svtoolkit-help — bug reports and trouble shooting

Re: [svtoolkit-help] SVAltAlign: PicardException

[Bob H. <han...@br...>]

My first suspicion would be that there are variants in the input vcf 
that do not have IDs (i.e. field 3 is ".") - I suspect (unique) IDs are 
required on variants to run through this workflow.

If this isn't it, then I would grep through

/v4scratch/mmc256/ChargeS/GenomeStrip/chr22/record2/altalign/Chr22.pindel024s.x5.50.Strand.NoGenotypes.alt.fasta

to see what the sequence names look like, e.g.

grep '^>' /v4scratch/mmc256/ChargeS/GenomeStrip/chr22/record2/altalign/Chr22.pindel024s.x5.50.Strand.NoGenotypes.alt.fasta

In particular noting whether there are multiple entries of ">._1" and 
trying to determine which input vcf records they correspond to (by 
position in the file and sequence).

-Bob

On 8/21/12 3:06 PM, Margarida Cardoso Moreira wrote:
> Hi,
>
> I am trying to use SVAltAlign to generate alternate allele alignments for a set of deletion calls originally made by Pindel. However, I am getting the following error:
>
> ERROR 14:51:59,841 FunctionEdge - Error: java -Xmx4g -Djava.io.tmpdir=/tmp/1324184.scheduler.v4linux -cp /v4scratch/mmc256/svtoolkit_1.04.939//lib/SVToolkit.jar:/v4scratch/mmc256/svtoolkit_1.04.939//lib/gatk/GenomeAnalysisTK.jar:/v4scratch/mmc256/svtoolkit_1.04.939//lib/gatk/Queue.jar -cp "/v4scratch/mmc256/svtoolkit_1.04.939/lib/SVToolkit.jar:/v4scratch/mmc256/svtoolkit_1.04.939/lib/gatk/GenomeAnalysisTK.jar:/v4scratch/mmc256/svtoolkit_1.04.939/lib/gatk/Queue.jar" net.sf.picard.sam.CreateSequenceDictionary O=/v4scratch/mmc256/ChargeS/GenomeStrip/chr22/record2/altalign/Chr22.pindel024s.x5.50.Strand.NoGenotypes.alt.dict R=/v4scratch/mmc256/ChargeS/GenomeStrip/chr22/record2/altalign/Chr22.pindel024s.x5.50.Strand.NoGenotypes.alt.fasta TRUNCATE_NAMES_AT_WHITESPACE=TRUE
> org.broadinstitute.sting.queue.util.JobExitException: Failed to run job.
> Command line:
> sh /tmp/1324184.scheduler.v4linux/.exec12328
> Exit code: 1
> Standard error contained:
> [Tue Aug 21 14:51:59 EDT 2012] net.sf.picard.sam.CreateSequenceDictionary REFERENCE=/v4scratch/mmc256/ChargeS/GenomeStrip/chr22/record2/altalign/Chr22.pindel024s.x5.50.Strand.NoGenotypes.alt.fasta OUTPUT=/v4scratch/mmc256/ChargeS/GenomeStrip/chr22/record2/altalign/Chr22.pindel024s.x5.50.Strand.NoGenotypes.alt.dict TRUNCATE_NAMES_AT_WHITESPACE=true    NUM_SEQUENCES=2147483647 TMP_DIR=/tmp/1324184.scheduler.v4linux/mmc256 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
> [Tue Aug 21 14:51:59 EDT 2012] net.sf.picard.sam.CreateSequenceDictionary done. Elapsed time: 0.00 minutes.
> Runtime.totalMemory()=9109504
> Exception in thread "main" net.sf.picard.PicardException: Contig '._1' already exists in fasta index.
> 	at net.sf.picard.reference.FastaSequenceIndex.add(FastaSequenceIndex.java:70)
> 	at net.sf.picard.reference.FastaSequenceIndex.parseIndexFile(FastaSequenceIndex.java:142)
> 	at net.sf.picard.reference.FastaSequenceIndex.<init>(FastaSequenceIndex.java:55)
> 	at net.sf.picard.reference.IndexedFastaSequenceFile.<init>(IndexedFastaSequenceFile.java:95)
> 	at net.sf.picard.reference.ReferenceSequenceFileFactory.getReferenceSequenceFile(ReferenceSequenceFileFactory.java:75)
> 	at net.sf.picard.sam.CreateSequenceDictionary.makeSequenceDictionary(CreateSequenceDictionary.java:128)
> 	at net.sf.picard.sam.CreateSequenceDictionary.doWork(CreateSequenceDictionary.java:113)
> 	at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:158)
> 	at net.sf.picard.sam.CreateSequenceDictionary.main(CreateSequenceDictionary.java:93)
>
> 	at org.broadinstitute.sting.queue.util.ShellJob.run(ShellJob.scala:24)
> 	at org.broadinstitute.sting.queue.engine.shell.ShellJobRunner.start(ShellJobRunner.scala:54)
> 	at org.broadinstitute.sting.queue.engine.FunctionEdge.start(FunctionEdge.scala:56)
> 	at org.broadinstitute.sting.queue.engine.QGraph.runJobs(QGraph.scala:383)
> 	at org.broadinstitute.sting.queue.engine.QGraph.run(QGraph.scala:123)
> 	at org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:111)
> 	at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
> 	at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:57)
> 	at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)
>
>
> Here is a bit of the vcf file:
>
> ##fileformat=VCFv4.0
> ##fileDate=Aug251981
> ##source=pindel
> ##reference=HG19
> ##INFO=<ID=END,Number=1,Type=Integer,Description="End position of the variant described in this record">
> ##INFO=<ID=HOMLEN,Number=1,Type=Integer,Description="Length of base pair identical micro-homology at event breakpoints">
> ##INFO=<ID=HOMSEQ,Number=.,Type=String,Description="Sequence of base pair identical micro-homology at event breakpoints">
> ##INFO=<ID=SVLEN,Number=1,Type=Integer,Description="Difference in length between REF and ALT alleles">
> ##INFO=<ID=SVTYPE,Number=1,Type=String,Description="Type of structural variant">
> ##INFO=<ID=NTLEN,Number=.,Type=Integer,Description="Number of bases inserted in place of deleted code">
> ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
> ##FORMAT=<ID=AD,Number=1,Type=Integer,Description="Allele depth, how many reads support this allele">
> #CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
> 22	16849477	DEL_1	AATCGAATGGAATCATCATCGAATGGAATCGAATTGAATCATCGAATGGAATCGAATGCAATCATCTCAAACAGAATCAAATAGAACCATCCAATGAAATCAAATGGAATCATCATCGAATAGAATCAAATGGAACCATAGAATGGT	A	.	PASS	END=16849624;HOMLEN=19;HOMSEQ=ATCGAATGGAATCATCATC;SVLEN=-146;SVTYPE=DEL
> 22	16851058	DEL_2	TAATCATGGAATGGAATCGAAGGTAATCATGGAATGGAATCAAATGGAATTATCATCGAATGGGATGGAATGGAATCATCATCGAAAGGAATCGAAGAG	T	.	PASS	END=16851157;HOMLEN=19;HOMSEQ=AATCATGGAATGGAATCGA;SVLEN=-98;SVTYPE=DEL
>
> Any help would be much appreciated. I really cannot figure this one out.
>
> Thanks!
>
> Margarida
> ------------------------------------------------------------------------------
> Live Security Virtual Conference
> Exclusive live event will cover all the ways today's security and
> threat landscape has changed and how IT managers can respond. Discussions
> will include endpoint security, mobile security and the latest in malware
> threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help

[svtoolkit-help] SVAltAlign: PicardException

[Margarida C. M. <mm...@co...>]

Hi, 

I am trying to use SVAltAlign to generate alternate allele alignments for a set of deletion calls originally made by Pindel. However, I am getting the following error:

ERROR 14:51:59,841 FunctionEdge - Error: java -Xmx4g -Djava.io.tmpdir=/tmp/1324184.scheduler.v4linux -cp /v4scratch/mmc256/svtoolkit_1.04.939//lib/SVToolkit.jar:/v4scratch/mmc256/svtoolkit_1.04.939//lib/gatk/GenomeAnalysisTK.jar:/v4scratch/mmc256/svtoolkit_1.04.939//lib/gatk/Queue.jar -cp "/v4scratch/mmc256/svtoolkit_1.04.939/lib/SVToolkit.jar:/v4scratch/mmc256/svtoolkit_1.04.939/lib/gatk/GenomeAnalysisTK.jar:/v4scratch/mmc256/svtoolkit_1.04.939/lib/gatk/Queue.jar" net.sf.picard.sam.CreateSequenceDictionary O=/v4scratch/mmc256/ChargeS/GenomeStrip/chr22/record2/altalign/Chr22.pindel024s.x5.50.Strand.NoGenotypes.alt.dict R=/v4scratch/mmc256/ChargeS/GenomeStrip/chr22/record2/altalign/Chr22.pindel024s.x5.50.Strand.NoGenotypes.alt.fasta TRUNCATE_NAMES_AT_WHITESPACE=TRUE 
org.broadinstitute.sting.queue.util.JobExitException: Failed to run job.
Command line:
sh /tmp/1324184.scheduler.v4linux/.exec12328
Exit code: 1
Standard error contained: 
[Tue Aug 21 14:51:59 EDT 2012] net.sf.picard.sam.CreateSequenceDictionary REFERENCE=/v4scratch/mmc256/ChargeS/GenomeStrip/chr22/record2/altalign/Chr22.pindel024s.x5.50.Strand.NoGenotypes.alt.fasta OUTPUT=/v4scratch/mmc256/ChargeS/GenomeStrip/chr22/record2/altalign/Chr22.pindel024s.x5.50.Strand.NoGenotypes.alt.dict TRUNCATE_NAMES_AT_WHITESPACE=true    NUM_SEQUENCES=2147483647 TMP_DIR=/tmp/1324184.scheduler.v4linux/mmc256 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
[Tue Aug 21 14:51:59 EDT 2012] net.sf.picard.sam.CreateSequenceDictionary done. Elapsed time: 0.00 minutes.
Runtime.totalMemory()=9109504
Exception in thread "main" net.sf.picard.PicardException: Contig '._1' already exists in fasta index.
	at net.sf.picard.reference.FastaSequenceIndex.add(FastaSequenceIndex.java:70)
	at net.sf.picard.reference.FastaSequenceIndex.parseIndexFile(FastaSequenceIndex.java:142)
	at net.sf.picard.reference.FastaSequenceIndex.<init>(FastaSequenceIndex.java:55)
	at net.sf.picard.reference.IndexedFastaSequenceFile.<init>(IndexedFastaSequenceFile.java:95)
	at net.sf.picard.reference.ReferenceSequenceFileFactory.getReferenceSequenceFile(ReferenceSequenceFileFactory.java:75)
	at net.sf.picard.sam.CreateSequenceDictionary.makeSequenceDictionary(CreateSequenceDictionary.java:128)
	at net.sf.picard.sam.CreateSequenceDictionary.doWork(CreateSequenceDictionary.java:113)
	at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:158)
	at net.sf.picard.sam.CreateSequenceDictionary.main(CreateSequenceDictionary.java:93)

	at org.broadinstitute.sting.queue.util.ShellJob.run(ShellJob.scala:24)
	at org.broadinstitute.sting.queue.engine.shell.ShellJobRunner.start(ShellJobRunner.scala:54)
	at org.broadinstitute.sting.queue.engine.FunctionEdge.start(FunctionEdge.scala:56)
	at org.broadinstitute.sting.queue.engine.QGraph.runJobs(QGraph.scala:383)
	at org.broadinstitute.sting.queue.engine.QGraph.run(QGraph.scala:123)
	at org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:111)
	at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
	at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:57)
	at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)


Here is a bit of the vcf file:

##fileformat=VCFv4.0
##fileDate=Aug251981
##source=pindel
##reference=HG19
##INFO=<ID=END,Number=1,Type=Integer,Description="End position of the variant described in this record">
##INFO=<ID=HOMLEN,Number=1,Type=Integer,Description="Length of base pair identical micro-homology at event breakpoints">
##INFO=<ID=HOMSEQ,Number=.,Type=String,Description="Sequence of base pair identical micro-homology at event breakpoints">
##INFO=<ID=SVLEN,Number=1,Type=Integer,Description="Difference in length between REF and ALT alleles">
##INFO=<ID=SVTYPE,Number=1,Type=String,Description="Type of structural variant">
##INFO=<ID=NTLEN,Number=.,Type=Integer,Description="Number of bases inserted in place of deleted code">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=AD,Number=1,Type=Integer,Description="Allele depth, how many reads support this allele">
#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
22	16849477	DEL_1	AATCGAATGGAATCATCATCGAATGGAATCGAATTGAATCATCGAATGGAATCGAATGCAATCATCTCAAACAGAATCAAATAGAACCATCCAATGAAATCAAATGGAATCATCATCGAATAGAATCAAATGGAACCATAGAATGGT	A	.	PASS	END=16849624;HOMLEN=19;HOMSEQ=ATCGAATGGAATCATCATC;SVLEN=-146;SVTYPE=DEL
22	16851058	DEL_2	TAATCATGGAATGGAATCGAAGGTAATCATGGAATGGAATCAAATGGAATTATCATCGAATGGGATGGAATGGAATCATCATCGAAAGGAATCGAAGAG	T	.	PASS	END=16851157;HOMLEN=19;HOMSEQ=AATCATGGAATGGAATCGA;SVLEN=-98;SVTYPE=DEL

Any help would be much appreciated. I really cannot figure this one out.

Thanks!

Margarida

Re: [svtoolkit-help] Questions regarding the output

[Bob H. <han...@br...>]

On 8/6/12 12:26 AM, Jaemin Kim wrote:
> Hi, I've been asking quite a few questions about GenomeSTRiP and 
> answers have been very helpful.
>
> I have two additional questions:
>
> 1. When you actually count the number of deletion sites in your paper, 
> did you count the ones with "PASS" quality only?
Yes. There are a set of default filters applied if you use the standard 
SVDiscovery Q script.
These may or may not be optimal for different data sets, and I would 
encourage you to look at the distributions of the various metrics.
The default filters weren't too bad when applied out-of-the-box to 1000G 
Phase 1, although that is similar 4x data.
In the larger data set, the default filters had an estimated false 
discovery rate of about 8%.
We used two additional filters for Phase 1 to get the estimated FDR down 
to about 3-4%, most importantly a filter that mostly removed rare events:
GSNPAIRS/GSNSAMPLES > 1.1
For any low-coverage sequencing of several hundred samples or more this 
filter is likely important.
We estimated the FDR of sites where there were two supporting read pairs 
in two different samples at around 25%.
Of lesser importance, but still helpful, we also removed any sites that 
were > 90% alpha satellite repeat (as called by repeatmasker).
> 2. How did you calculate the deletion length? Did you use the GSCOORDS 
> information (and take the subtraction between biggest and smallest 
> coordinates)?
No. I use either INFO:END - POS or INFO:SVLEN.  For Genome STRiP I think 
these are always the same.
These are supposed to be the "most likely" start/end/length of the deletion.
On top of these, you can use INFO:CIPOS and INFO:CIEND which are 
approximately 95% confidence intervals on POS and END respectively.
GSCOORDS is somewhat different - it is the inner/outer extent of the 
aberrantly spaced read pairs and is mostly used for internal bookkeeping.
The outer coordinates will likely over-estimate the true position and 
the inner coordinates will similarly under-estimate.

-Bob
>
>
> Thanks for your kindness.
>
>
> Regards,
>
> Jaemin Kim
>
>
> ------------------------------------------------------------------------------
> Live Security Virtual Conference
> Exclusive live event will cover all the ways today's security and
> threat landscape has changed and how IT managers can respond. Discussions
> will include endpoint security, mobile security and the latest in malware
> threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
>
>
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help

[svtoolkit-help] Questions regarding the output

[Jaemin K. <jm...@sn...>]

Hi, I've been asking quite a few questions about GenomeSTRiP and answers have been very helpful. 

I have two additional questions:

1. When you actually count the number of deletion sites in your paper, did you count the ones with "PASS" quality only? 
2. How did you calculate the deletion length? Did you use the GSCOORDS information (and take the subtraction between biggest and smallest coordinates)? 


Thanks for your kindness. 


Regards, 

Jaemin Kim

Re: [svtoolkit-help] SVDiscovery: No gender data

[Margarida C. M. <mm...@co...>]

Thank you Rob and Ashish for the advice. 
I will run SVDiscovery without the gender file for the autosomes and then check the sample ids for the X chromosome.

Margarida

On Jul 31, 2012, at 12:32 PM, Ashish Kumar wrote:

> I guess I have seen this before.
> Quick and easy solution, if you are doing this only for autosomes, then remove the option "-genderMapFile" and you get rid of the problem for now.
> 
> For resolving this, please make sure your gender mapfile has same sample ids as reflected in the BAM headers of each BAM.
> 
> Best,
> Ashish
> 
> ________________________________________
> From: Bob Handsaker [han...@br...]
> Sent: 31 July 2012 17:25
> To: svt...@li...
> Subject: Re: [svtoolkit-help] SVDiscovery: No gender data
> 
> I'd check the basics:
> - make sure the gender file is tab-delimited
> - make sure the gender file is specified on the command line
> - make sure there's nothing funny about the line endings (e.g. use "file
> your-gender-file" on unix)
> You don't need to re-preprocess to run a subset of samples, you can just
> drop the relevant bam files.
> If after checking this you can't find it, you can try sending me the
> complete log file for the failing run and the gender file you are using.
> -Bob
> 
> On 7/31/12 12:15 PM, Margarida Cardoso Moreira wrote:
>> Dear Bob Handsaker,
>> 
>> I am getting an error that I cannot completely understand while running SVDiscover: "No gender data for sample: A11111".
>> 
>> I checked the gender file and the line of text referring to that genome is equal to the other lines. Genome's Strip metadata doesn't show any abnormality with that sample. I ran SVDiscovery again after removing that sample (having ran first SVPreprocess without that sample) and I got the same error but now for a different sample. I am working with ~900 bam files and these 2 are in the middle of the bam list file.
>> 
>> I don't understand what could be wrong with the gender file to produce such an error.
>> 
>> Thank you for your help,
>> 
>> Margarida
>> 
>> ##### ERROR ------------------------------------------------------------------------------------------
>> ##### ERROR stack trace
>> java.lang.RuntimeException: No gender data for sample: A11111
>>      at org.broadinstitute.sv.discovery.ClusterMembershipModule.init(ClusterMembershipModule.java:182)
>>      at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.createMembershipModule(DeletionDiscoveryAlgorithm.java:1062)
>>      at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.initClusterModules(DeletionDiscoveryAlgorithm.java:1007)
>>      at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.processClusters(DeletionDiscoveryAlgorithm.java:317)
>>      at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:191)
>>      at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:168)
>>      at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:45)
>>      at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
>>      at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:76)
>>      at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:234)
>>      at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
>>      at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:105)
>>      at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
>>      at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:67)
>>      at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
>> ##### ERROR ------------------------------------------------------------------------------------------
>> ##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0-6121-g40e3165):
>> ##### ERROR
>> ##### ERROR Please visit the wiki to see if this is a known problem
>> ##### ERROR If not, please post the error, with stack trace, to the GATK forum
>> ##### ERROR Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki
>> ##### ERROR Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa
>> ##### ERROR
>> ##### ERROR MESSAGE: No gender data for sample: A11111
>> ##### ERROR ------------------------------------------------------------------------------------------
>> 
>>      at org.broadinstitute.sting.queue.util.ShellJob.run(ShellJob.scala:24)
>>      at org.broadinstitute.sting.queue.engine.shell.ShellJobRunner.start(ShellJobRunner.scala:54)
>>      at org.broadinstitute.sting.queue.engine.FunctionEdge.start(FunctionEdge.scala:56)
>>      at org.broadinstitute.sting.queue.engine.QGraph.runJobs(QGraph.scala:383)
>>      at org.broadinstitute.sting.queue.engine.QGraph.run(QGraph.scala:123)
>>      at org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:111)
>>      at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
>>      at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:57)
>>      at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)
>> 
>> 
>> ------------------------------------------------------------------------------
>> Live Security Virtual Conference
>> Exclusive live event will cover all the ways today's security and
>> threat landscape has changed and how IT managers can respond. Discussions
>> will include endpoint security, mobile security and the latest in malware
>> threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
>> _______________________________________________
>> svtoolkit-help mailing list
>> svt...@li...
>> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help
> 
> 
> ------------------------------------------------------------------------------
> Live Security Virtual Conference
> Exclusive live event will cover all the ways today's security and
> threat landscape has changed and how IT managers can respond. Discussions
> will include endpoint security, mobile security and the latest in malware
> threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help
> 
> ------------------------------------------------------------------------------
> Live Security Virtual Conference
> Exclusive live event will cover all the ways today's security and 
> threat landscape has changed and how IT managers can respond. Discussions 
> will include endpoint security, mobile security and the latest in malware 
> threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help

Re: [svtoolkit-help] SVDiscovery: No gender data

[Ashish K. <as...@we...>]

I guess I have seen this before.
Quick and easy solution, if you are doing this only for autosomes, then remove the option "-genderMapFile" and you get rid of the problem for now.

For resolving this, please make sure your gender mapfile has same sample ids as reflected in the BAM headers of each BAM.

Best,
Ashish

________________________________________
From: Bob Handsaker [han...@br...]
Sent: 31 July 2012 17:25
To: svt...@li...
Subject: Re: [svtoolkit-help] SVDiscovery: No gender data

I'd check the basics:
- make sure the gender file is tab-delimited
- make sure the gender file is specified on the command line
- make sure there's nothing funny about the line endings (e.g. use "file
your-gender-file" on unix)
You don't need to re-preprocess to run a subset of samples, you can just
drop the relevant bam files.
If after checking this you can't find it, you can try sending me the
complete log file for the failing run and the gender file you are using.
-Bob

On 7/31/12 12:15 PM, Margarida Cardoso Moreira wrote:
> Dear Bob Handsaker,
>
> I am getting an error that I cannot completely understand while running SVDiscover: "No gender data for sample: A11111".
>
> I checked the gender file and the line of text referring to that genome is equal to the other lines. Genome's Strip metadata doesn't show any abnormality with that sample. I ran SVDiscovery again after removing that sample (having ran first SVPreprocess without that sample) and I got the same error but now for a different sample. I am working with ~900 bam files and these 2 are in the middle of the bam list file.
>
> I don't understand what could be wrong with the gender file to produce such an error.
>
> Thank you for your help,
>
> Margarida
>
> ##### ERROR ------------------------------------------------------------------------------------------
> ##### ERROR stack trace
> java.lang.RuntimeException: No gender data for sample: A11111
>       at org.broadinstitute.sv.discovery.ClusterMembershipModule.init(ClusterMembershipModule.java:182)
>       at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.createMembershipModule(DeletionDiscoveryAlgorithm.java:1062)
>       at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.initClusterModules(DeletionDiscoveryAlgorithm.java:1007)
>       at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.processClusters(DeletionDiscoveryAlgorithm.java:317)
>       at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:191)
>       at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:168)
>       at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:45)
>       at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
>       at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:76)
>       at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:234)
>       at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
>       at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:105)
>       at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
>       at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:67)
>       at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
> ##### ERROR ------------------------------------------------------------------------------------------
> ##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0-6121-g40e3165):
> ##### ERROR
> ##### ERROR Please visit the wiki to see if this is a known problem
> ##### ERROR If not, please post the error, with stack trace, to the GATK forum
> ##### ERROR Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki
> ##### ERROR Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa
> ##### ERROR
> ##### ERROR MESSAGE: No gender data for sample: A11111
> ##### ERROR ------------------------------------------------------------------------------------------
>
>       at org.broadinstitute.sting.queue.util.ShellJob.run(ShellJob.scala:24)
>       at org.broadinstitute.sting.queue.engine.shell.ShellJobRunner.start(ShellJobRunner.scala:54)
>       at org.broadinstitute.sting.queue.engine.FunctionEdge.start(FunctionEdge.scala:56)
>       at org.broadinstitute.sting.queue.engine.QGraph.runJobs(QGraph.scala:383)
>       at org.broadinstitute.sting.queue.engine.QGraph.run(QGraph.scala:123)
>       at org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:111)
>       at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
>       at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:57)
>       at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)
>
>
> ------------------------------------------------------------------------------
> Live Security Virtual Conference
> Exclusive live event will cover all the ways today's security and
> threat landscape has changed and how IT managers can respond. Discussions
> will include endpoint security, mobile security and the latest in malware
> threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help


------------------------------------------------------------------------------
Live Security Virtual Conference
Exclusive live event will cover all the ways today's security and
threat landscape has changed and how IT managers can respond. Discussions
will include endpoint security, mobile security and the latest in malware
threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
_______________________________________________
svtoolkit-help mailing list
svt...@li...
https://lists.sourceforge.net/lists/listinfo/svtoolkit-help

Re: [svtoolkit-help] SVDiscovery: No gender data

[Bob H. <han...@br...>]

I'd check the basics:
- make sure the gender file is tab-delimited
- make sure the gender file is specified on the command line
- make sure there's nothing funny about the line endings (e.g. use "file 
your-gender-file" on unix)
You don't need to re-preprocess to run a subset of samples, you can just 
drop the relevant bam files.
If after checking this you can't find it, you can try sending me the 
complete log file for the failing run and the gender file you are using.
-Bob

On 7/31/12 12:15 PM, Margarida Cardoso Moreira wrote:
> Dear Bob Handsaker,
>
> I am getting an error that I cannot completely understand while running SVDiscover: "No gender data for sample: A11111".
>
> I checked the gender file and the line of text referring to that genome is equal to the other lines. Genome's Strip metadata doesn't show any abnormality with that sample. I ran SVDiscovery again after removing that sample (having ran first SVPreprocess without that sample) and I got the same error but now for a different sample. I am working with ~900 bam files and these 2 are in the middle of the bam list file.
>
> I don't understand what could be wrong with the gender file to produce such an error.
>
> Thank you for your help,
>
> Margarida
>
> ##### ERROR ------------------------------------------------------------------------------------------
> ##### ERROR stack trace
> java.lang.RuntimeException: No gender data for sample: A11111
> 	at org.broadinstitute.sv.discovery.ClusterMembershipModule.init(ClusterMembershipModule.java:182)
> 	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.createMembershipModule(DeletionDiscoveryAlgorithm.java:1062)
> 	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.initClusterModules(DeletionDiscoveryAlgorithm.java:1007)
> 	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.processClusters(DeletionDiscoveryAlgorithm.java:317)
> 	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:191)
> 	at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:168)
> 	at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:45)
> 	at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
> 	at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:76)
> 	at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:234)
> 	at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
> 	at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:105)
> 	at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
> 	at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:67)
> 	at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
> ##### ERROR ------------------------------------------------------------------------------------------
> ##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0-6121-g40e3165):
> ##### ERROR
> ##### ERROR Please visit the wiki to see if this is a known problem
> ##### ERROR If not, please post the error, with stack trace, to the GATK forum
> ##### ERROR Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki
> ##### ERROR Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa
> ##### ERROR
> ##### ERROR MESSAGE: No gender data for sample: A11111
> ##### ERROR ------------------------------------------------------------------------------------------
>
> 	at org.broadinstitute.sting.queue.util.ShellJob.run(ShellJob.scala:24)
> 	at org.broadinstitute.sting.queue.engine.shell.ShellJobRunner.start(ShellJobRunner.scala:54)
> 	at org.broadinstitute.sting.queue.engine.FunctionEdge.start(FunctionEdge.scala:56)
> 	at org.broadinstitute.sting.queue.engine.QGraph.runJobs(QGraph.scala:383)
> 	at org.broadinstitute.sting.queue.engine.QGraph.run(QGraph.scala:123)
> 	at org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:111)
> 	at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
> 	at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:57)
> 	at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)
>
>
> ------------------------------------------------------------------------------
> Live Security Virtual Conference
> Exclusive live event will cover all the ways today's security and
> threat landscape has changed and how IT managers can respond. Discussions
> will include endpoint security, mobile security and the latest in malware
> threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help

[svtoolkit-help] SVDiscovery: No gender data

[Margarida C. M. <mm...@co...>]

Dear Bob Handsaker,

I am getting an error that I cannot completely understand while running SVDiscover: "No gender data for sample: A11111". 

I checked the gender file and the line of text referring to that genome is equal to the other lines. Genome's Strip metadata doesn't show any abnormality with that sample. I ran SVDiscovery again after removing that sample (having ran first SVPreprocess without that sample) and I got the same error but now for a different sample. I am working with ~900 bam files and these 2 are in the middle of the bam list file. 

I don't understand what could be wrong with the gender file to produce such an error.

Thank you for your help,

Margarida

##### ERROR ------------------------------------------------------------------------------------------
##### ERROR stack trace 
java.lang.RuntimeException: No gender data for sample: A11111
	at org.broadinstitute.sv.discovery.ClusterMembershipModule.init(ClusterMembershipModule.java:182)
	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.createMembershipModule(DeletionDiscoveryAlgorithm.java:1062)
	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.initClusterModules(DeletionDiscoveryAlgorithm.java:1007)
	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.processClusters(DeletionDiscoveryAlgorithm.java:317)
	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:191)
	at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:168)
	at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:45)
	at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
	at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:76)
	at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:234)
	at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
	at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:105)
	at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
	at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:67)
	at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0-6121-g40e3165):
##### ERROR
##### ERROR Please visit the wiki to see if this is a known problem
##### ERROR If not, please post the error, with stack trace, to the GATK forum
##### ERROR Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki
##### ERROR Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa
##### ERROR
##### ERROR MESSAGE: No gender data for sample: A11111
##### ERROR ------------------------------------------------------------------------------------------

	at org.broadinstitute.sting.queue.util.ShellJob.run(ShellJob.scala:24)
	at org.broadinstitute.sting.queue.engine.shell.ShellJobRunner.start(ShellJobRunner.scala:54)
	at org.broadinstitute.sting.queue.engine.FunctionEdge.start(FunctionEdge.scala:56)
	at org.broadinstitute.sting.queue.engine.QGraph.runJobs(QGraph.scala:383)
	at org.broadinstitute.sting.queue.engine.QGraph.run(QGraph.scala:123)
	at org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:111)
	at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
	at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:57)
	at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)

Re: [svtoolkit-help] SVDiscovery: Code exception error

[Bob H. <han...@br...>]

I will try to make the error message clearer, but the underlying problem 
looks like there is no data on fragment size distributions in
your metadata directory

/v4scratch/mmc256/ChargeS/GenomeStrip/chr1/record/metadata

I.e. no isd.hist.bin or isd.dist.bin file.
Did preprocessing complete successfully?  Or did you use a different 
metadata directory during preprocessing?

-Bob

On 7/26/12 4:59 PM, Margarida Cardoso Moreira wrote:
> Dear Bob Handsaker,
>
> First of all, I would like to thank you and your colleagues for making Genome Strip available to everyone and for helping the community using your program.
>
> I hope you can help me understand the following error that I am getting while running SVDiscovery (I am using version 1.04.939):
>
> ERROR 15:53:47,940 FunctionEdge - Error: java -Xmx4g -Djava.io.tmpdir=/tmp/1308242.scheduler.v4linux -cp /v4scratch/mmc256/svtoolkit_1.04.939//lib/SVToolkit.jar:/v4scratch/mmc256/svtoolkit_1.04.939//lib/gatk/GenomeAnalysisTK.jar:/v4scratch/mmc256/svtoolkit_1.04.939//lib/gatk/Queue.jar -verbose:gc org.broadinstitute.sv.main.SVDiscovery -T SVDiscovery -R /v4scratch/mmc256/human_g1k_v37.fasta -I /v4scratch/mmc256/ChargeS/GenomeStrip/chr22/ListBams.list -O /v4scratch/mmc256/ChargeS/GenomeStrip/chr1/record/P0001.discovery.vcf -md /v4scratch/mmc256/ChargeS/GenomeStrip/chr1/record/metadata -disableGATKTraversal -configFile /v4scratch/mmc256/ChargeS/GenomeStrip/chr22/genstrip_parameters_Chr22.txt -runDirectory /v4scratch/mmc256/ChargeS/GenomeStrip/chr1/record -genderMapFile /v4scratch/mmc256/ChargeS/GenomeStrip/chr22/gender_file_Chr22.txt -genomeMaskFile /v4scratch/mmc256/human_g1k_v37.mask.100.fasta -partitionName P0001 -filePrefix P0001 -L 22:1-11010000 -searchLocus 22:1-9999999 -s
>   earchWindow 22:1-11010000 -searchMinimumSize 50 -searchMaximumSize 1000000
> org.broadinstitute.sting.queue.util.JobExitException: Failed to run job.
>
> ##### ERROR ------------------------------------------------------------------------------------------
> ##### ERROR stack trace
> java.lang.NullPointerException
> 	at org.broadinstitute.sv.metadata.isize.InsertRadiusMap.init(InsertRadiusMap.java:59)
> 	at org.broadinstitute.sv.metadata.isize.InsertRadiusMap.<init>(InsertRadiusMap.java:42)
> 	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.createClusteringRadiusMap(DeletionDiscoveryAlgorithm.java:1037)
> 	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.initClusterModules(DeletionDiscoveryAlgorithm.java:1005)
> 	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.processClusters(DeletionDiscoveryAlgorithm.java:317)
> 	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:191)
> 	at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:168)
> 	at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:45)
> 	at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
> 	at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:76)
> 	at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:234)
> 	at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
> 	at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:105)
> 	at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
> 	at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:67)
> 	at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
> ##### ERROR ------------------------------------------------------------------------------------------
> ##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0-6121-g40e3165):
> ##### ERROR
> ##### ERROR Please visit the wiki to see if this is a known problem
> ##### ERROR If not, please post the error, with stack trace, to the GATK forum
> ##### ERROR Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki
> ##### ERROR Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa
> ##### ERROR
> ##### ERROR MESSAGE: Code exception (see stack trace for error itself)
> ##### ERROR ------------------------------------------------------------------------------------------
>
> 	at org.broadinstitute.sting.queue.util.ShellJob.run(ShellJob.scala:24)
> 	at org.broadinstitute.sting.queue.engine.shell.ShellJobRunner.start(ShellJobRunner.scala:54)
> 	at org.broadinstitute.sting.queue.engine.FunctionEdge.start(FunctionEdge.scala:56)
> 	at org.broadinstitute.sting.queue.engine.QGraph.runJobs(QGraph.scala:383)
> 	at org.broadinstitute.sting.queue.engine.QGraph.run(QGraph.scala:123)
> 	at org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:111)
> 	at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
> 	at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:57)
> 	at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)
>
> Let me know if you need more of the output to understand the error.
>
> Thank you for your help!
>
> Margarida Cardoso Moreira
>
>
> ------------------------------------------------------------------------------
> Live Security Virtual Conference
> Exclusive live event will cover all the ways today's security and
> threat landscape has changed and how IT managers can respond. Discussions
> will include endpoint security, mobile security and the latest in malware
> threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help

[svtoolkit-help] SVDiscovery: Code exception error

[Margarida C. M. <mm...@co...>]

Dear Bob Handsaker,

First of all, I would like to thank you and your colleagues for making Genome Strip available to everyone and for helping the community using your program.

I hope you can help me understand the following error that I am getting while running SVDiscovery (I am using version 1.04.939):

ERROR 15:53:47,940 FunctionEdge - Error: java -Xmx4g -Djava.io.tmpdir=/tmp/1308242.scheduler.v4linux -cp /v4scratch/mmc256/svtoolkit_1.04.939//lib/SVToolkit.jar:/v4scratch/mmc256/svtoolkit_1.04.939//lib/gatk/GenomeAnalysisTK.jar:/v4scratch/mmc256/svtoolkit_1.04.939//lib/gatk/Queue.jar -verbose:gc org.broadinstitute.sv.main.SVDiscovery -T SVDiscovery -R /v4scratch/mmc256/human_g1k_v37.fasta -I /v4scratch/mmc256/ChargeS/GenomeStrip/chr22/ListBams.list -O /v4scratch/mmc256/ChargeS/GenomeStrip/chr1/record/P0001.discovery.vcf -md /v4scratch/mmc256/ChargeS/GenomeStrip/chr1/record/metadata -disableGATKTraversal -configFile /v4scratch/mmc256/ChargeS/GenomeStrip/chr22/genstrip_parameters_Chr22.txt -runDirectory /v4scratch/mmc256/ChargeS/GenomeStrip/chr1/record -genderMapFile /v4scratch/mmc256/ChargeS/GenomeStrip/chr22/gender_file_Chr22.txt -genomeMaskFile /v4scratch/mmc256/human_g1k_v37.mask.100.fasta -partitionName P0001 -filePrefix P0001 -L 22:1-11010000 -searchLocus 22:1-9999999 -searchWindow 22:1-11010000 -searchMinimumSize 50 -searchMaximumSize 1000000 
org.broadinstitute.sting.queue.util.JobExitException: Failed to run job.

##### ERROR ------------------------------------------------------------------------------------------
##### ERROR stack trace 
java.lang.NullPointerException
	at org.broadinstitute.sv.metadata.isize.InsertRadiusMap.init(InsertRadiusMap.java:59)
	at org.broadinstitute.sv.metadata.isize.InsertRadiusMap.<init>(InsertRadiusMap.java:42)
	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.createClusteringRadiusMap(DeletionDiscoveryAlgorithm.java:1037)
	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.initClusterModules(DeletionDiscoveryAlgorithm.java:1005)
	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.processClusters(DeletionDiscoveryAlgorithm.java:317)
	at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:191)
	at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:168)
	at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:45)
	at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
	at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:76)
	at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:234)
	at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
	at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:105)
	at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
	at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:67)
	at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0-6121-g40e3165):
##### ERROR
##### ERROR Please visit the wiki to see if this is a known problem
##### ERROR If not, please post the error, with stack trace, to the GATK forum
##### ERROR Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki
##### ERROR Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa
##### ERROR
##### ERROR MESSAGE: Code exception (see stack trace for error itself)
##### ERROR ------------------------------------------------------------------------------------------

	at org.broadinstitute.sting.queue.util.ShellJob.run(ShellJob.scala:24)
	at org.broadinstitute.sting.queue.engine.shell.ShellJobRunner.start(ShellJobRunner.scala:54)
	at org.broadinstitute.sting.queue.engine.FunctionEdge.start(FunctionEdge.scala:56)
	at org.broadinstitute.sting.queue.engine.QGraph.runJobs(QGraph.scala:383)
	at org.broadinstitute.sting.queue.engine.QGraph.run(QGraph.scala:123)
	at org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:111)
	at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
	at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:57)
	at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)

Let me know if you need more of the output to understand the error.

Thank you for your help!

Margarida Cardoso Moreira

Re: [svtoolkit-help] installing svtoolkit on mac lion - installtest fails

[Bob H. <han...@br...>]

Hi, Adalgeir,

Genome STRiP is pretty computationally intensive, so depending on what 
analysis you are trying to do, you may not get very far without a 
compute cluster.
Partly for this reason, we don't have the resources allocated to support 
non-Linux platforms.

However, if you need to run on mac, bwa is not required for all analyses 
you might want to do with Genome STRiP.
Bwa is used to build the genome masks, but if you are using one of the 
pre-built masks, then this is not an issue (or perhaps you can build the 
mask on a linux box).
Secondly, bwa is used for bulk realignment of unmapped reads to 
breakpoint junctions.
If you are not genotyping known variants (e.g. from 1000 Genomes) with 
assembled breakpoints, then you don't need to use bwa.
Even if you are using breakpoints in genotyping, if you have longer 
reads (e.g. 100bp) and these were aligned to the reference with any 
recent version of bwa,
the contribution from SVAltAlign is usually not very important. It is 
more important with older short reads (< 75bp).

If you do not run the parts of the installtest that include SVAltAlign.q 
and remove -altAlignments from the genotyping, then the installtest 
should run,
although it may produce different results.

Hope this helps,
-Bob

On 6/21/12 11:51 AM, Aðalgeir Arason wrote:
> Hi,
>
> First thanks for making svtoolkit available. I wonder if I can ask 
> your help / advice with installing svtoolkit 1.03.619 on Unix in Mac 
> OS X Lion (10.7.4). Just in brief (details below):
>
> When running the installtests, both fail. The major error seems to be 
> an UnsatisfiedLinkError (no bwa in java.library.path). I tried a 
> solution which in a gsa discussion thread 7 months ago 
> (_https://getsatisfaction.com/gsa/topics/no_bwa_in_java_library_path_) 
> was said to work but didn't explain in enough details for me. It was 
> based on building some mac library, with the aid of a build_mac.sh in 
> GATK/Sting, but I got stuck with finding a location for -lsupc++. I 
> added a comment to the thread and was adviced to contact the svtoolkit 
> authors.
>
> In more detail:
>
> 1) discovery.sh almost worked: I ran the installtest/discovery.sh, 
> resulting in test reasults not matching benchmark data. The 
> discrepancy seemed minimal: A GSDEPTHRANKSUMPVALUE in the bottom 
> paragraph (under DEL_5) was 0.0089357_81_ in my test.1.discovery.vcf 
> whereas it was 0.0089357_8_ in the original vcf in the benchmark 
> folder. Everything else was identical (except the ##fileDate and 
> ##source).
>
> 2) genotyping.sh delivered 'Done with errors' and 'Exception in thread 
> "main" java.lang.UnsatisfiedLinkError: no bwa in java.library.path".
>
> 3) Following the clue in the above mentioned discussion thread, I 
> found build_mac.sh in my GATK/Sting/public/c/bwa folder. I modified an 
> export BWA_HOME command in accordance with the bwa location on my 
> computer, so the bash file contained:
>
>
> #!/bin/sh
> export BWA_HOME=*"/usr/local/bin"*
> export JAVA_INCLUDE="/System/Library/Frameworks/JavaVM.framework/Headers"
> export TARGET_LIB="libbwa.dylib"
> export EXTRA_LIBS="-lc -lz -lsupc++"
> export LIBTOOL_COMMAND="libtool -dynamic"
> make
>
> I have no clue how I should modify other lines (target / extra libs 
> etc), if they are to be adjusted. My JAVA_INCLUDE Headers folder 
> exists in the above location.
>
> The content of the Makefile was:
>
>
> CXX=g++
> CXXFLAGS=-g -Wall -O2 -m64 -fPIC
>
> .cpp.o:
> $(CXX) -c $(CXXFLAGS) -I$(BWA_HOME) -I$(JAVA_INCLUDE) $< -o $@
>
> all: init lib
>
> init:
> @echo Please make sure the following platforms are set correctly on 
> your machine.
> @echo BWA_HOME=$(BWA_HOME)
> @echo JAVA_INCLUDE=$(JAVA_INCLUDE)
> @echo TARGET_LIB=$(TARGET_LIB)
> @echo EXTRA_LIBS=$(EXTRA_LIBS)
> @echo LIBTOOL_COMMAND=$(LIBTOOL_COMMAND)
>
> lib: org_broadinstitute_sting_alignment_bwa_c_BWACAligner.o bwa_gateway.o
> $(LIBTOOL_COMMAND) $? -o $(TARGET_LIB) -L$(BWA_HOME) -lbwacore 
> $(EXTRA_LIBS)
>
> clean:
> rm *.o libbwa.*
>
> I ran the build_mac.sh in the above mentioned Sting directory and it 
> delivered:
>
> Please make sure the following platforms are set correctly on your 
> machine.
> BWA_HOME=/usr/local/bin/bwa
> JAVA_INCLUDE=/System/Library/Frameworks/JavaVM.framework/Headers
> TARGET_LIB=libbwa.dylib
> EXTRA_LIBS=-lc -lz -lsupc++
> LIBTOOL_COMMAND=libtool -dynamic
> libtool -dynamic 
> org_broadinstitute_sting_alignment_bwa_c_BWACAligner.o bwa_gateway.o 
> -o libbwa.dylib -L/usr/local/bin/bwa -lbwacore -lc -lz -lsupc++
> libtool: can't locate file for: -lbwacore
> libtool: file: -lbwacore is not an object file (not allowed in a library)
> libtool: can't locate file for: -lsupc++
> libtool: file: -lsupc++ is not an object file (not allowed in a library)
> make: *** [lib] Error 1
>
> Running the command locate *supc++* results with 
>  /Applications/Xcode.app/Contents/Developer/Platforms/MacOSX.platform/Developer/SDKs/MacOSX10.6.sdk/usr/lib/libsupc++.a 
> and nothing else. I'm not clear if it means that supc++ is installed. 
> My Xcode is a recent update to 4.3.2. The command locate *lbwa* 
> doesn't find anything.
>
> This is where I'm stuck. I would be most grateful if you could take a 
> look at this and tell if you see what's wrong. Maybe I'm heading the 
> opposite direction trying, the above bash file? I'm relatively new to 
> Unix/Linux and Java.
>
> Thanks again,
>
> Adalgeir
>
>
>
> ---
> Adalgeir Arason
> Landspitali University Hospital
> Reykjavik
> Iceland
>
>
>
> Fyrirvari / Disclaimer
> http://www.landspitali.is/disclaimer/
>
>
> ------------------------------------------------------------------------------
> Live Security Virtual Conference
> Exclusive live event will cover all the ways today's security and
> threat landscape has changed and how IT managers can respond. Discussions
> will include endpoint security, mobile security and the latest in malware
> threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
>
>
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help

[svtoolkit-help] installing svtoolkit on mac lion - installtest fails

[Aðalgeir A. <ada...@la...>]

Hi,

First thanks for making svtoolkit available. I wonder if I can ask your 
help / advice with installing svtoolkit 1.03.619 on Unix in Mac OS X Lion 
(10.7.4). Just in brief (details below):

When running the installtests, both fail. The major error seems to be an 
UnsatisfiedLinkError (no bwa in java.library.path). I tried a solution 
which in a gsa discussion thread 7 months ago (
https://getsatisfaction.com/gsa/topics/no_bwa_in_java_library_path) was 
said to work but didn't explain in enough details for me. It was based on 
building some mac library, with the aid of a build_mac.sh in GATK/Sting, 
but I got stuck with finding a location for -lsupc++. I added a comment to 
the thread and was adviced to contact the svtoolkit authors.

In more detail:

1) discovery.sh almost worked: I ran the installtest/discovery.sh, 
resulting in test reasults not matching benchmark data. The discrepancy 
seemed minimal: A GSDEPTHRANKSUMPVALUE in the bottom paragraph (under 
DEL_5) was 0.008935781 in my test.1.discovery.vcf whereas it was 0.0089357
8 in the original vcf in the benchmark folder. Everything else was 
identical (except the ##fileDate and ##source).

2) genotyping.sh delivered 'Done with errors' and 'Exception in thread 
"main" java.lang.UnsatisfiedLinkError: no bwa in java.library.path".

3) Following the clue in the above mentioned discussion thread, I found 
build_mac.sh in my GATK/Sting/public/c/bwa folder. I modified an export 
BWA_HOME command in accordance with the bwa location on my computer, so 
the bash file contained:


#!/bin/sh
export BWA_HOME="/usr/local/bin"
export JAVA_INCLUDE="/System/Library/Frameworks/JavaVM.framework/Headers"
export TARGET_LIB="libbwa.dylib"
export EXTRA_LIBS="-lc -lz -lsupc++"
export LIBTOOL_COMMAND="libtool -dynamic"
make

I have no clue how I should modify other lines (target / extra libs etc), 
if they are to be adjusted. My JAVA_INCLUDE Headers folder exists in the 
above location.

The content of the Makefile was:


CXX=g++
CXXFLAGS=-g -Wall -O2 -m64 -fPIC

.cpp.o:
$(CXX) -c $(CXXFLAGS) -I$(BWA_HOME) -I$(JAVA_INCLUDE) $< -o $@

all: init lib

init:
@echo Please make sure the following platforms are set correctly on your 
machine.
@echo BWA_HOME=$(BWA_HOME)
@echo JAVA_INCLUDE=$(JAVA_INCLUDE)
@echo TARGET_LIB=$(TARGET_LIB)
@echo EXTRA_LIBS=$(EXTRA_LIBS)
@echo LIBTOOL_COMMAND=$(LIBTOOL_COMMAND)

lib: org_broadinstitute_sting_alignment_bwa_c_BWACAligner.o bwa_gateway.o 
$(LIBTOOL_COMMAND) $? -o $(TARGET_LIB) -L$(BWA_HOME) -lbwacore 
$(EXTRA_LIBS)

clean:
rm *.o libbwa.*

I ran the build_mac.sh in the above mentioned Sting directory and it 
delivered:

Please make sure the following platforms are set correctly on your 
machine.
BWA_HOME=/usr/local/bin/bwa
JAVA_INCLUDE=/System/Library/Frameworks/JavaVM.framework/Headers
TARGET_LIB=libbwa.dylib
EXTRA_LIBS=-lc -lz -lsupc++
LIBTOOL_COMMAND=libtool -dynamic
libtool -dynamic org_broadinstitute_sting_alignment_bwa_c_BWACAligner.o 
bwa_gateway.o -o libbwa.dylib -L/usr/local/bin/bwa -lbwacore -lc -lz 
-lsupc++
libtool: can't locate file for: -lbwacore
libtool: file: -lbwacore is not an object file (not allowed in a library)
libtool: can't locate file for: -lsupc++
libtool: file: -lsupc++ is not an object file (not allowed in a library)
make: *** [lib] Error 1

Running the command locate *supc++* results with 
/Applications/Xcode.app/Contents/Developer/Platforms/MacOSX.platform/Developer/SDKs/MacOSX10.6.sdk/usr/lib/libsupc++.a 
and nothing else. I'm not clear if it means that supc++ is installed. My 
Xcode is a recent update to 4.3.2. The command locate *lbwa* doesn't find 
anything.

This is where I'm stuck. I would be most grateful if you could take a look 
at this and tell if you see what's wrong. Maybe I'm heading the opposite 
direction trying, the above bash file? I'm relatively new to Unix/Linux 
and Java.

Thanks again,

Adalgeir



---
Adalgeir Arason
Landspitali University Hospital
Reykjavik
Iceland



Fyrirvari / Disclaimer
http://www.landspitali.is/disclaimer/ 

Re: [svtoolkit-help] Problem running Genome Strip: Error message : "Unrecognized sequence: 1:0-0

[Bob H. <han...@br...>]

The -L argument restricts the regions of the genome you want to cover - 
the chromosome name "1" isn't found in your reference sequence.
-Bob

On 6/13/12 9:26 AM, Per Axel Ericsson wrote:
> Hi
> Any ideas?
>
> On Thu, Jun 7, 2012 at 10:10 PM, Per Axel Ericsson
> <eri...@br...>  wrote:
>> Hi
>> I've been trying to run Genome Strip on a ~4Mb region, I've run the
>> installation test and I have all the dependencies wokring, my target
>> is the dog genome a co-worker have created a genome mask file which
>> have been previously been validated.
>> Can you point me in a direction what this error message mean?
>> I included the error message below :
>>
>> INFO  15:58:04,137 HelpFormatter - Program Args: -S
>> /seq/vsag/axel/Tools/Genome_strip/svtoolkit/qscript/SVDiscovery.q -S
>> /seq/vsag/axel/Tools/Genome_strip/svtoolkit/qscript/SVQScript.q -gatk
>> /seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar
>> -cp /seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/SVToolkit.jar:/seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/Queue.jar
>> -configFile conf/genstrip_installtest_parameters.txt -tempDir ./tmpdir
>> -R /seq/references/Canis_lupus_familiaris_assembly2/v0/Canis_lupus_familiaris_assembly2.fasta
>> -genomeMaskFile
>> /seq/vsag/hyunji/CCD/capture/genomestrip/canFam2_1_index/work/Canis_lupus_familiaris_assembly2.mask.fasta
>> -genderMapFile data/HCSMA_gender.map -runDirectory HCSMA_test -md
>> HCSMA_test/metadata -jobLogDir HCSMA_test/logs -L 1 -minimumSize 100
>> -maximumSize 1000000 -I
>> /seq/picard_aggregation/G14162/HCSMA_B90_Homo_1/v3/HCSMA_B90_Homo_1.bam
>> -O HCSMA.discovery.vcf -run
>> INFO  15:58:04,138 HelpFormatter - Date/Time: 2012/06/07 15:58:04
>> INFO  15:58:04,138 HelpFormatter -
>> ---------------------------------------------------------
>> INFO  15:58:04,138 HelpFormatter -
>> ---------------------------------------------------------
>> INFO  15:58:04,140 QCommandLine - Scripting SVDiscovery
>> ##### ERROR ------------------------------------------------------------------------------------------
>> ##### ERROR stack trace
>> java.lang.IllegalArgumentException: Unrecognized sequence: 1:0-0
>>         at org.broadinstitute.sv.queue.ComputeDiscoveryPartitions.computePartitions(ComputeDiscoveryPartitions.java:96)
>>         at org.broadinstitute.sv.qscript.SVQScript.computeDiscoveryPartitions(SVQScript.q:132)
>>         at SVDiscovery.script(SVDiscovery.q:19)
>>         at org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:46)
>>         at org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:43)
>>         at scala.collection.Iterator$class.foreach(Iterator.scala:631)
>>         at scala.collection.JavaConversions$JIteratorWrapper.foreach(JavaConversions.scala:549)
>>         at scala.collection.IterableLike$class.foreach(IterableLike.scala:79)
>>         at scala.collection.JavaConversions$JListWrapper.foreach(JavaConversions.scala:596)
>>         at org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:43)
>>         at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:239)
>>         at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:117)
>>         at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)
>> ##### ERROR ------------------------------------------------------------------------------------------
>> ##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0.5039M):
>> ##### ERROR
>> ##### ERROR Please visit to wiki to see if this is a known problem
>> ##### ERROR If not, please post the error, with stack trace, to the GATK forum
>> ##### ERROR Visit our wiki for extensive documentation
>> http://www.broadinstitute.org/gsa/wiki
>> ##### ERROR Visit our forum to view answers to commonly asked
>> questions http://getsatisfaction.com/gsa
>> ##### ERROR
>> ##### ERROR MESSAGE: Unrecognized sequence: 1:0-0
>> ##### ERROR ------------------------------------------------------------------------------------------
>> Best regards Axel
> ------------------------------------------------------------------------------
> Live Security Virtual Conference
> Exclusive live event will cover all the ways today's security and
> threat landscape has changed and how IT managers can respond. Discussions
> will include endpoint security, mobile security and the latest in malware
> threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help

Re: [svtoolkit-help] Problem running Genome Strip: Error message : "Unrecognized sequence: 1:0-0

[Per A. E. <eri...@br...>]

Hi
Any ideas?

On Thu, Jun 7, 2012 at 10:10 PM, Per Axel Ericsson
<eri...@br...> wrote:
> Hi
> I've been trying to run Genome Strip on a ~4Mb region, I've run the
> installation test and I have all the dependencies wokring, my target
> is the dog genome a co-worker have created a genome mask file which
> have been previously been validated.
> Can you point me in a direction what this error message mean?
> I included the error message below :
>
> INFO  15:58:04,137 HelpFormatter - Program Args: -S
> /seq/vsag/axel/Tools/Genome_strip/svtoolkit/qscript/SVDiscovery.q -S
> /seq/vsag/axel/Tools/Genome_strip/svtoolkit/qscript/SVQScript.q -gatk
> /seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar
> -cp /seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/SVToolkit.jar:/seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/Queue.jar
> -configFile conf/genstrip_installtest_parameters.txt -tempDir ./tmpdir
> -R /seq/references/Canis_lupus_familiaris_assembly2/v0/Canis_lupus_familiaris_assembly2.fasta
> -genomeMaskFile
> /seq/vsag/hyunji/CCD/capture/genomestrip/canFam2_1_index/work/Canis_lupus_familiaris_assembly2.mask.fasta
> -genderMapFile data/HCSMA_gender.map -runDirectory HCSMA_test -md
> HCSMA_test/metadata -jobLogDir HCSMA_test/logs -L 1 -minimumSize 100
> -maximumSize 1000000 -I
> /seq/picard_aggregation/G14162/HCSMA_B90_Homo_1/v3/HCSMA_B90_Homo_1.bam
> -O HCSMA.discovery.vcf -run
> INFO  15:58:04,138 HelpFormatter - Date/Time: 2012/06/07 15:58:04
> INFO  15:58:04,138 HelpFormatter -
> ---------------------------------------------------------
> INFO  15:58:04,138 HelpFormatter -
> ---------------------------------------------------------
> INFO  15:58:04,140 QCommandLine - Scripting SVDiscovery
> ##### ERROR ------------------------------------------------------------------------------------------
> ##### ERROR stack trace
> java.lang.IllegalArgumentException: Unrecognized sequence: 1:0-0
>        at org.broadinstitute.sv.queue.ComputeDiscoveryPartitions.computePartitions(ComputeDiscoveryPartitions.java:96)
>        at org.broadinstitute.sv.qscript.SVQScript.computeDiscoveryPartitions(SVQScript.q:132)
>        at SVDiscovery.script(SVDiscovery.q:19)
>        at org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:46)
>        at org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:43)
>        at scala.collection.Iterator$class.foreach(Iterator.scala:631)
>        at scala.collection.JavaConversions$JIteratorWrapper.foreach(JavaConversions.scala:549)
>        at scala.collection.IterableLike$class.foreach(IterableLike.scala:79)
>        at scala.collection.JavaConversions$JListWrapper.foreach(JavaConversions.scala:596)
>        at org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:43)
>        at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:239)
>        at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:117)
>        at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)
> ##### ERROR ------------------------------------------------------------------------------------------
> ##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0.5039M):
> ##### ERROR
> ##### ERROR Please visit to wiki to see if this is a known problem
> ##### ERROR If not, please post the error, with stack trace, to the GATK forum
> ##### ERROR Visit our wiki for extensive documentation
> http://www.broadinstitute.org/gsa/wiki
> ##### ERROR Visit our forum to view answers to commonly asked
> questions http://getsatisfaction.com/gsa
> ##### ERROR
> ##### ERROR MESSAGE: Unrecognized sequence: 1:0-0
> ##### ERROR ------------------------------------------------------------------------------------------
> Best regards Axel

Re: [svtoolkit-help] Problem running Genome Strip: Error message : "Unrecognized sequence: 1:0-"

[Bob H. <han...@br...>]

This is because you are using "-L 1" (restrict analysis to chromosome 1) 
and I suspect there is no sequence "1" in your reference assembly.
(Note that "1" is not the same as "chr1".)  The full syntax of -L is 
chr:start-end.
-Bob

On 6/7/12 4:06 PM, Axel Ericsson wrote:
> Hi
> I've been trying to run Genome Strip on a ~4Mb region, I've run the 
> installation test and I have all the dependencies wokring, my target 
> is the dog genome a co-worker have created a genome mask file which 
> have been previously been validated.
> Can you point me in a direction what this error message mean?
> I included the error message below :
>
> INFO  15:58:04,137 HelpFormatter - Program Args: -S 
> /seq/vsag/axel/Tools/Genome_strip/svtoolkit/qscript/SVDiscovery.q -S 
> /seq/vsag/axel/Tools/Genome_strip/svtoolkit/qscript/SVQScript.q -gatk 
> /seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar 
> -cp 
> /seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/SVToolkit.jar:/seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/Queue.jar 
> -configFile conf/genstrip_installtest_parameters.txt -tempDir ./tmpdir 
> -R 
> /seq/references/Canis_lupus_familiaris_assembly2/v0/Canis_lupus_familiaris_assembly2.fasta 
> -genomeMaskFile 
> /seq/vsag/hyunji/CCD/capture/genomestrip/canFam2_1_index/work/Canis_lupus_familiaris_assembly2.mask.fasta 
> -genderMapFile data/HCSMA_gender.map -runDirectory HCSMA_test -md 
> HCSMA_test/metadata -jobLogDir HCSMA_test/logs -L 1 -minimumSize 100 
> -maximumSize 1000000 -I 
> /seq/picard_aggregation/G14162/HCSMA_B90_Homo_1/v3/HCSMA_B90_Homo_1.bam -O 
> HCSMA.discovery.vcf -run
> INFO  15:58:04,138 HelpFormatter - Date/Time: 2012/06/07 15:58:04
> INFO  15:58:04,138 HelpFormatter - 
> ---------------------------------------------------------
> INFO  15:58:04,138 HelpFormatter - 
> ---------------------------------------------------------
> INFO  15:58:04,140 QCommandLine - Scripting SVDiscovery
> ##### ERROR 
> ------------------------------------------------------------------------------------------
> ##### ERROR stack trace
> java.lang.IllegalArgumentException: Unrecognized sequence: 1:0-0
> at 
> org.broadinstitute.sv.queue.ComputeDiscoveryPartitions.computePartitions(ComputeDiscoveryPartitions.java:96)
> at 
> org.broadinstitute.sv.qscript.SVQScript.computeDiscoveryPartitions(SVQScript.q:132)
> at SVDiscovery.script(SVDiscovery.q:19)
> at 
> org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:46)
> at 
> org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:43)
> at scala.collection.Iterator$class.foreach(Iterator.scala:631)
> at 
> scala.collection.JavaConversions$JIteratorWrapper.foreach(JavaConversions.scala:549)
> at scala.collection.IterableLike$class.foreach(IterableLike.scala:79)
> at 
> scala.collection.JavaConversions$JListWrapper.foreach(JavaConversions.scala:596)
> at 
> org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:43)
> at 
> org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:239)
> at 
> org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:117)
> at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)
> ##### ERROR 
> ------------------------------------------------------------------------------------------
> ##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0.5039M):
> ##### ERROR
> ##### ERROR Please visit to wiki to see if this is a known problem
> ##### ERROR If not, please post the error, with stack trace, to the 
> GATK forum
> ##### ERROR Visit our wiki for extensive documentation 
> http://www.broadinstitute.org/gsa/wiki
> ##### ERROR Visit our forum to view answers to commonly asked 
> questions http://getsatisfaction.com/gsa
> ##### ERROR
> ##### ERROR MESSAGE: Unrecognized sequence: 1:0-0
> ##### ERROR 
> ------------------------------------------------------------------------------------------
> Best regards Axel
>
>
> ------------------------------------------------------------------------------
> Live Security Virtual Conference
> Exclusive live event will cover all the ways today's security and
> threat landscape has changed and how IT managers can respond. Discussions
> will include endpoint security, mobile security and the latest in malware
> threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
>
>
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help

[svtoolkit-help] Problem running Genome Strip: Error message : "Unrecognized sequence: 1:0-0

[Per A. E. <eri...@br...>]

Hi
I've been trying to run Genome Strip on a ~4Mb region, I've run the
installation test and I have all the dependencies wokring, my target
is the dog genome a co-worker have created a genome mask file which
have been previously been validated.
Can you point me in a direction what this error message mean?
I included the error message below :

INFO  15:58:04,137 HelpFormatter - Program Args: -S
/seq/vsag/axel/Tools/Genome_strip/svtoolkit/qscript/SVDiscovery.q -S
/seq/vsag/axel/Tools/Genome_strip/svtoolkit/qscript/SVQScript.q -gatk
/seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar
-cp /seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/SVToolkit.jar:/seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/Queue.jar
-configFile conf/genstrip_installtest_parameters.txt -tempDir ./tmpdir
-R /seq/references/Canis_lupus_familiaris_assembly2/v0/Canis_lupus_familiaris_assembly2.fasta
-genomeMaskFile
/seq/vsag/hyunji/CCD/capture/genomestrip/canFam2_1_index/work/Canis_lupus_familiaris_assembly2.mask.fasta
-genderMapFile data/HCSMA_gender.map -runDirectory HCSMA_test -md
HCSMA_test/metadata -jobLogDir HCSMA_test/logs -L 1 -minimumSize 100
-maximumSize 1000000 -I
/seq/picard_aggregation/G14162/HCSMA_B90_Homo_1/v3/HCSMA_B90_Homo_1.bam
-O HCSMA.discovery.vcf -run
INFO  15:58:04,138 HelpFormatter - Date/Time: 2012/06/07 15:58:04
INFO  15:58:04,138 HelpFormatter -
---------------------------------------------------------
INFO  15:58:04,138 HelpFormatter -
---------------------------------------------------------
INFO  15:58:04,140 QCommandLine - Scripting SVDiscovery
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR stack trace
java.lang.IllegalArgumentException: Unrecognized sequence: 1:0-0
	at org.broadinstitute.sv.queue.ComputeDiscoveryPartitions.computePartitions(ComputeDiscoveryPartitions.java:96)
	at org.broadinstitute.sv.qscript.SVQScript.computeDiscoveryPartitions(SVQScript.q:132)
	at SVDiscovery.script(SVDiscovery.q:19)
	at org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:46)
	at org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:43)
	at scala.collection.Iterator$class.foreach(Iterator.scala:631)
	at scala.collection.JavaConversions$JIteratorWrapper.foreach(JavaConversions.scala:549)
	at scala.collection.IterableLike$class.foreach(IterableLike.scala:79)
	at scala.collection.JavaConversions$JListWrapper.foreach(JavaConversions.scala:596)
	at org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:43)
	at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:239)
	at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:117)
	at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0.5039M):
##### ERROR
##### ERROR Please visit to wiki to see if this is a known problem
##### ERROR If not, please post the error, with stack trace, to the GATK forum
##### ERROR Visit our wiki for extensive documentation
http://www.broadinstitute.org/gsa/wiki
##### ERROR Visit our forum to view answers to commonly asked
questions http://getsatisfaction.com/gsa
##### ERROR
##### ERROR MESSAGE: Unrecognized sequence: 1:0-0
##### ERROR ------------------------------------------------------------------------------------------
Best regards Axel

[svtoolkit-help] Problem running Genome Strip: Error message : "Unrecognized sequence: 1:0-"

[Axel E. <axe...@gm...>]

Hi
I've been trying to run Genome Strip on a ~4Mb region, I've run the
installation test and I have all the dependencies wokring, my target is the
dog genome a co-worker have created a genome mask file which have been
previously been validated.
Can you point me in a direction what this error message mean?
I included the error message below :

INFO  15:58:04,137 HelpFormatter - Program Args: -S
/seq/vsag/axel/Tools/Genome_strip/svtoolkit/qscript/SVDiscovery.q -S
/seq/vsag/axel/Tools/Genome_strip/svtoolkit/qscript/SVQScript.q -gatk
/seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar
-cp
/seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/SVToolkit.jar:/seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/seq/vsag/axel/Tools/Genome_strip/svtoolkit/lib/gatk/Queue.jar
-configFile conf/genstrip_installtest_parameters.txt -tempDir ./tmpdir -R
/seq/references/Canis_lupus_familiaris_assembly2/v0/Canis_lupus_familiaris_assembly2.fasta
-genomeMaskFile
/seq/vsag/hyunji/CCD/capture/genomestrip/canFam2_1_index/work/Canis_lupus_familiaris_assembly2.mask.fasta
-genderMapFile data/HCSMA_gender.map -runDirectory HCSMA_test -md
HCSMA_test/metadata -jobLogDir HCSMA_test/logs -L 1 -minimumSize 100
-maximumSize 1000000 -I
/seq/picard_aggregation/G14162/HCSMA_B90_Homo_1/v3/HCSMA_B90_Homo_1.bam -O
HCSMA.discovery.vcf -run
INFO  15:58:04,138 HelpFormatter - Date/Time: 2012/06/07 15:58:04
INFO  15:58:04,138 HelpFormatter -
---------------------------------------------------------
INFO  15:58:04,138 HelpFormatter -
---------------------------------------------------------
INFO  15:58:04,140 QCommandLine - Scripting SVDiscovery
##### ERROR
------------------------------------------------------------------------------------------
##### ERROR stack trace
java.lang.IllegalArgumentException: Unrecognized sequence: 1:0-0
at
org.broadinstitute.sv.queue.ComputeDiscoveryPartitions.computePartitions(ComputeDiscoveryPartitions.java:96)
at
org.broadinstitute.sv.qscript.SVQScript.computeDiscoveryPartitions(SVQScript.q:132)
at SVDiscovery.script(SVDiscovery.q:19)
at
org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:46)
at
org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:43)
at scala.collection.Iterator$class.foreach(Iterator.scala:631)
at
scala.collection.JavaConversions$JIteratorWrapper.foreach(JavaConversions.scala:549)
at scala.collection.IterableLike$class.foreach(IterableLike.scala:79)
at
scala.collection.JavaConversions$JListWrapper.foreach(JavaConversions.scala:596)
at
org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:43)
at
org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:239)
at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:117)
at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)
##### ERROR
------------------------------------------------------------------------------------------
##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0.5039M):
##### ERROR
##### ERROR Please visit to wiki to see if this is a known problem
##### ERROR If not, please post the error, with stack trace, to the GATK
forum
##### ERROR Visit our wiki for extensive documentation
http://www.broadinstitute.org/gsa/wiki
##### ERROR Visit our forum to view answers to commonly asked questions
http://getsatisfaction.com/gsa
##### ERROR
##### ERROR MESSAGE: Unrecognized sequence: 1:0-0
##### ERROR
------------------------------------------------------------------------------------------
Best regards Axel

Re: [svtoolkit-help] Left read of read pair fails left read test

[Bob H. <han...@br...>]

I was able to find and fix this problem thanks to lots of help from 
Martin Kircher who kindly provided debugging help and some sample data 
that recreated the problem.
This should be resolved in interim releasev r939 and later versions.
ftp://ftp.broadinstitute.org/pub/svtoolkit/releases/interim/svtoolkit_1.04.939.tar.gz
-Bob

On 11/10/11 10:45 AM, Philine Feulner wrote:
> Dear Bob,
>
> I am referring to your reply from the 2011-07-15. I am very sorry that it took me so long to come back to you!
>
> I run Picard ValidateSam on the bam files and they are fine.
>
> I also extracted 2 pairs of reads (from different chromosomes and libraries) which failed to run through svtoolkit (error: Left read of read pair fails left read test):
>
> NG-5241_BS25_4kb_7_68_16539_10233       65      scaffold_1073   245     37      36M     =       755     510     CTATCTATCCACGCCGCGCAGACATCTCAAAATCTC    355767676676476474777877867679997675    X0:i:1  X1:i:0  MD:Z:16A19      RG:Z:BS25_4kb_read_run1t_matepair       XG:i:0  AM:i:37 NM:i:1  SM:i:37 XM:i:1  XO:i:0  MQ:i:37 OQ:Z:IIGHIIIIHIIIHIIIIIIIIIIIIIIIIIIIHIII     XT:A:U
> NG-5241_BS25_4kb_7_68_16539_10233       129     scaffold_1073   755     37      36M     =       245     -510    TCACTTTCAAACCTTCATATTATGTGTGTCTATATA    345677767886677677677677878786767685 X0:i:1  X1:i:0  MD:Z:36 RG:Z:BS25_4kb_read_run1t_matepair       XG:i:0  AM:i:37 NM:i:0  SM:i:37 XM:i:0  XO:i:0  MQ:i:37 OQ:Z:IGFHIEIIIIIIIIIIIHIIIIIIIIIIIIHIIIII       XT:A:U
>
> HWI-ST225_0141:4:1:18064:55456#0        97      groupIV 12453454        37      50M     =       12453809        404     CTTATATGACTCCACCAAATGCTCATCTTAACCGTCAATCCGCGAGAGTT      78767677867667667887777677677686638678766374878787      X0:i:1  X1:i:0  MD:Z:7C36C5     RG:Z:BS25_read_run2t_paired_50bp        XG:i:0  AM:i:37 NM:i:2  SM:i:37 XM:i:2  XO:i:0  MQ:i:37 OQ:Z:IIIGGHIIIIIIIHIIIIIIIIGIIIIIIIIIIIIIHIIIIIIEIIIIHH XT:A:U
> HWI-ST225_0141:4:1:18064:55456#0        145     groupIV 12453809        37      50M     =       12453454        -404    TGAGTATTTAGGGAAGAACTTATGTTAAAATGTTTGTTGACCTCAGGACT      76766788676667767878677686777776887687687787766887      X0:i:1  X1:i:0  MD:Z:12A37      RG:Z:BS25_read_run2t_paired_50bp        XG:i:0  AM:i:37 NM:i:1  SM:i:37 XM:i:1  XO:i:0  MQ:i:37 OQ:Z:IIIIGIIIIIIIGHIIIIBIIIIIIGGIHIHIIIIIIIIIIHIIIIIIII XT:A:U
>
>
> If I run svtoolkit on these read pairs (bam files attached) only, one pair (from the paired end library) now runs through while the other one (from the mate pair library) still fails.
>
> Thanks for your help,
> Philine
>
>
>
>
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Dr Philine Feulner
> Westfälische Wilhelms University
> Institute for Evolution and Biodiversity
> Evolutionary Bioinformatics Group
> Hüfferstrasse 1
> 48149 Münster
> Germany
> Tel: +49 (0) 251 83 21636
> Fax: +49 (0) 251 83 24668
> Email: p.f...@un...
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
>
>
>
> ------------------------------------------------------------------------------
> RSA(R) Conference 2012
> Save $700 by Nov 18
> Register now
> http://p.sf.net/sfu/rsa-sfdev2dev1
>
>
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help

Re: [svtoolkit-help] ERROR MESSAGE: Parameters to GenomeLocParser are incorrect: the contig index is less than 0

[Bob H. <han...@br...>]

Hi, Saumya,
Just going from the error message, I might guess that you specified a 
locus on the command line (e.g. using -L)
but the chromosome name does not match any name in your reference sequence.
If this isn't it, I think more detail from you will be needed.
-Bob

On 5/3/12 7:10 AM, Saumya Kumar wrote:
>
> Hello,
>
> I am using Genome Strip on one of the bam files and it generates this 
> error:
>
> ERROR stack trace
>
> org.broadinstitute.sting.utils.exceptions.ReviewedStingException: 
> Parameters to GenomeLocParser are incorrect: the contig index is less 
> than 0
>
>         at 
> org.broadinstitute.sting.utils.GenomeLocParser.exceptionOnInvalidGenomeLoc(GenomeLocParser.java:427)
>
>         at 
> org.broadinstitute.sting.utils.GenomeLocParser.createGenomeLoc(GenomeLocParser.java:390)
>
>         at 
> org.broadinstitute.sting.gatk.iterators.VerifyingSamIterator.isOutOfOrder(VerifyingSamIterator.java:47)
>
>         at 
> org.broadinstitute.sting.gatk.iterators.VerifyingSamIterator.verifyRecord(VerifyingSamIterator.java:36)
>
>         at 
> org.broadinstitute.sting.gatk.iterators.VerifyingSamIterator.next(VerifyingSamIterator.java:29)
>
>         at 
> org.broadinstitute.sting.gatk.iterators.VerifyingSamIterator.next(VerifyingSamIterator.java:13)
>
>         at 
> org.broadinstitute.sting.gatk.filters.CountingFilteringIterator.getNextRecord(CountingFilteringIterator.java:106)
>
>         at 
> org.broadinstitute.sting.gatk.filters.CountingFilteringIterator.next(CountingFilteringIterator.java:82)
>
>         at 
> org.broadinstitute.sting.gatk.filters.CountingFilteringIterator.next(CountingFilteringIterator.java:42)
>
>         at 
> org.broadinstitute.sting.gatk.iterators.PrivateStringSAMCloseableIterator.next(StingSAMIteratorAdapter.java:100)
>
>         at 
> org.broadinstitute.sting.gatk.iterators.PrivateStringSAMCloseableIterator.next(StingSAMIteratorAdapter.java:84)
>
>         at 
> org.broadinstitute.sting.gatk.datasources.simpleDataSources.SAMDataSource.fillShard(SAMDataSource.java:436)
>
>         at 
> org.broadinstitute.sting.gatk.datasources.shards.ReadShardStrategy.advance(ReadShardStrategy.java:179)
>
>         at 
> org.broadinstitute.sting.gatk.datasources.shards.ReadShardStrategy.next(ReadShardStrategy.java:129)
>
>         at 
> org.broadinstitute.sting.gatk.datasources.shards.ReadShardStrategy.next(ReadShardStrategy.java:44)
>
>         at 
> org.broadinstitute.sting.utils.threading.GenomeLocProcessingTracker$OwnershipIterator.next(GenomeLocProcessingTracker.java:172)
>
>         at 
> org.broadinstitute.sting.utils.threading.GenomeLocProcessingTracker$OwnershipIterator.next(GenomeLocProcessingTracker.java:144)
>
>         at 
> org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:52)
>
>         at 
> org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:217)
>
>         at 
> org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:111)
>
>         at 
> org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:239)
>
>         at 
> org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:87)
>
> I have adapted discovery.sh script according to my bam files, but it 
> is giving this sort of error. I couldn't find anything similar in the 
> archive list, could anyone please suggest what might be the problem?
>
> Thanks,
>
> Saumya
>
>
> This email may have a PROTECTIVE MARKING, for an explanation please 
> see: 
> http://www.mrc.ac.uk/About/Informationandstandards/Documentmarking/index.htm 
> <http://www.mrc.ac.uk/About/Informationandstandards/Documentmarking/index.htm%20> 
>
>
>
>
> ------------------------------------------------------------------------------
> Live Security Virtual Conference
> Exclusive live event will cover all the ways today's security and
> threat landscape has changed and how IT managers can respond. Discussions
> will include endpoint security, mobile security and the latest in malware
> threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
>
>
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help

[svtoolkit-help] ERROR MESSAGE: Parameters to GenomeLocParser are incorrect: the contig index is less than 0

[Saumya K. <s....@ha...>]

Hello,

I am using Genome Strip on one of the bam files and it generates this error:

ERROR stack trace
org.broadinstitute.sting.utils.exceptions.ReviewedStingException: Parameters to GenomeLocParser are incorrect: the contig index is less than 0
        at org.broadinstitute.sting.utils.GenomeLocParser.exceptionOnInvalidGenomeLoc(GenomeLocParser.java:427)
        at org.broadinstitute.sting.utils.GenomeLocParser.createGenomeLoc(GenomeLocParser.java:390)
        at org.broadinstitute.sting.gatk.iterators.VerifyingSamIterator.isOutOfOrder(VerifyingSamIterator.java:47)
        at org.broadinstitute.sting.gatk.iterators.VerifyingSamIterator.verifyRecord(VerifyingSamIterator.java:36)
        at org.broadinstitute.sting.gatk.iterators.VerifyingSamIterator.next(VerifyingSamIterator.java:29)
        at org.broadinstitute.sting.gatk.iterators.VerifyingSamIterator.next(VerifyingSamIterator.java:13)
        at org.broadinstitute.sting.gatk.filters.CountingFilteringIterator.getNextRecord(CountingFilteringIterator.java:106)
        at org.broadinstitute.sting.gatk.filters.CountingFilteringIterator.next(CountingFilteringIterator.java:82)
        at org.broadinstitute.sting.gatk.filters.CountingFilteringIterator.next(CountingFilteringIterator.java:42)
        at org.broadinstitute.sting.gatk.iterators.PrivateStringSAMCloseableIterator.next(StingSAMIteratorAdapter.java:100)
        at org.broadinstitute.sting.gatk.iterators.PrivateStringSAMCloseableIterator.next(StingSAMIteratorAdapter.java:84)
        at org.broadinstitute.sting.gatk.datasources.simpleDataSources.SAMDataSource.fillShard(SAMDataSource.java:436)
        at org.broadinstitute.sting.gatk.datasources.shards.ReadShardStrategy.advance(ReadShardStrategy.java:179)
        at org.broadinstitute.sting.gatk.datasources.shards.ReadShardStrategy.next(ReadShardStrategy.java:129)
        at org.broadinstitute.sting.gatk.datasources.shards.ReadShardStrategy.next(ReadShardStrategy.java:44)
        at org.broadinstitute.sting.utils.threading.GenomeLocProcessingTracker$OwnershipIterator.next(GenomeLocProcessingTracker.java:172)
        at org.broadinstitute.sting.utils.threading.GenomeLocProcessingTracker$OwnershipIterator.next(GenomeLocProcessingTracker.java:144)
        at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:52)
        at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:217)
        at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:111)
        at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:239)
        at org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:87)

I have adapted discovery.sh script according to my bam files, but it is giving this sort of error. I couldn't find anything similar in the archive list, could anyone please suggest what might be the problem?

Thanks,
Saumya



This email may have a PROTECTIVE MARKING, for an explanation please see: http://www.mrc.ac.uk/About/Informationandstandards/Documentmarking/index.htm

Re: [svtoolkit-help] Overlapping CNVs?

[Bob H. <han...@br...>]

Hi, Eddie,

First of all, the examples you are showing below are not called as 
deletions - all three failed both the COVERAGE and DEPTH default filters.
The VCF will list all of the sites evaluated, but most evaluated sites 
are not in fact polymorphic.

That said, you will likely find some examples of overlapping calls among 
the passing calls as well.  In my experience, the number of
passing calls that overlap are usually a percent or two.  When there are 
overlapping calls, they _might_ be two different events, with different
breakpoints, but in most cases they are usually redundant calls of the 
same underlying polymorphism with slightly different boundary estimates.

I have been experimenting with filters to remove the redundant calls 
after genotyping.
These tools have been used in the 1000 genomes phase 1 processing, but 
are not released yet.
In the meantime, don't be surprised if you get a few redundant calls.

-Bob

On 4/10/12 4:48 PM, Eddie Loh wrote:
> Hi,
>
> I ran Genome-STRiP on my dataset and in the output genotype vcf files, I
> noticed that some of the reported deletions were overlapping. How should I
> interpret such overlapping deletions? Would one of the predicted deletion
> be better than the others?
>
> For example:
> chr1    2583913 DEL_13  C<DEL>    .       COVERAGE;DEPTH
> CIEND=-44,45;CIPOS=-44,45;END=2629140;GSCOHERENCE=-6.6125886653079;GSCOHFN=-2.2041962217693;GSCOHPVALUE=0.0399;GSCOORDS=2583629,2583912,2629141,2629308;GSDEPTHCALLTHRESHOLD=1.8113119220635596;GSDEPTHNOBSSAMPLES=2;GSDEPTHNTOTALSAMPLES=2;GSDEPTHOBSSAMPLES=0904,0906;GSDEPTHPVALUE=0.0;GSDEPTHRANKSUMPVALUE=0.913914;GSDEPTHRATIO=1.3544900147632686;GSDMAX=45328;GSDMIN=44329;GSDOPT=45140;<rest
> of line clipped>
> chr1    2583923 DEL_7   A<DEL>    .       COVERAGE;DEPTH
> CIEND=-59,59;CIPOS=-59,59;END=2621941;GSCOHERENCE=-3.731442108152636;GSCOHFN=-0.7462884216305272;GSCOHPVALUE=0.6772;GSCOORDS=2583656,2583912,2621951,2622152;GSDEPTHCALLTHRESHOLD=1.6648659343192074;GSDEPTHNOBSSAMPLES=3;GSDEPTHNTOTALSAMPLES=3;GSDEPTHOBSSAMPLES=0708,0904,0913;GSDEPTHPVALUE=0.0;GSDEPTHRANKSUMPVALUE=0.8289357;GSDEPTHRATIO=1.2133095867419799;GSDMAX=38138;GSDMIN=37139;GSDOPT=37940;<rest
> of line clipped>
> chr1    2583951 DEL_9   A<DEL>    .       COVERAGE;DEPTH
> CIEND=-121,121;CIPOS=-121,121;END=2617214;GSCOHERENCE=-1.3613655977544998;GSCOHFN=-0.6806827988772499;GSCOHPVALUE=0.601;GSCOORDS=2583824,2583939,2617225,2617334;GSDEPTHCALLTHRESHOLD=1.6374681994307405;GSDEPTHNOBSSAMPLES=2;GSDEPTHNTOTALSAMPLES=2;GSDEPTHOBSSAMPLES=0904,0912;GSDEPTHPVALUE=0.0;GSDEPTHRANKSUMPVALUE=0.9686783;GSDEPTHRATIO=1.4466964842117855;GSDMAX=33385;GSDMIN=32386;GSDOPT=33065;<rest
> of line clipped>
>
> Cheers,
> Eddie
>
>
>
>
> ------------------------------------------------------------------------------
> Better than sec? Nothing is better than sec when it comes to
> monitoring Big Data applications. Try Boundary one-second
> resolution app monitoring today. Free.
> http://p.sf.net/sfu/Boundary-dev2dev
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help

[svtoolkit-help] Overlapping CNVs?

[Eddie L. <edd...@pa...>]

Hi,

I ran Genome-STRiP on my dataset and in the output genotype vcf files, I
noticed that some of the reported deletions were overlapping. How should I
interpret such overlapping deletions? Would one of the predicted deletion
be better than the others?

For example:
chr1    2583913 DEL_13  C       <DEL>   .       COVERAGE;DEPTH 
CIEND=-44,45;CIPOS=-44,45;END=2629140;GSCOHERENCE=-6.6125886653079;GSCOHFN=-2.2041962217693;GSCOHPVALUE=0.0399;GSCOORDS=2583629,2583912,2629141,2629308;GSDEPTHCALLTHRESHOLD=1.8113119220635596;GSDEPTHNOBSSAMPLES=2;GSDEPTHNTOTALSAMPLES=2;GSDEPTHOBSSAMPLES=0904,0906;GSDEPTHPVALUE=0.0;GSDEPTHRANKSUMPVALUE=0.913914;GSDEPTHRATIO=1.3544900147632686;GSDMAX=45328;GSDMIN=44329;GSDOPT=45140;<rest
of line clipped>
chr1    2583923 DEL_7   A       <DEL>   .       COVERAGE;DEPTH 
CIEND=-59,59;CIPOS=-59,59;END=2621941;GSCOHERENCE=-3.731442108152636;GSCOHFN=-0.7462884216305272;GSCOHPVALUE=0.6772;GSCOORDS=2583656,2583912,2621951,2622152;GSDEPTHCALLTHRESHOLD=1.6648659343192074;GSDEPTHNOBSSAMPLES=3;GSDEPTHNTOTALSAMPLES=3;GSDEPTHOBSSAMPLES=0708,0904,0913;GSDEPTHPVALUE=0.0;GSDEPTHRANKSUMPVALUE=0.8289357;GSDEPTHRATIO=1.2133095867419799;GSDMAX=38138;GSDMIN=37139;GSDOPT=37940;<rest
of line clipped>
chr1    2583951 DEL_9   A       <DEL>   .       COVERAGE;DEPTH 
CIEND=-121,121;CIPOS=-121,121;END=2617214;GSCOHERENCE=-1.3613655977544998;GSCOHFN=-0.6806827988772499;GSCOHPVALUE=0.601;GSCOORDS=2583824,2583939,2617225,2617334;GSDEPTHCALLTHRESHOLD=1.6374681994307405;GSDEPTHNOBSSAMPLES=2;GSDEPTHNTOTALSAMPLES=2;GSDEPTHOBSSAMPLES=0904,0912;GSDEPTHPVALUE=0.0;GSDEPTHRANKSUMPVALUE=0.9686783;GSDEPTHRATIO=1.4466964842117855;GSDMAX=33385;GSDMIN=32386;GSDOPT=33065;<rest
of line clipped>

Cheers,
Eddie

Re: [svtoolkit-help] A question about GenomeSTRiP

[Bob H. <han...@br...>]

On 4/6/12 2:32 AM, Jaemin Kim wrote:
>
> Hello, Steven McCarroll
>
> I'm Jaemin Kim, a graduate student in Seoul National University. I'm 
> trying to identify the CNV of horse and pig NGS via GenomeSTrip, but 
> I'm having some difficulties.
>
> 1.Can you please send me an README file or the description file of the 
> output format? I tested with small sets, but I don't know how to 
> interpret the result file (For example, the first column denotes for 
> this, the second for this, and so on). Do you have the explanation of 
> the final output files in output directory?
>
The final output files are in vcf format: 
http://www.1000genomes.org/wiki/Analysis/Variant%20Call%20Format/vcf-variant-call-format-version-41
I think they are compatible with v4.1, but if you find discrepancies, 
please let me know.
>
> 2.Also, during the SV Discovery Process, I see the following message; 
> java.lang.IllegalArgumentException: *Left read of read pair fails left 
> read test*: HWI-ST840:150:C097JACXX:1:1101:12655:134832 145 29 
> 934986924 4M1I94M 29 9349874-92 
> GATCTCGTGGCATAGTGGTTGGGTTCAGCATCCTCTGCTTTGGTGCCCCAGGTTTGCAGGTTCAGATCCTGGGCATGGATCTACACCACTTGTCAGCCA 
> DDBD@@DCDDDDDDDDDDDDBDEEDEEDFDFFFHHHGGJIIJIJIJJIHIJJIJIJJIJJJJJJJJIJIIJIGBIIIJGHFIFGCIGFHHHGFFFFFBB 
> MD:Z:1C0C95 RG:Z:P00033F1.001 XG:i:1 NM:i:3 XM:i:2 XN:i:0 XO:i:1 
> MQ:i:24 AS:i:-18 YS:i:-20 YT:Z:DP
>
There should have been two "#DBG:" lines directly before this error - 
can you send them?
Thanks,
-Bob
>
> Can you please tell me how to fix this error? We used the test samples 
> of 7.
>
> I really think that this is a useful tool, considering the population 
> basis. So could you please help me on these questions? I will really 
> appreciate your consideration.
>
> Sincerely,
>
> Jaemin Kim
>
>
>
> ------------------------------------------------------------------------------
> For Developers, A Lot Can Happen In A Second.
> Boundary is the first to Know...and Tell You.
> Monitor Your Applications in Ultra-Fine Resolution. Try it FREE!
> http://p.sf.net/sfu/Boundary-d2dvs2
>
>
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help

[svtoolkit-help] A question about GenomeSTRiP

[Jaemin K. <jm...@sn...>]

Hello, Steven McCarroll
 


 

I’m Jaemin Kim, a graduate student in Seoul National University. I’m trying to identify the CNV of horse and pig NGS via GenomeSTrip, but I’m having some difficulties.
 


 

1.     Can you please send me an README file or the description file of the output format? I tested with small sets, but I don’t know how to interpret the result file (For example, the first column denotes for this, the second for this, and so on). Do you have the explanation of the final output files in output directory?
 

2.     Also, during the SV Discovery Process, I see the following message; java.lang.IllegalArgumentException: Left read of read pair fails left read test: HWI-ST840:150:C097JACXX:1:1101:12655:134832 145 29 9349869 24 4M1I94M 29 9349874 -92 GATCTCGTGGCATAGTGGTTGGGTTCAGCATCCTCTGCTTTGGTGCCCCAGGTTTGCAGGTTCAGATCCTGGGCATGGATCTACACCACTTGTCAGCCA DDBD@@DCDDDDDDDDDDDDBDEEDEEDFDFFFHHHGGJIIJIJIJJIHIJJIJIJJIJJJJJJJJIJIIJIGBIIIJGHFIFGCIGFHHHGFFFFFBB MD:Z:1C0C95 RG:Z:P00033F1.001 XG:i:1 NM:i:3 XM:i:2 XN:i:0 XO:i:1 MQ:i:24 AS:i:-18 YS:i:-20 YT:Z:DP
 

Can you please tell me how to fix this error? We used the test samples of 7.
 

 I really think that this is a useful tool, considering the population basis. So could you please help me on these questions? I will really appreciate your consideration.
 


 

Sincerely,
 


 

Jaemin Kim
 

Re: [svtoolkit-help] high depth region

[Bob H. <han...@br...>]

This is a known problem.
One solution is to run the parallelism more fine-grained (this is 
usually what I do).
Another solution is to simply not run these regions (notably the 
peri-centromeric regions on chr10 and chr2).
You can control this with -L.
You are unlikely to get good calls in these regions.
There is currently no other way to throttle back processing in these 
regions, although I agree it would be useful.
-Bob

On 4/4/12 5:19 PM, Ashish Kumar wrote:
>
> Hi Bob,
>
> While trying to run discovery pipeline over the whole-genome, there 
> are certain regions that are high depth region (and presumably very 
> low complexity).
>
> For eg. on a chr10's 2Mb region, the discovery is able to complete 
> only about 20% of the region in 3 days of computation.
>
> Shall I parallelise this region further into smaller discovery regions 
> or there are other ways that GenomeSTRiP can cope up with in such a 
> situation?
>
> Thanks,
>
> Ashish
>
>
>
> ------------------------------------------------------------------------------
> Better than sec? Nothing is better than sec when it comes to
> monitoring Big Data applications. Try Boundary one-second
> resolution app monitoring today. Free.
> http://p.sf.net/sfu/Boundary-dev2dev
>
>
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help