------------------------------------------------------------------ > Learn Graph Databases - Download FREE O'Reilly Book > "Graph Databases" is the definitive new guide to graph databases and their > applications. Written by three acclaimed leaders in the field, > this first edition is now available. Download your free book today! > http://p.sf.net/sfu/NeoTech > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Joel F. M. <joe...@mc...> - 2014-06-06 15:47:32
|
Hi Brian,
When I rerun transdecoder in a directory where it was already run, I get an error during symlink creation:
ln: creating symbolic link `Trinity.fasta.transdecoder.pfam.dat.domtbl': File exists
Not a big deal; I can delete the symlink first but maybe you could do it in the same way you overwrite other files.
I guess it's in:
trinityrnaseq_r20140413p1/trinity-plugins/TransDecoder_r20131110/pfam_runner.pl
lines 183 and 210: replace
&process_cmd("ln -s $pfam_out $pfam_out.domtbl");
by
&process_cmd("ln -s -f $pfam_out $pfam_out.domtbl");
Thanks for your work!
Best
Joël
|
|
From: Brian H. <bh...@br...> - 2014-05-14 22:05:13
|
Hi Andre, Transdecoder doesn't have a start-codon finding function. It finds the longest ORFs, and in the case where there isn't an intervening in-frame stop-codon between your optimal start codon and the 5' end of the sequence, it's going to simply assume that the transcript is not full-length and give you the full translation from the beginning of the transcript. Usually, there's an in-frame stop codon in the 5' UTR that prevents most full-length transcripts from being reported as 5' partials. I suppose, if you have a GC-rich target (rarer random stop codons), this could definitely be more of an issue. The high prevalence of 5' partials tends to be a general indicator of not having full-length transcripts, resulting from the 3' coverage bias typical of poly-A captured cDNA sequencing. I'm sure there are occassions where a genuine full-length transcript has an in-frame translatable 5' UTR, but in my experience, these have generally been the rare exceptions. cheers, ~brian On Wed, May 14, 2014 at 5:57 PM, Andre Minoche <And...@cr...> wrote: > Dear Matt, > > Thank you for your quick reply. > > The quality of the reference sequence from which I derived the cds is not > an issue. > > I have full length transcript cDNA sequences I aligned to a high quality > genome assembly. From the alignment coordinates and using the genome > assembly as source, I derived high quality mRNA sequences I used as input > for transdecoder. > > Deep RNA-seq data confirms the full length nature of my cDNA sequences. At > the locations where my full length transcripts align I also have Augustus > gene models supported by RNA-seq data. The ORFs of the predicted gene > models generally correspond to the ORFs of transdecoder, with the > exception, that in many cases transdecoder ORFs start upstream of the > Augustus start codon and not with an ATG (5prime_partial, ORFs). > > Best regards > André > > On 14 May 2014, at 21:44, Matthew MacManes <mat...@un...> > wrote: > > Andre, > > Alternatively, this could be a metric of assembly quality (e.g. > http://journal.frontiersin.org/Journal/10.3389/fgene.2014.00013/abstract) > which may be a function of the input data. Can you tell us a little bit > about the type and quantity of data used in this assembly? > > Matt > > __________________________________ > *Matthew MacManes*, Ph.D. > University of New Hampshire I Assistant Professor > Department of Molecular, Cellular, & Biomedical Sciences > Durham, NH 03824 > Phone: 603-862-4052 I Twitter: @PeroMHC <https://twitter.com/PeroMHC> > Web: genomebio.org > Office: 189 Rudman Hall I Lab: 145 Rudman Hall > > > On Wed, May 14, 2014 at 2:44 PM, Andre Minoche <And...@cr...>wrote: > >> >> Hi, >> >> First of all thanks for providing a tool to predict ORFs. >> >> I am surprised to see, that so many of my ORFs predicted with >> transdecoder do not start with ATG (5prime_partial, 650 out of 1807). >> >> To me it seems like a malfunction of the software. >> >> Is there an easy way to trim the ORFs to the nearest start codon? >> >> Thanks >> André >> >> -- >> André Minoche, Postdoc >> >> Centre for Genomic Regulation (CRG) >> Doctor Aiguader, 88, 4th floor >> 08003 Barcelona >> >> http://seq.crg.es >> >> >> >> ------------------------------------------------------------------------------ >> "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE >> Instantly run your Selenium tests across 300+ browser/OS combos. >> Get unparalleled scalability from the best Selenium testing platform >> available >> Simple to use. Nothing to install. Get started now for free." >> http://p.sf.net/sfu/SauceLabs >> _______________________________________________ >> Transdecoder-users mailing list >> Tra...@li... >> https://lists.sourceforge.net/lists/listinfo/transdecoder-users >> > > > > > ------------------------------------------------------------------------------ > "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE > Instantly run your Selenium tests across 300+ browser/OS combos. > Get unparalleled scalability from the best Selenium testing platform > available > Simple to use. Nothing to install. Get started now for free." > http://p.sf.net/sfu/SauceLabs > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Andre M. <And...@cr...> - 2014-05-14 21:57:24
|
Dear Matt, Thank you for your quick reply. The quality of the reference sequence from which I derived the cds is not an issue. I have full length transcript cDNA sequences I aligned to a high quality genome assembly. From the alignment coordinates and using the genome assembly as source, I derived high quality mRNA sequences I used as input for transdecoder. Deep RNA-seq data confirms the full length nature of my cDNA sequences. At the locations where my full length transcripts align I also have Augustus gene models supported by RNA-seq data. The ORFs of the predicted gene models generally correspond to the ORFs of transdecoder, with the exception, that in many cases transdecoder ORFs start upstream of the Augustus start codon and not with an ATG (5prime_partial, ORFs). Best regards André On 14 May 2014, at 21:44, Matthew MacManes <mat...@un...<mailto:mat...@un...>> wrote: Andre, Alternatively, this could be a metric of assembly quality (e.g. http://journal.frontiersin.org/Journal/10.3389/fgene.2014.00013/abstract) which may be a function of the input data. Can you tell us a little bit about the type and quantity of data used in this assembly? Matt __________________________________ Matthew MacManes, Ph.D. University of New Hampshire I Assistant Professor Department of Molecular, Cellular, & Biomedical Sciences Durham, NH 03824 Phone: 603-862-4052 I Twitter: @PeroMHC<https://twitter.com/PeroMHC> Web: genomebio.org<http://genomebio.org/> Office: 189 Rudman Hall I Lab: 145 Rudman Hall On Wed, May 14, 2014 at 2:44 PM, Andre Minoche <And...@cr...<mailto:And...@cr...>> wrote: Hi, First of all thanks for providing a tool to predict ORFs. I am surprised to see, that so many of my ORFs predicted with transdecoder do not start with ATG (5prime_partial, 650 out of 1807). To me it seems like a malfunction of the software. Is there an easy way to trim the ORFs to the nearest start codon? Thanks André -- André Minoche, Postdoc Centre for Genomic Regulation (CRG) Doctor Aiguader, 88, 4th floor 08003 Barcelona http://seq.crg.es<http://seq.crg.es/> ------------------------------------------------------------------------------ "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE Instantly run your Selenium tests across 300+ browser/OS combos. Get unparalleled scalability from the best Selenium testing platform available Simple to use. Nothing to install. Get started now for free." http://p.sf.net/sfu/SauceLabs _______________________________________________ Transdecoder-users mailing list Tra...@li...<mailto:Tra...@li...> https://lists.sourceforge.net/lists/listinfo/transdecoder-users |
|
From: Andre M. <And...@cr...> - 2014-05-14 21:57:22
|
Dear Matt, Thank you for your quick reply. The quality of the reference sequence from which I derived the cds is not an issue. I have full length transcript cDNA sequences I aligned to a high quality genome assembly. From the alignment coordinates and using the genome assembly as source, I derived high quality mRNA sequences I used as input for transdecoder. Deep RNA-seq data confirms the full length nature of my cDNA sequences. At the locations where my full length transcripts align I also have Augustus gene models supported by RNA-seq data. The ORFs of the predicted gene models generally correspond to the ORFs of transdecoder, with the exception, that in many cases transdecoder ORFs start upstream of the Augustus start codon and not with an ATG (5prime_partial, ORFs). Best regards André On 14 May 2014, at 21:44, Matthew MacManes <mat...@un...<mailto:mat...@un...>> wrote: Andre, Alternatively, this could be a metric of assembly quality (e.g. http://journal.frontiersin.org/Journal/10.3389/fgene.2014.00013/abstract) which may be a function of the input data. Can you tell us a little bit about the type and quantity of data used in this assembly? Matt __________________________________ Matthew MacManes, Ph.D. University of New Hampshire I Assistant Professor Department of Molecular, Cellular, & Biomedical Sciences Durham, NH 03824 Phone: 603-862-4052 I Twitter: @PeroMHC<https://twitter.com/PeroMHC> Web: genomebio.org<http://genomebio.org/> Office: 189 Rudman Hall I Lab: 145 Rudman Hall On Wed, May 14, 2014 at 2:44 PM, Andre Minoche <And...@cr...<mailto:And...@cr...>> wrote: Hi, First of all thanks for providing a tool to predict ORFs. I am surprised to see, that so many of my ORFs predicted with transdecoder do not start with ATG (5prime_partial, 650 out of 1807). To me it seems like a malfunction of the software. Is there an easy way to trim the ORFs to the nearest start codon? Thanks André -- André Minoche, Postdoc Centre for Genomic Regulation (CRG) Doctor Aiguader, 88, 4th floor 08003 Barcelona http://seq.crg.es<http://seq.crg.es/> ------------------------------------------------------------------------------ "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE Instantly run your Selenium tests across 300+ browser/OS combos. Get unparalleled scalability from the best Selenium testing platform available Simple to use. Nothing to install. Get started now for free." http://p.sf.net/sfu/SauceLabs _______________________________________________ Transdecoder-users mailing list Tra...@li...<mailto:Tra...@li...> https://lists.sourceforge.net/lists/listinfo/transdecoder-users |
|
From: Matthew M. <mat...@un...> - 2014-05-14 19:45:29
|
Andre, Alternatively, this could be a metric of assembly quality (e.g. http://journal.frontiersin.org/Journal/10.3389/fgene.2014.00013/abstract) which may be a function of the input data. Can you tell us a little bit about the type and quantity of data used in this assembly? Matt __________________________________ *Matthew MacManes*, Ph.D. University of New Hampshire I Assistant Professor Department of Molecular, Cellular, & Biomedical Sciences Durham, NH 03824 Phone: 603-862-4052 I Twitter: @PeroMHC <https://twitter.com/PeroMHC> Web: genomebio.org Office: 189 Rudman Hall I Lab: 145 Rudman Hall On Wed, May 14, 2014 at 2:44 PM, Andre Minoche <And...@cr...> wrote: > > Hi, > > First of all thanks for providing a tool to predict ORFs. > > I am surprised to see, that so many of my ORFs predicted with > transdecoder do not start with ATG (5prime_partial, 650 out of 1807). > > To me it seems like a malfunction of the software. > > Is there an easy way to trim the ORFs to the nearest start codon? > > Thanks > André > > -- > André Minoche, Postdoc > > Centre for Genomic Regulation (CRG) > Doctor Aiguader, 88, 4th floor > 08003 Barcelona > > http://seq.crg.es > > > > ------------------------------------------------------------------------------ > "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE > Instantly run your Selenium tests across 300+ browser/OS combos. > Get unparalleled scalability from the best Selenium testing platform > available > Simple to use. Nothing to install. Get started now for free." > http://p.sf.net/sfu/SauceLabs > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > |
|
From: Andre M. <And...@cr...> - 2014-05-14 18:57:04
|
Hi,
First of all thanks for providing a tool to predict ORFs.
I am surprised to see, that so many of my ORFs predicted with
transdecoder do not start with ATG (5prime_partial, 650 out of 1807).
To me it seems like a malfunction of the software.
Is there an easy way to trim the ORFs to the nearest start codon?
Thanks
André
--
André Minoche, Postdoc
Centre for Genomic Regulation (CRG)
Doctor Aiguader, 88, 4th floor
08003 Barcelona
http://seq.crg.es
|
|
From: Brian H. <bh...@br...> - 2014-05-14 00:25:37
|
Excellent! Thanks for the update! ~brian On Tue, May 13, 2014 at 6:54 PM, Edward Gilding <e.g...@im...>wrote: > Hi Brian > > > > Thanks! That did the trick. It works like a charm now. > > > > -Ed > > > > Dr. Edward K Gilding > > > > The Institute of Molecular Biosciences > > The University of Queensland > > Brisbane, QLD 4072 > > Australia > > > > O: +61 07 3346 2014 > > > > *From:* Brian Haas [mailto:bh...@br...] > *Sent:* Tuesday, 13 May 2014 1:27 AM > *To:* Edward Gilding > *Cc:* tra...@li... > *Subject:* Re: [Transdecoder-users] Transdecoder help: failure to output > final .pep files > > > > Hi Ed, > > > > It might be that the fasta header format of your transcripts file is > incompatible with transdecoder. Perhaps try creating a version of the file > that has a simpler header format, such as by: > > > > cat input.fasta | perl -lane 's/centroid=//; s/;.*//g; print;' > > input.adj.fasta > > > > and running the input.adj.fasta through transdecoder. > > > > If it still fails, we can look into it further. > > > > best, > > > > ~brian > > > > > > On Sun, May 11, 2014 at 11:43 PM, Edward Gilding <e.g...@im...> > wrote: > > Hello > > > > I’ve been trying to run Transdecoder with pfam searching on transcriptome > assemblies that I made using Soapdenovo-Trans(SdT). With different > assemblies and different PBS parameters (like where I place the data on our > system’s parallel shared file system etc), Transdecoder creates the temp > directory with some of the intermediate files. No finished output files are > ever produced. Once I got the .dat file with the pfam hits for my assembly > but there were no final .pep .gff3 .cds or .bed files produced and stored > anywhere. Am I missing something? > > > > Unlike Trinity, SdT plugs in Ns if there is an expected gap between the > fragments of a transcript. Could these Ns be tripping up Transdecoder? > > > > NOTES: > > My scripts load the modules our system operators made for Transdecoder and > hmmer before sending commands for Transdecoder. > > > > These are example entries from my input fasta: > > > > >centroid=Fi49merScaf_11503;seqs=3; > > > AACTAAGGGTTTGTTGCTTTTATCAGCGAAATATATTAATGTTTTTAAATTATAGTTGACAACTTTACCGATGAACTATTGAGGTACAGCTTTTTGGGAACATATAGTCTAGTGCCAAGTCCTTCTAGTGCTTTCACACACTCGGCAATACTCTCTTCACTATCAATGTCCATGTTCCAAATTGCCGC… > > >centroid=Fi49merScaf_29126;seqs=1; > > > TTGGCTGAGAGAACTTACACAAGCCACTTATCGAGCTTCTGCCCCTCCGCCCATCAACATACTTGGAGAACTAAGCAATGATGTAGCGGAAACTGCTGAACCTAGAGCTGTAAATGCTAGGACAGCGGATCTTGTTGTTAATGGAACACTGATTGAGATGAAGTTATCATTATATGTGAAGG… > > centroid=Fi49merScaf_29118;seqs=1; > > > CTGACATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCAAATAGACTGTACAGCATTATAGACAGGTACCTCACAGACTTAAAAAGCCCTTAAGACTGTTTTCCTGTAAAAGAATCTCCTTTTTTAACACAGAAATTATCTACAAAATCTAATTCGGAGACCACGGTGTTAACCAAATC… > > > > > > Thanks > > Ed > > > > Dr. Edward K Gilding > > > > The Institute of Molecular Biosciences > > The University of Queensland > > Brisbane, QLD 4072 > > Australia > > > > O: +61 07 3346 2014 > > > > > > ------------------------------------------------------------------------------ > "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE > Instantly run your Selenium tests across 300+ browser/OS combos. > Get unparalleled scalability from the best Selenium testing platform > available > Simple to use. Nothing to install. Get started now for free." > http://p.sf.net/sfu/SauceLabs > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > > > > > > -- > -- > Brian J. Haas > The Broad Institute > http://broad.mit.edu/~bhaas > > > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Edward G. <e.g...@im...> - 2014-05-13 22:54:58
|
Hi Brian Thanks! That did the trick. It works like a charm now. -Ed Dr. Edward K Gilding The Institute of Molecular Biosciences The University of Queensland Brisbane, QLD 4072 Australia O: +61 07 3346 2014 From: Brian Haas [mailto:bh...@br...] Sent: Tuesday, 13 May 2014 1:27 AM To: Edward Gilding Cc: tra...@li... Subject: Re: [Transdecoder-users] Transdecoder help: failure to output final .pep files Hi Ed, It might be that the fasta header format of your transcripts file is incompatible with transdecoder. Perhaps try creating a version of the file that has a simpler header format, such as by: cat input.fasta | perl -lane 's/centroid=//; s/;.*//g; print;' > input.adj.fasta and running the input.adj.fasta through transdecoder. If it still fails, we can look into it further. best, ~brian On Sun, May 11, 2014 at 11:43 PM, Edward Gilding <e.g...@im...<mailto:e.g...@im...>> wrote: Hello I’ve been trying to run Transdecoder with pfam searching on transcriptome assemblies that I made using Soapdenovo-Trans(SdT). With different assemblies and different PBS parameters (like where I place the data on our system’s parallel shared file system etc), Transdecoder creates the temp directory with some of the intermediate files. No finished output files are ever produced. Once I got the .dat file with the pfam hits for my assembly but there were no final .pep .gff3 .cds or .bed files produced and stored anywhere. Am I missing something? Unlike Trinity, SdT plugs in Ns if there is an expected gap between the fragments of a transcript. Could these Ns be tripping up Transdecoder? NOTES: My scripts load the modules our system operators made for Transdecoder and hmmer before sending commands for Transdecoder. These are example entries from my input fasta: >centroid=Fi49merScaf_11503;seqs=3; AACTAAGGGTTTGTTGCTTTTATCAGCGAAATATATTAATGTTTTTAAATTATAGTTGACAACTTTACCGATGAACTATTGAGGTACAGCTTTTTGGGAACATATAGTCTAGTGCCAAGTCCTTCTAGTGCTTTCACACACTCGGCAATACTCTCTTCACTATCAATGTCCATGTTCCAAATTGCCGC… >centroid=Fi49merScaf_29126;seqs=1; TTGGCTGAGAGAACTTACACAAGCCACTTATCGAGCTTCTGCCCCTCCGCCCATCAACATACTTGGAGAACTAAGCAATGATGTAGCGGAAACTGCTGAACCTAGAGCTGTAAATGCTAGGACAGCGGATCTTGTTGTTAATGGAACACTGATTGAGATGAAGTTATCATTATATGTGAAGG… centroid=Fi49merScaf_29118;seqs=1; CTGACATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCAAATAGACTGTACAGCATTATAGACAGGTACCTCACAGACTTAAAAAGCCCTTAAGACTGTTTTCCTGTAAAAGAATCTCCTTTTTTAACACAGAAATTATCTACAAAATCTAATTCGGAGACCACGGTGTTAACCAAATC… Thanks Ed Dr. Edward K Gilding The Institute of Molecular Biosciences The University of Queensland Brisbane, QLD 4072 Australia O: +61 07 3346 2014<tel:%2B61%2007%203346%202014> ------------------------------------------------------------------------------ "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE Instantly run your Selenium tests across 300+ browser/OS combos. Get unparalleled scalability from the best Selenium testing platform available Simple to use. Nothing to install. Get started now for free." http://p.sf.net/sfu/SauceLabs _______________________________________________ Transdecoder-users mailing list Tra...@li...<mailto:Tra...@li...> https://lists.sourceforge.net/lists/listinfo/transdecoder-users -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
|
From: Brian H. <bh...@br...> - 2014-05-12 15:26:55
|
Hi Ed, It might be that the fasta header format of your transcripts file is incompatible with transdecoder. Perhaps try creating a version of the file that has a simpler header format, such as by: cat input.fasta | perl -lane 's/centroid=//; s/;.*//g; print;' > input.adj.fasta and running the input.adj.fasta through transdecoder. If it still fails, we can look into it further. best, ~brian On Sun, May 11, 2014 at 11:43 PM, Edward Gilding <e.g...@im...>wrote: > Hello > > > > I’ve been trying to run Transdecoder with pfam searching on transcriptome > assemblies that I made using Soapdenovo-Trans(SdT). With different > assemblies and different PBS parameters (like where I place the data on our > system’s parallel shared file system etc), Transdecoder creates the temp > directory with some of the intermediate files. No finished output files are > ever produced. Once I got the .dat file with the pfam hits for my assembly > but there were no final .pep .gff3 .cds or .bed files produced and stored > anywhere. Am I missing something? > > > > Unlike Trinity, SdT plugs in Ns if there is an expected gap between the > fragments of a transcript. Could these Ns be tripping up Transdecoder? > > > > NOTES: > > My scripts load the modules our system operators made for Transdecoder and > hmmer before sending commands for Transdecoder. > > > > These are example entries from my input fasta: > > > > >centroid=Fi49merScaf_11503;seqs=3; > > > AACTAAGGGTTTGTTGCTTTTATCAGCGAAATATATTAATGTTTTTAAATTATAGTTGACAACTTTACCGATGAACTATTGAGGTACAGCTTTTTGGGAACATATAGTCTAGTGCCAAGTCCTTCTAGTGCTTTCACACACTCGGCAATACTCTCTTCACTATCAATGTCCATGTTCCAAATTGCCGC… > > >centroid=Fi49merScaf_29126;seqs=1; > > > TTGGCTGAGAGAACTTACACAAGCCACTTATCGAGCTTCTGCCCCTCCGCCCATCAACATACTTGGAGAACTAAGCAATGATGTAGCGGAAACTGCTGAACCTAGAGCTGTAAATGCTAGGACAGCGGATCTTGTTGTTAATGGAACACTGATTGAGATGAAGTTATCATTATATGTGAAGG… > > centroid=Fi49merScaf_29118;seqs=1; > > > CTGACATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCAAATAGACTGTACAGCATTATAGACAGGTACCTCACAGACTTAAAAAGCCCTTAAGACTGTTTTCCTGTAAAAGAATCTCCTTTTTTAACACAGAAATTATCTACAAAATCTAATTCGGAGACCACGGTGTTAACCAAATC… > > > > > > Thanks > > Ed > > > > Dr. Edward K Gilding > > > > The Institute of Molecular Biosciences > > The University of Queensland > > Brisbane, QLD 4072 > > Australia > > > > O: +61 07 3346 2014 > > > > > ------------------------------------------------------------------------------ > "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE > Instantly run your Selenium tests across 300+ browser/OS combos. > Get unparalleled scalability from the best Selenium testing platform > available > Simple to use. Nothing to install. Get started now for free." > http://p.sf.net/sfu/SauceLabs > _______________________________________________ > Transdecoder-users mailing list > Tra...@li... > https://lists.sourceforge.net/lists/listinfo/transdecoder-users > > -- -- Brian J. Haas The Broad Institute http://broad.mit.edu/~bhaas |
1 message has been excluded from this view by a project administrator.
