svtoolkit-help Mailing List for Structural Variation Toolkit (Page 4)
Status: Beta
Brought to you by:
bhandsaker
Menu
▾
▴
svtoolkit-help — bug reports and trouble shooting
You can subscribe to this list here.
| 2011 |
Jan
|
Feb
(2) |
Mar
(7) |
Apr
(3) |
May
|
Jun
(9) |
Jul
(2) |
Aug
(2) |
Sep
(15) |
Oct
(13) |
Nov
(11) |
Dec
(8) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2012 |
Jan
(14) |
Feb
(5) |
Mar
(4) |
Apr
(8) |
May
(2) |
Jun
(8) |
Jul
(6) |
Aug
(4) |
Sep
(8) |
Oct
(5) |
Nov
(2) |
Dec
(4) |
| 2013 |
Jan
(4) |
Feb
|
Mar
(4) |
Apr
|
May
(8) |
Jun
(3) |
Jul
|
Aug
(1) |
Sep
|
Oct
(4) |
Nov
|
Dec
(3) |
| 2014 |
Jan
|
Feb
|
Mar
(3) |
Apr
(5) |
May
|
Jun
|
Jul
|
Aug
|
Sep
(1) |
Oct
|
Nov
|
Dec
|
| 2015 |
Jan
(2) |
Feb
(9) |
Mar
(2) |
Apr
(6) |
May
|
Jun
(7) |
Jul
|
Aug
(2) |
Sep
(4) |
Oct
(4) |
Nov
(1) |
Dec
(1) |
| 2016 |
Jan
|
Feb
|
Mar
|
Apr
|
May
|
Jun
|
Jul
(2) |
Aug
(3) |
Sep
(3) |
Oct
(1) |
Nov
|
Dec
|
| 2017 |
Jan
|
Feb
(2) |
Mar
|
Apr
|
May
|
Jun
|
Jul
|
Aug
|
Sep
(3) |
Oct
(3) |
Nov
(1) |
Dec
|
| 2018 |
Jan
(2) |
Feb
|
Mar
|
Apr
|
May
(3) |
Jun
(6) |
Jul
|
Aug
(4) |
Sep
|
Oct
(1) |
Nov
|
Dec
|
|
From: Pınar K. <pin...@gm...> - 2014-04-18 10:18:03
|
Hi,
Sorry for re-posting the same error subject, but when I run the
preprocessing step of SVToolkit, I get the same error and could not find
out a solution. I use the SVToolkit version 1.04 (build 1358).
I'll appreciate any help. Thanks,
Pinar Kavak
Researcher
Turkey
Here is command and the output log file is following:
COMMAND
-----------------------------------------------------------------
SV_TMPDIR=./tmpdir
SV_TMPDIR=/tmp
IN_DIR=/export/storage
REF_DIR=/export/working/ortak/b37_bundle_2.5
runDir=/export/working/pinar/genomeStrip
sites=/export/working/pinar/genomeStrip/sizofreni.discovery.vcf
genotypes=/export/working/pinar/genomeStrip/sizofreni.genotypes.vcf
export LD_LIBRARY_PATH=${SV_DIR}/bwa:${LD_LIBRARY_PATH}
mx="-Xmx16g"
classpath="${SV_DIR}/lib/SVToolkit.jar:${SV_DIR}/lib/gatk/GenomeAnalysisTK.jar:${SV_DIR}/lib/gatk/Queue.jar"
mkdir -p ${runDir}/logs || exit 1
mkdir -p ${runDir}/metadata || exit 1
java -cp ${classpath} ${mx} -jar ${SV_DIR}/lib/SVToolkit.jar
java -cp ${classpath} ${mx} \
-Djava.io.tmpdir=${SV_TMPDIR} \
-Djava.library.path=bwa \
org.broadinstitute.sting.queue.QCommandLine \
-cp ${classpath} \
-S ${SV_DIR}/qscript/SVPreprocess.q \
-S ${SV_DIR}/qscript/SVQScript.q \
-md ${runDir}/metadata \
-configFile installtest/conf/genstrip_installtest_parameters.txt \
-tempDir ${SV_TMPDIR} \
-gatk ${SV_DIR}/lib/gatk/GenomeAnalysisTK.jar \
-R ${REF_DIR}/human_g1k_v37.fasta \
-genomeMaskFile ${REF_DIR}/mask/human_g1k_v37.mask.fasta \
-ploidyMapFile ${REF_DIR}/mask/humgen_g1k_v37_ploidy.map \
-copyNumberMaskFile ${REF_DIR}/mask/cn2_mask_g1k_v37.fasta \
-computeGCProfiles \
-bamFilesAreDisjoint \
-I ${IN_DIR}/Nurten_SIZOFRENI/WGS/bam/2367.realigned.bam \
-I ${IN_DIR}/Nurten_SIZOFRENI/WGS/bam/855.realigned.bam \
-runDirectory ${runDir} \
-jobLogDir ${runDir}/logs \
--disableJobReport \
-run
OUTPUT LOG
------------------
SVToolkit version 1.04 (build 1358)
Build date: 2014/02/13 15:47:19
Web site: http://www.broadinstitute.org/software/genomestrip
INFO 18:46:59,457 QScriptManager - Compiling 2 QScripts
INFO 18:47:13,419 QScriptManager - Compilation complete
INFO 18:47:13,665 HelpFormatter -
----------------------------------------------------------------------
INFO 18:47:13,665 HelpFormatter - Queue v2.5-2-g5671483, Compiled
2013/08/22 15:09:27
INFO 18:47:13,665 HelpFormatter - Copyright (c) 2012 The Broad Institute
INFO 18:47:13,666 HelpFormatter - For support and documentation go to
http://www.broadinstitute.org/gatk
INFO 18:47:13,666 HelpFormatter - Program Args: -cp
/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar
-S /export/home/ortak/TOOLS/svtoolkit/qscript/SVPreprocess.q -S
/export/home/ortak/TOOLS/svtoolkit/qscript/SVQScript.q -md
/export/working/pinar/genomeStrip/metadata -configFile
installtest/conf/genstrip_installtest_parameters.txt -tempDir /tmp -gatk
/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar -R
/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta -genomeMaskFile
/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta
-ploidyMapFile
/export/working/ortak/b37_bundle_2.5/mask/humgen_g1k_v37_ploidy.map
-copyNumberMaskFile
/export/working/ortak/b37_bundle_2.5/mask/cn2_mask_g1k_v37.fasta
-computeGCProfiles -bamFilesAreDisjoint -I
/export/storage/Nurten_SIZOFRENI/WGS/bam/2367.realigned.bam -I
/export/storage/Nurten_SIZOFRENI/WGS/bam/855.realigned.bam -runDirectory
/export/working/pinar/genomeStrip -jobLogDir
/export/working/pinar/genomeStrip/logs --disableJobReport -run
INFO 18:47:13,667 HelpFormatter - Date/Time: 2014/04/17 18:47:13
INFO 18:47:13,667 HelpFormatter -
----------------------------------------------------------------------
INFO 18:47:13,667 HelpFormatter -
----------------------------------------------------------------------
INFO 18:47:13,676 QCommandLine - Scripting SVPreprocess
INFO 18:47:13,887 QCommandLine - Added 12 functions
INFO 18:47:13,887 QGraph - Generating graph.
INFO 18:47:13,914 QGraph - Running jobs.
INFO 18:47:13,969 FunctionEdge - Starting: 'java' '-Xmx4096m'
'-XX:+UseParallelOldGC' '-XXarallelGCThreads=4' '-XX:GCTimeLimit=50'
'-XX:GCHeapFreeLimit=10'
'-Djava.io.tmpdir=/export/home/ortak/TOOLS/svtoolkit/.queue/tmp' '-cp'
'/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar'
'-cp'
'/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar'
'org.broadinstitute.sv.apps.ComputeGCProfiles' '-O'
'/export/working/pinar/genomeStrip/metadata/gcprofile/reference.gcprof.zip'
'-R' '/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta' '-md'
'/export/working/pinar/genomeStrip/metadata' '-writeReferenceProfile'
'true' '-genomeMaskFile'
'/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta'
'-copyNumberMaskFile'
'/export/working/ortak/b37_bundle_2.5/mask/cn2_mask_g1k_v37.fasta'
'-configFile' 'installtest/conf/genstrip_installtest_parameters.txt'
INFO 18:47:13,971 FunctionEdge - Output written to
/export/working/pinar/genomeStrip/logs/SVPreprocess-3.out
INFO 18:58:01,912 QGraph - 6 Pend, 1 Run, 0 Fail, 5 Done
ERROR 18:58:01,923 FunctionEdge - Error: 'java' '-Xmx4096m'
'-XX:+UseParallelOldGC' '-XXarallelGCThreads=4' '-XX:GCTimeLimit=50'
'-XX:GCHeapFreeLimit=10'
'-Djava.io.tmpdir=/export/home/ortak/TOOLS/svtoolkit/.queue/tmp' '-cp'
'/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar'
'-cp'
'/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar'
'org.broadinstitute.sv.apps.ComputeGCProfiles' '-O'
'/export/working/pinar/genomeStrip/metadata/gcprofile/reference.gcprof.zip'
'-R' '/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta' '-md'
'/export/working/pinar/genomeStrip/metadata' '-writeReferenceProfile'
'true' '-genomeMaskFile'
'/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta'
'-copyNumberMaskFile'
'/export/working/ortak/b37_bundle_2.5/mask/cn2_mask_g1k_v37.fasta'
'-configFile' 'installtest/conf/genstrip_installtest_parameters.txt'
ERROR 18:58:01,929 FunctionEdge - Contents of
/export/working/pinar/genomeStrip/logs/SVPreprocess-3.out:
INFO 18:47:21,668 HelpFormatter -
----------------------------------------------------------
INFO 18:47:21,671 HelpFormatter - Program Name:
org.broadinstitute.sv.apps.ComputeGCProfiles
INFO 18:47:21,678 HelpFormatter - Program Args: -O
/export/working/pinar/genomeStrip/metadata/gcprofile/reference.gcprof.zip
-R /export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta -md
/export/working/pinar/genomeStrip/metadata -writeReferenceProfile true
-genomeMaskFile
/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta
-copyNumberMaskFile
/export/working/ortak/b37_bundle_2.5/mask/cn2_mask_g1k_v37.fasta
-configFile installtest/conf/genstrip_installtest_parameters.txt
INFO 18:47:21,678 HelpFormatter - Date/Time: 2014/04/17 18:47:21
INFO 18:47:21,678 HelpFormatter -
----------------------------------------------------------
INFO 18:47:21,678 HelpFormatter -
----------------------------------------------------------
INFO 18:47:21,686 MetaData - Opening metadata ...
INFO 18:47:21,688 MetaData - Adding metadata directory
/export/working/pinar/genomeStrip/metadata ...
INFO 18:47:21,690 MetaData - Opened metadata.
INFO 18:47:21,690 ComputeGCProfiles - Opening reference sequence ...
INFO 18:47:21,692 ComputeGCProfiles - Opened reference sequence.
INFO 18:47:21,693 ComputeGCProfiles - Opening genome mask ...
INFO 18:47:21,694 ComputeGCProfiles - Opened genome mask.
INFO 18:47:21,694 ComputeGCProfiles - Opening copy number mask ...
INFO 18:47:21,695 ComputeGCProfiles - Opened copy number mask.
INFO 18:47:21,695 ComputeGCProfiles - Initializing algorithm ...
#INFO: ReadCountAlgorithm: detected metadata version 1, forcing legacy
behavior
INFO 18:47:21,701 MetaData - Loading insert size histograms ...
INFO 18:47:22,451 ComputeGCProfiles - Algorithm initialized.
INFO 18:47:22,452 ComputeGCProfiles - Computing reference GC profile ...
#DBG: Thu Apr 17 18:47:22 EEST 2014 computing reference profile for the
interval 1:1-249250621
#DBG: Thu Apr 17 18:48:14 EEST 2014 computing reference profile for the
interval 2:1-243199373
#DBG: Thu Apr 17 18:49:07 EEST 2014 computing reference profile for the
interval 3:1-198022430
#DBG: Thu Apr 17 18:49:49 EEST 2014 computing reference profile for the
interval 4:1-191154276
#DBG: Thu Apr 17 18:50:30 EEST 2014 computing reference profile for the
interval 5:1-180915260
#DBG: Thu Apr 17 18:51:08 EEST 2014 computing reference profile for the
interval 6:1-171115067
#DBG: Thu Apr 17 18:51:45 EEST 2014 computing reference profile for the
interval 7:1-159138663
#DBG: Thu Apr 17 18:52:18 EEST 2014 computing reference profile for the
interval 8:1-146364022
#DBG: Thu Apr 17 18:52:49 EEST 2014 computing reference profile for the
interval 9:1-141213431
#DBG: Thu Apr 17 18:53:17 EEST 2014 computing reference profile for the
interval 10:1-135534747
#DBG: Thu Apr 17 18:53:45 EEST 2014 computing reference profile for the
interval 11:1-135006516
#DBG: Thu Apr 17 18:54:14 EEST 2014 computing reference profile for the
interval 12:1-133851895
#DBG: Thu Apr 17 18:54:42 EEST 2014 computing reference profile for the
interval 13:1-115169878
#DBG: Thu Apr 17 18:55:05 EEST 2014 computing reference profile for the
interval 14:1-107349540
#DBG: Thu Apr 17 18:55:26 EEST 2014 computing reference profile for the
interval 15:1-102531392
#DBG: Thu Apr 17 18:55:46 EEST 2014 computing reference profile for the
interval 16:1-90354753
#DBG: Thu Apr 17 18:56:04 EEST 2014 computing reference profile for the
interval 17:1-81195210
#DBG: Thu Apr 17 18:56:21 EEST 2014 computing reference profile for the
interval 18:1-78077248
#DBG: Thu Apr 17 18:56:37 EEST 2014 computing reference profile for the
interval 19:1-59128983
#DBG: Thu Apr 17 18:56:49 EEST 2014 computing reference profile for the
interval 20:1-63025520
#DBG: Thu Apr 17 18:57:02 EEST 2014 computing reference profile for the
interval 21:1-48129895
#DBG: Thu Apr 17 18:57:12 EEST 2014 computing reference profile for the
interval 22:1-51304566
#DBG: Thu Apr 17 18:57:21 EEST 2014 computing reference profile for the
interval X:1-155270560
#DBG: Thu Apr 17 18:57:52 EEST 2014 computing reference profile for the
interval Y:1-59373566
#DBG: Thu Apr 17 18:58:01 EEST 2014 computing reference profile for the
interval MT:1-16569
#DBG: Thu Apr 17 18:58:01 EEST 2014 computing reference profile for the
interval GL000207.1:1-4262
Exception in thread "main" java.lang.RuntimeException: Invalid sequence
position: GL000207.1:201
at
org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:50)
at
org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245)
at
org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
at
org.broadinstitute.sv.commandline.CommandLineProgram.run(CommandLineProgram.java:25)
at
org.broadinstitute.sv.apps.ComputeGCProfiles.main(ComputeGCProfiles.java:125)
Caused by: java.lang.IllegalArgumentException: Invalid sequence position:
GL000207.1:201
at
org.broadinstitute.sv.mask.GenomeMaskFastaFile.getMaskBit(GenomeMaskFastaFile.java:80)
at
org.broadinstitute.sv.metadata.gc.GCProfileAlgorithm.computeIntervalProfile(GCProfileAlgorithm.java:332)
at
org.broadinstitute.sv.metadata.gc.GCProfileAlgorithm.computeReferenceProfileMap(GCProfileAlgorithm.java:243)
at
org.broadinstitute.sv.metadata.gc.GCProfileAlgorithm.computeReferenceProfile(GCProfileAlgorithm.java:191)
at
org.broadinstitute.sv.apps.ComputeGCProfiles.run(ComputeGCProfiles.java:172)
at
org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:39)
... 4 more
INFO 18:58:01,930 QGraph - Writing incremental jobs reports...
INFO 18:58:01,933 FunctionEdge - Starting: 'java' '-Xmx4096m'
'-XX:+UseParallelOldGC' '-XXarallelGCThreads=4' '-XX:GCTimeLimit=50'
'-XX:GCHeapFreeLimit=10'
'-Djava.io.tmpdir=/export/home/ortak/TOOLS/svtoolkit/.queue/tmp' '-cp'
'/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar'
'-cp'
'/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar'
'org.broadinstitute.sv.apps.ComputeGenomeSizes' '-O'
'/export/working/pinar/genomeStrip/metadata/genome_sizes.txt' '-R'
'/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta' '-ploidyMapFile'
'/export/working/ortak/b37_bundle_2.5/mask/humgen_g1k_v37_ploidy.map'
'-genomeMaskFile'
'/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta'
INFO 18:58:01,933 FunctionEdge - Output written to
/export/working/pinar/genomeStrip/logs/SVPreprocess-2.out
INFO 19:01:54,542 QGraph - 5 Pend, 1 Run, 1 Fail, 5 Done
ERROR 19:01:54,549 FunctionEdge - Error: 'java' '-Xmx4096m'
'-XX:+UseParallelOldGC' '-XXarallelGCThreads=4' '-XX:GCTimeLimit=50'
'-XX:GCHeapFreeLimit=10'
'-Djava.io.tmpdir=/export/home/ortak/TOOLS/svtoolkit/.queue/tmp' '-cp'
'/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar'
'-cp'
'/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar'
'org.broadinstitute.sv.apps.ComputeGenomeSizes' '-O'
'/export/working/pinar/genomeStrip/metadata/genome_sizes.txt' '-R'
'/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta' '-ploidyMapFile'
'/export/working/ortak/b37_bundle_2.5/mask/humgen_g1k_v37_ploidy.map'
'-genomeMaskFile'
'/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta'
ERROR 19:01:54,551 FunctionEdge - Contents of
/export/working/pinar/genomeStrip/logs/SVPreprocess-2.out:
INFO 18:58:09,523 HelpFormatter -
-----------------------------------------------------------
INFO 18:58:09,526 HelpFormatter - Program Name:
org.broadinstitute.sv.apps.ComputeGenomeSizes
INFO 18:58:09,533 HelpFormatter - Program Args: -O
/export/working/pinar/genomeStrip/metadata/genome_sizes.txt -R
/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta -ploidyMapFile
/export/working/ortak/b37_bundle_2.5/mask/humgen_g1k_v37_ploidy.map
-genomeMaskFile
/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta
INFO 18:58:09,534 HelpFormatter - Date/Time: 2014/04/17 18:58:09
INFO 18:58:09,534 HelpFormatter -
-----------------------------------------------------------
INFO 18:58:09,534 HelpFormatter -
-----------------------------------------------------------
INFO 18:58:09,549 ComputeGenomeSizes - Processing interval 1:1-249250621 ...
INFO 18:58:28,244 ComputeGenomeSizes - Processing interval 2:1-243199373 ...
INFO 18:58:46,064 ComputeGenomeSizes - Processing interval 3:1-198022430 ...
INFO 18:59:00,273 ComputeGenomeSizes - Processing interval 4:1-191154276 ...
INFO 18:59:14,199 ComputeGenomeSizes - Processing interval 5:1-180915260 ...
INFO 18:59:27,249 ComputeGenomeSizes - Processing interval 6:1-171115067 ...
INFO 18:59:39,596 ComputeGenomeSizes - Processing interval 7:1-159138663 ...
INFO 18:59:51,039 ComputeGenomeSizes - Processing interval 8:1-146364022 ...
INFO 19:00:01,565 ComputeGenomeSizes - Processing interval 9:1-141213431 ...
INFO 19:00:12,362 ComputeGenomeSizes - Processing interval 10:1-135534747
...
INFO 19:00:22,179 ComputeGenomeSizes - Processing interval 11:1-135006516
...
INFO 19:00:31,886 ComputeGenomeSizes - Processing interval 12:1-133851895
...
INFO 19:00:41,484 ComputeGenomeSizes - Processing interval 13:1-115169878
...
INFO 19:00:49,752 ComputeGenomeSizes - Processing interval 14:1-107349540
...
INFO 19:00:57,475 ComputeGenomeSizes - Processing interval 15:1-102531392
...
INFO 19:01:04,955 ComputeGenomeSizes - Processing interval 16:1-90354753 ...
INFO 19:01:11,456 ComputeGenomeSizes - Processing interval 17:1-81195210 ...
INFO 19:01:17,264 ComputeGenomeSizes - Processing interval 18:1-78077248 ...
INFO 19:01:23,082 ComputeGenomeSizes - Processing interval 19:1-59128983 ...
INFO 19:01:27,400 ComputeGenomeSizes - Processing interval 20:1-63025520 ...
INFO 19:01:31,924 ComputeGenomeSizes - Processing interval 21:1-48129895 ...
INFO 19:01:35,388 ComputeGenomeSizes - Processing interval 22:1-51304566 ...
INFO 19:01:39,081 ComputeGenomeSizes - Processing interval X:1-155270560 ...
INFO 19:01:50,250 ComputeGenomeSizes - Processing interval Y:1-59373566 ...
INFO 19:01:54,512 ComputeGenomeSizes - Processing interval MT:1-16569 ...
INFO 19:01:54,514 ComputeGenomeSizes - Processing interval
GL000207.1:1-4262 ...
Exception in thread "main" java.lang.RuntimeException
at
org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:50)
at
org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245)
at
org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
at
org.broadinstitute.sv.commandline.CommandLineProgram.run(CommandLineProgram.java:25)
at
org.broadinstitute.sv.apps.ComputeGenomeSizes.main(ComputeGenomeSizes.java:56)
Caused by: java.lang.NullPointerException
at
org.broadinstitute.sv.apps.ComputeGenomeSizes.run(ComputeGenomeSizes.java:74)
at
org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:39)
... 4 more
INFO 19:01:54,551 QGraph - Writing incremental jobs reports...
INFO 19:01:54,552 QGraph - 5 Pend, 0 Run, 2 Fail, 5 Done
INFO 19:01:54,555 QCommandLine - Writing final jobs report...
INFO 19:01:54,556 QCommandLine - Done with errors
INFO 19:01:54,558 QGraph - -------
INFO 19:01:54,560 QGraph - Failed: 'java' '-Xmx4096m'
'-XX:+UseParallelOldGC' '-XXarallelGCThreads=4' '-XX:GCTimeLimit=50'
'-XX:GCHeapFreeLimit=10'
'-Djava.io.tmpdir=/export/home/ortak/TOOLS/svtoolkit/.queue/tmp' '-cp'
'/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar'
'-cp'
'/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar'
'org.broadinstitute.sv.apps.ComputeGCProfiles' '-O'
'/export/working/pinar/genomeStrip/metadata/gcprofile/reference.gcprof.zip'
'-R' '/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta' '-md'
'/export/working/pinar/genomeStrip/metadata' '-writeReferenceProfile'
'true' '-genomeMaskFile'
'/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta'
'-copyNumberMaskFile'
'/export/working/ortak/b37_bundle_2.5/mask/cn2_mask_g1k_v37.fasta'
'-configFile' 'installtest/conf/genstrip_installtest_parameters.txt'
INFO 19:01:54,560 QGraph - Log:
/export/working/pinar/genomeStrip/logs/SVPreprocess-3.out
INFO 19:01:54,561 QGraph - -------
INFO 19:01:54,562 QGraph - Failed: 'java' '-Xmx4096m'
'-XX:+UseParallelOldGC' '-XXarallelGCThreads=4' '-XX:GCTimeLimit=50'
'-XX:GCHeapFreeLimit=10'
'-Djava.io.tmpdir=/export/home/ortak/TOOLS/svtoolkit/.queue/tmp' '-cp'
'/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar'
'-cp'
'/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar'
'org.broadinstitute.sv.apps.ComputeGenomeSizes' '-O'
'/export/working/pinar/genomeStrip/metadata/genome_sizes.txt' '-R'
'/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta' '-ploidyMapFile'
'/export/working/ortak/b37_bundle_2.5/mask/humgen_g1k_v37_ploidy.map'
'-genomeMaskFile'
'/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta'
INFO 19:01:54,563 QGraph - Log:
/export/working/pinar/genomeStrip/logs/SVPreprocess-2.out
INFO 19:01:54,563 QCommandLine - Script failed with 12 total jobs
|
|
From: Pinar Kavak(BİLGEM-U. <pin...@tu...> - 2014-04-17 16:28:52
|
Hi,
Sorry for re-posting the same error subject, but when I run the preprocessing step of SVToolkit, I get the same error and could not find out a solution. I use the SVToolkit version 1.04 (build 1358).
I'll appreciate any help. Thanks,
Pinar Kavak
Researcher
Turkey
Here is command and the output log file is following:
COMMAND
-----------------------------------------------------------------
SV_TMPDIR=./tmpdir
SV_TMPDIR=/tmp
IN_DIR=/export/storage
REF_DIR=/export/working/ortak/b37_bundle_2.5
runDir=/export/working/pinar/genomeStrip
sites=/export/working/pinar/genomeStrip/sizofreni.discovery.vcf
genotypes=/export/working/pinar/genomeStrip/sizofreni.genotypes.vcf
export LD_LIBRARY_PATH=${SV_DIR}/bwa:${LD_LIBRARY_PATH}
mx="-Xmx16g"
classpath="${SV_DIR}/lib/SVToolkit.jar:${SV_DIR}/lib/gatk/GenomeAnalysisTK.jar:${SV_DIR}/lib/gatk/Queue.jar"
mkdir -p ${runDir}/logs || exit 1
mkdir -p ${runDir}/metadata || exit 1
java -cp ${classpath} ${mx} -jar ${SV_DIR}/lib/SVToolkit.jar
java -cp ${classpath} ${mx} \
-Djava.io.tmpdir=${SV_TMPDIR} \
-Djava.library.path=bwa \
org.broadinstitute.sting.queue.QCommandLine \
-cp ${classpath} \
-S ${SV_DIR}/qscript/SVPreprocess.q \
-S ${SV_DIR}/qscript/SVQScript.q \
-md ${runDir}/metadata \
-configFile installtest/conf/genstrip_installtest_parameters.txt \
-tempDir ${SV_TMPDIR} \
-gatk ${SV_DIR}/lib/gatk/GenomeAnalysisTK.jar \
-R ${REF_DIR}/human_g1k_v37.fasta \
-genomeMaskFile ${REF_DIR}/mask/human_g1k_v37.mask.fasta \
-ploidyMapFile ${REF_DIR}/mask/humgen_g1k_v37_ploidy.map \
-copyNumberMaskFile ${REF_DIR}/mask/cn2_mask_g1k_v37.fasta \
-computeGCProfiles \
-bamFilesAreDisjoint \
-I ${IN_DIR}/Nurten_SIZOFRENI/WGS/bam/2367.realigned.bam \
-I ${IN_DIR}/Nurten_SIZOFRENI/WGS/bam/855.realigned.bam \
-runDirectory ${runDir} \
-jobLogDir ${runDir}/logs \
--disableJobReport \
-run
OUTPUT LOG
------------------
SVToolkit version 1.04 (build 1358)
Build date: 2014/02/13 15:47:19
Web site: http://www.broadinstitute.org/software/genomestrip
INFO 18:46:59,457 QScriptManager - Compiling 2 QScripts
INFO 18:47:13,419 QScriptManager - Compilation complete
INFO 18:47:13,665 HelpFormatter - ----------------------------------------------------------------------
INFO 18:47:13,665 HelpFormatter - Queue v2.5-2-g5671483, Compiled 2013/08/22 15:09:27
INFO 18:47:13,665 HelpFormatter - Copyright (c) 2012 The Broad Institute
INFO 18:47:13,666 HelpFormatter - For support and documentation go to http://www.broadinstitute.org/gatk
INFO 18:47:13,666 HelpFormatter - Program Args: -cp /export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar -S /export/home/ortak/TOOLS/svtoolkit/qscript/SVPreprocess.q -S /export/home/ortak/TOOLS/svtoolkit/qscript/SVQScript.q -md /export/working/pinar/genomeStrip/metadata -configFile installtest/conf/genstrip_installtest_parameters.txt -tempDir /tmp -gatk /export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar -R /export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta -genomeMaskFile /export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta -ploidyMapFile /export/working/ortak/b37_bundle_2.5/mask/humgen_g1k_v37_ploidy.map -copyNumberMaskFile /export/working/ortak/b37_bundle_2.5/mask/cn2_mask_g1k_v37.fasta -computeGCProfiles -bamFilesAreDisjoint -I /export/storage/Nurten_SIZOFRENI/WGS/bam/2367.realigned.bam -I /export/storage/Nurten_SIZOFRENI/WGS/bam/855.realigned.bam -runDirectory /export/working/pinar/genomeStrip -jobLogDir /export/working/pinar/genomeStrip/logs --disableJobReport -run
INFO 18:47:13,667 HelpFormatter - Date/Time: 2014/04/17 18:47:13
INFO 18:47:13,667 HelpFormatter - ----------------------------------------------------------------------
INFO 18:47:13,667 HelpFormatter - ----------------------------------------------------------------------
INFO 18:47:13,676 QCommandLine - Scripting SVPreprocess
INFO 18:47:13,887 QCommandLine - Added 12 functions
INFO 18:47:13,887 QGraph - Generating graph.
INFO 18:47:13,914 QGraph - Running jobs.
INFO 18:47:13,969 FunctionEdge - Starting: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/export/home/ortak/TOOLS/svtoolkit/.queue/tmp' '-cp' '/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar' '-cp' '/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.ComputeGCProfiles' '-O' '/export/working/pinar/genomeStrip/metadata/gcprofile/reference.gcprof.zip' '-R' '/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta' '-md' '/export/working/pinar/genomeStrip/metadata' '-writeReferenceProfile' 'true' '-genomeMaskFile' '/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta' '-copyNumberMaskFile' '/export/working/ortak/b37_bundle_2.5/mask/cn2_mask_g1k_v37.fasta' '-configFile' 'installtest/conf/genstrip_installtest_parameters.txt'
INFO 18:47:13,971 FunctionEdge - Output written to /export/working/pinar/genomeStrip/logs/SVPreprocess-3.out
INFO 18:58:01,912 QGraph - 6 Pend, 1 Run, 0 Fail, 5 Done
ERROR 18:58:01,923 FunctionEdge - Error: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/export/home/ortak/TOOLS/svtoolkit/.queue/tmp' '-cp' '/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar' '-cp' '/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.ComputeGCProfiles' '-O' '/export/working/pinar/genomeStrip/metadata/gcprofile/reference.gcprof.zip' '-R' '/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta' '-md' '/export/working/pinar/genomeStrip/metadata' '-writeReferenceProfile' 'true' '-genomeMaskFile' '/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta' '-copyNumberMaskFile' '/export/working/ortak/b37_bundle_2.5/mask/cn2_mask_g1k_v37.fasta' '-configFile' 'installtest/conf/genstrip_installtest_parameters.txt'
ERROR 18:58:01,929 FunctionEdge - Contents of /export/working/pinar/genomeStrip/logs/SVPreprocess-3.out:
INFO 18:47:21,668 HelpFormatter - ----------------------------------------------------------
INFO 18:47:21,671 HelpFormatter - Program Name: org.broadinstitute.sv.apps.ComputeGCProfiles
INFO 18:47:21,678 HelpFormatter - Program Args: -O /export/working/pinar/genomeStrip/metadata/gcprofile/reference.gcprof.zip -R /export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta -md /export/working/pinar/genomeStrip/metadata -writeReferenceProfile true -genomeMaskFile /export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta -copyNumberMaskFile /export/working/ortak/b37_bundle_2.5/mask/cn2_mask_g1k_v37.fasta -configFile installtest/conf/genstrip_installtest_parameters.txt
INFO 18:47:21,678 HelpFormatter - Date/Time: 2014/04/17 18:47:21
INFO 18:47:21,678 HelpFormatter - ----------------------------------------------------------
INFO 18:47:21,678 HelpFormatter - ----------------------------------------------------------
INFO 18:47:21,686 MetaData - Opening metadata ...
INFO 18:47:21,688 MetaData - Adding metadata directory /export/working/pinar/genomeStrip/metadata ...
INFO 18:47:21,690 MetaData - Opened metadata.
INFO 18:47:21,690 ComputeGCProfiles - Opening reference sequence ...
INFO 18:47:21,692 ComputeGCProfiles - Opened reference sequence.
INFO 18:47:21,693 ComputeGCProfiles - Opening genome mask ...
INFO 18:47:21,694 ComputeGCProfiles - Opened genome mask.
INFO 18:47:21,694 ComputeGCProfiles - Opening copy number mask ...
INFO 18:47:21,695 ComputeGCProfiles - Opened copy number mask.
INFO 18:47:21,695 ComputeGCProfiles - Initializing algorithm ...
#INFO: ReadCountAlgorithm: detected metadata version 1, forcing legacy behavior
INFO 18:47:21,701 MetaData - Loading insert size histograms ...
INFO 18:47:22,451 ComputeGCProfiles - Algorithm initialized.
INFO 18:47:22,452 ComputeGCProfiles - Computing reference GC profile ...
#DBG: Thu Apr 17 18:47:22 EEST 2014 computing reference profile for the interval 1:1-249250621
#DBG: Thu Apr 17 18:48:14 EEST 2014 computing reference profile for the interval 2:1-243199373
#DBG: Thu Apr 17 18:49:07 EEST 2014 computing reference profile for the interval 3:1-198022430
#DBG: Thu Apr 17 18:49:49 EEST 2014 computing reference profile for the interval 4:1-191154276
#DBG: Thu Apr 17 18:50:30 EEST 2014 computing reference profile for the interval 5:1-180915260
#DBG: Thu Apr 17 18:51:08 EEST 2014 computing reference profile for the interval 6:1-171115067
#DBG: Thu Apr 17 18:51:45 EEST 2014 computing reference profile for the interval 7:1-159138663
#DBG: Thu Apr 17 18:52:18 EEST 2014 computing reference profile for the interval 8:1-146364022
#DBG: Thu Apr 17 18:52:49 EEST 2014 computing reference profile for the interval 9:1-141213431
#DBG: Thu Apr 17 18:53:17 EEST 2014 computing reference profile for the interval 10:1-135534747
#DBG: Thu Apr 17 18:53:45 EEST 2014 computing reference profile for the interval 11:1-135006516
#DBG: Thu Apr 17 18:54:14 EEST 2014 computing reference profile for the interval 12:1-133851895
#DBG: Thu Apr 17 18:54:42 EEST 2014 computing reference profile for the interval 13:1-115169878
#DBG: Thu Apr 17 18:55:05 EEST 2014 computing reference profile for the interval 14:1-107349540
#DBG: Thu Apr 17 18:55:26 EEST 2014 computing reference profile for the interval 15:1-102531392
#DBG: Thu Apr 17 18:55:46 EEST 2014 computing reference profile for the interval 16:1-90354753
#DBG: Thu Apr 17 18:56:04 EEST 2014 computing reference profile for the interval 17:1-81195210
#DBG: Thu Apr 17 18:56:21 EEST 2014 computing reference profile for the interval 18:1-78077248
#DBG: Thu Apr 17 18:56:37 EEST 2014 computing reference profile for the interval 19:1-59128983
#DBG: Thu Apr 17 18:56:49 EEST 2014 computing reference profile for the interval 20:1-63025520
#DBG: Thu Apr 17 18:57:02 EEST 2014 computing reference profile for the interval 21:1-48129895
#DBG: Thu Apr 17 18:57:12 EEST 2014 computing reference profile for the interval 22:1-51304566
#DBG: Thu Apr 17 18:57:21 EEST 2014 computing reference profile for the interval X:1-155270560
#DBG: Thu Apr 17 18:57:52 EEST 2014 computing reference profile for the interval Y:1-59373566
#DBG: Thu Apr 17 18:58:01 EEST 2014 computing reference profile for the interval MT:1-16569
#DBG: Thu Apr 17 18:58:01 EEST 2014 computing reference profile for the interval GL000207.1:1-4262
Exception in thread "main" java.lang.RuntimeException: Invalid sequence position: GL000207.1:201
at org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:50)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
at org.broadinstitute.sv.commandline.CommandLineProgram.run(CommandLineProgram.java:25)
at org.broadinstitute.sv.apps.ComputeGCProfiles.main(ComputeGCProfiles.java:125)
Caused by: java.lang.IllegalArgumentException: Invalid sequence position: GL000207.1:201
at org.broadinstitute.sv.mask.GenomeMaskFastaFile.getMaskBit(GenomeMaskFastaFile.java:80)
at org.broadinstitute.sv.metadata.gc.GCProfileAlgorithm.computeIntervalProfile(GCProfileAlgorithm.java:332)
at org.broadinstitute.sv.metadata.gc.GCProfileAlgorithm.computeReferenceProfileMap(GCProfileAlgorithm.java:243)
at org.broadinstitute.sv.metadata.gc.GCProfileAlgorithm.computeReferenceProfile(GCProfileAlgorithm.java:191)
at org.broadinstitute.sv.apps.ComputeGCProfiles.run(ComputeGCProfiles.java:172)
at org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:39)
... 4 more
INFO 18:58:01,930 QGraph - Writing incremental jobs reports...
INFO 18:58:01,933 FunctionEdge - Starting: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/export/home/ortak/TOOLS/svtoolkit/.queue/tmp' '-cp' '/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar' '-cp' '/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.ComputeGenomeSizes' '-O' '/export/working/pinar/genomeStrip/metadata/genome_sizes.txt' '-R' '/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta' '-ploidyMapFile' '/export/working/ortak/b37_bundle_2.5/mask/humgen_g1k_v37_ploidy.map' '-genomeMaskFile' '/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta'
INFO 18:58:01,933 FunctionEdge - Output written to /export/working/pinar/genomeStrip/logs/SVPreprocess-2.out
INFO 19:01:54,542 QGraph - 5 Pend, 1 Run, 1 Fail, 5 Done
ERROR 19:01:54,549 FunctionEdge - Error: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/export/home/ortak/TOOLS/svtoolkit/.queue/tmp' '-cp' '/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar' '-cp' '/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.ComputeGenomeSizes' '-O' '/export/working/pinar/genomeStrip/metadata/genome_sizes.txt' '-R' '/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta' '-ploidyMapFile' '/export/working/ortak/b37_bundle_2.5/mask/humgen_g1k_v37_ploidy.map' '-genomeMaskFile' '/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta'
ERROR 19:01:54,551 FunctionEdge - Contents of /export/working/pinar/genomeStrip/logs/SVPreprocess-2.out:
INFO 18:58:09,523 HelpFormatter - -----------------------------------------------------------
INFO 18:58:09,526 HelpFormatter - Program Name: org.broadinstitute.sv.apps.ComputeGenomeSizes
INFO 18:58:09,533 HelpFormatter - Program Args: -O /export/working/pinar/genomeStrip/metadata/genome_sizes.txt -R /export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta -ploidyMapFile /export/working/ortak/b37_bundle_2.5/mask/humgen_g1k_v37_ploidy.map -genomeMaskFile /export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta
INFO 18:58:09,534 HelpFormatter - Date/Time: 2014/04/17 18:58:09
INFO 18:58:09,534 HelpFormatter - -----------------------------------------------------------
INFO 18:58:09,534 HelpFormatter - -----------------------------------------------------------
INFO 18:58:09,549 ComputeGenomeSizes - Processing interval 1:1-249250621 ...
INFO 18:58:28,244 ComputeGenomeSizes - Processing interval 2:1-243199373 ...
INFO 18:58:46,064 ComputeGenomeSizes - Processing interval 3:1-198022430 ...
INFO 18:59:00,273 ComputeGenomeSizes - Processing interval 4:1-191154276 ...
INFO 18:59:14,199 ComputeGenomeSizes - Processing interval 5:1-180915260 ...
INFO 18:59:27,249 ComputeGenomeSizes - Processing interval 6:1-171115067 ...
INFO 18:59:39,596 ComputeGenomeSizes - Processing interval 7:1-159138663 ...
INFO 18:59:51,039 ComputeGenomeSizes - Processing interval 8:1-146364022 ...
INFO 19:00:01,565 ComputeGenomeSizes - Processing interval 9:1-141213431 ...
INFO 19:00:12,362 ComputeGenomeSizes - Processing interval 10:1-135534747 ...
INFO 19:00:22,179 ComputeGenomeSizes - Processing interval 11:1-135006516 ...
INFO 19:00:31,886 ComputeGenomeSizes - Processing interval 12:1-133851895 ...
INFO 19:00:41,484 ComputeGenomeSizes - Processing interval 13:1-115169878 ...
INFO 19:00:49,752 ComputeGenomeSizes - Processing interval 14:1-107349540 ...
INFO 19:00:57,475 ComputeGenomeSizes - Processing interval 15:1-102531392 ...
INFO 19:01:04,955 ComputeGenomeSizes - Processing interval 16:1-90354753 ...
INFO 19:01:11,456 ComputeGenomeSizes - Processing interval 17:1-81195210 ...
INFO 19:01:17,264 ComputeGenomeSizes - Processing interval 18:1-78077248 ...
INFO 19:01:23,082 ComputeGenomeSizes - Processing interval 19:1-59128983 ...
INFO 19:01:27,400 ComputeGenomeSizes - Processing interval 20:1-63025520 ...
INFO 19:01:31,924 ComputeGenomeSizes - Processing interval 21:1-48129895 ...
INFO 19:01:35,388 ComputeGenomeSizes - Processing interval 22:1-51304566 ...
INFO 19:01:39,081 ComputeGenomeSizes - Processing interval X:1-155270560 ...
INFO 19:01:50,250 ComputeGenomeSizes - Processing interval Y:1-59373566 ...
INFO 19:01:54,512 ComputeGenomeSizes - Processing interval MT:1-16569 ...
INFO 19:01:54,514 ComputeGenomeSizes - Processing interval GL000207.1:1-4262 ...
Exception in thread "main" java.lang.RuntimeException
at org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:50)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
at org.broadinstitute.sv.commandline.CommandLineProgram.run(CommandLineProgram.java:25)
at org.broadinstitute.sv.apps.ComputeGenomeSizes.main(ComputeGenomeSizes.java:56)
Caused by: java.lang.NullPointerException
at org.broadinstitute.sv.apps.ComputeGenomeSizes.run(ComputeGenomeSizes.java:74)
at org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:39)
... 4 more
INFO 19:01:54,551 QGraph - Writing incremental jobs reports...
INFO 19:01:54,552 QGraph - 5 Pend, 0 Run, 2 Fail, 5 Done
INFO 19:01:54,555 QCommandLine - Writing final jobs report...
INFO 19:01:54,556 QCommandLine - Done with errors
INFO 19:01:54,558 QGraph - -------
INFO 19:01:54,560 QGraph - Failed: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/export/home/ortak/TOOLS/svtoolkit/.queue/tmp' '-cp' '/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar' '-cp' '/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.ComputeGCProfiles' '-O' '/export/working/pinar/genomeStrip/metadata/gcprofile/reference.gcprof.zip' '-R' '/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta' '-md' '/export/working/pinar/genomeStrip/metadata' '-writeReferenceProfile' 'true' '-genomeMaskFile' '/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta' '-copyNumberMaskFile' '/export/working/ortak/b37_bundle_2.5/mask/cn2_mask_g1k_v37.fasta' '-configFile' 'installtest/conf/genstrip_installtest_parameters.txt'
INFO 19:01:54,560 QGraph - Log: /export/working/pinar/genomeStrip/logs/SVPreprocess-3.out
INFO 19:01:54,561 QGraph - -------
INFO 19:01:54,562 QGraph - Failed: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/export/home/ortak/TOOLS/svtoolkit/.queue/tmp' '-cp' '/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar' '-cp' '/export/home/ortak/TOOLS/svtoolkit/lib/SVToolkit.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/export/home/ortak/TOOLS/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.ComputeGenomeSizes' '-O' '/export/working/pinar/genomeStrip/metadata/genome_sizes.txt' '-R' '/export/working/ortak/b37_bundle_2.5/human_g1k_v37.fasta' '-ploidyMapFile' '/export/working/ortak/b37_bundle_2.5/mask/humgen_g1k_v37_ploidy.map' '-genomeMaskFile' '/export/working/ortak/b37_bundle_2.5/mask/human_g1k_v37.mask.fasta'
INFO 19:01:54,563 QGraph - Log: /export/working/pinar/genomeStrip/logs/SVPreprocess-2.out
INFO 19:01:54,563 QCommandLine - Script failed with 12 total jobs
|
|
From: Mishra, P. <Pam...@bc...> - 2014-03-04 18:54:49
|
Hi Bob, Thanks for replying. It's WGS dara for sure and not exome. Also the coverage is 6X. There are 1576 calls and only 16 PASS calls for the 100 samples. For the 50 sub-sampled data this is the breakdown: 50 first samples: 236 deletion calls with 7 PASS calls 50 last samples : 866 calls with 7 PASS calls. The issue is not the number of calls but the samples that it picks up (with discordant pairs). The GSSAMPLES field has only 1 samples name for the last 50 sub-sampled and 2 samples for the 50 first samples. These same 2 samples appear in the complete 100 samples run. For example: 20 62949798 DEL_3987 G <DEL> . COVERAGE;DEPTH CIEND=-42,42;CIPOS=-42,42;END=62959138;GSCOHERENCE=-0.2890065636733324;GSCOHFN=-0.2890065636733324;GSCOHPVALUE=0.7447;GSCOORDS=62949527,62949709,62959226,62959343;GSDEPTHCALLTHRESHOLD=47.76261138557784;GSDEPTHNOBSSAMPLES=1;GSDEPTHNTOTALSAMPLES=1;GSDEPTHOBSSAMPLES=A00548;GSDEPTHPVALUE=3.3E-5;GSDEPTHRANKSUMPVALUE=0.8873735;GSDEPTHRATIO=1.3081478463888137;GSDMAX=9616;GSDMIN=8617;GSDOPT=9608;GSDSPAN=9516;GSMEMBNPAIRS=0;GSMEMBNSAMPLES=0;GSMEMBOBSSAMPLES=NA;GSMEMBPVALUE=NA;GSMEMBSTATISTIC=NA;GSNDEPTHCALLS=43;GSNPAIRS=2;GSNSAMPLES=1;GSOBSINREADS=246;GSOBSOUTREADS=1505009;GSOUTLEFT=1;GSOUTLIERS=1;GSOUTRIGHT=0;GSREADGROUPS=1,1;GSREADNAMES=HWI-ST1324:20:C0WACACXX:8:2106:3126:57827,HWI-ST1324:20:C0WACACXX:8:2114:9563:13653;GSSAMPLES=A00548,A00548;GSUNOBSINREADS=14652;GSUNOBSOUTREADS=117262117;IMPRECISE;SVLEN=-9608;SVTYPE=DEL This is not a PASS call site. But I see this more frequently. Here I see same 2 samples appearing again. Is this normal? Shouldn't this be able to pick up discordant pairs for the same site from other samples. These samples are pretty closely related of what I know. Is the coverage too low. But since Genome-strip was used for 1000 Genomes, which had a coverage of ~4X, I would presume it can work on a 6X. I will send you the vcf file once I get a clearance that I can send this data. Thanks, Pamela From: Bob Handsaker [mailto:han...@br...] Sent: Tuesday, March 04, 2014 8:20 AM To: svt...@li... Subject: Re: [svtoolkit-help] Regarding sample test in Genome Strip First, I want to check to make sure you are using WGS data, not exome capture. It would be quite unusual to see only 2 deletions on chr20 across 100 individuals. Are you able to share your output vcfs (e.g. one from a 100 sample run, one from a 50 sample run) that have discordant results? You can email them directly to me. Another thing to try is to genotype the sites (in all 100 samples is fine) and if you can share those results and also run PlotGenotypingResults, I can take a look and see if I can help diagnose what's wrong. Best, -Bob On 3/3/14 3:49 PM, Mishra, Pamela wrote: Hi, I am trying to find SV for 100 samples of chromosome 20. I already ran preprocessing and discovery on these samples without any error. The problem is when I look at the final vcf file, I see only 2 samples being called out having SVs in the discovery phase. I checked the logs and it looks like its reading and also making stats for all the 100 files. When I split the 100 samples in batches of 50 each (2 batches),one batch gives me the same 2 samples that show up in the 100 sample list. The other batch gives me only 1 sample. This same sample does not show any SV when its included in the 100 samples. I have done such kind of tests several times but I always find the same pattern again and again. I am not sure why this is happening. I understand there are a few filters listed here.(http://sourceforge.net/p/svtoolkit/mailman/message/28046131/) But my idea was that the samples that show discordant pairs should show up both in the list of 100 as well as when I run only 50. Could you please throw your suggestion and insight into this situation. Is there checks to be done? Any suggestion would be highly appreciated. Thanks, Pamela Mishra ------------------------------------------------------------------------------ Subversion Kills Productivity. Get off Subversion & Make the Move to Perforce. With Perforce, you get hassle-free workflows. Merge that actually works. Faster operations. Version large binaries. Built-in WAN optimization and the freedom to use Git, Perforce or both. Make the move to Perforce. http://pubads.g.doubleclick.net/gampad/clk?id=122218951&iu=/4140/ostg.clktrk _______________________________________________ svtoolkit-help mailing list svt...@li...<mailto:svt...@li...> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help |
|
From: Bob H. <han...@br...> - 2014-03-04 14:20:37
|
First, I want to check to make sure you are using WGS data, not exome capture. It would be quite unusual to see only 2 deletions on chr20 across 100 individuals. Are you able to share your output vcfs (e.g. one from a 100 sample run, one from a 50 sample run) that have discordant results? You can email them directly to me. Another thing to try is to genotype the sites (in all 100 samples is fine) and if you can share those results and also run PlotGenotypingResults, I can take a look and see if I can help diagnose what's wrong. Best, -Bob On 3/3/14 3:49 PM, Mishra, Pamela wrote: > > Hi, > > I am trying to find SV for 100 samples of chromosome 20. I already > ran preprocessing and discovery on these samples without any error. > The problem is when I look at the final vcf file, I see only 2 samples > being called out having SVs in the discovery phase. I checked the logs > and it looks like its reading and also making stats for all the 100 files. > > When I split the 100 samples in batches of 50 each (2 batches),one > batch gives me the same 2 samples that show up in the 100 sample list. > The other batch gives me only 1 sample. This same sample does not > show any SV when its included in the 100 samples. I have done such > kind of tests several times but I always find the same pattern again > and again. I am not sure why this is happening. I understand there > are a few filters listed > here.(http://sourceforge.net/p/svtoolkit/mailman/message/28046131/) > But my idea was that the samples that show discordant pairs should > show up both in the list of 100 as well as when I run only 50. Could > you please throw your suggestion and insight into this situation. Is > there checks to be done? > > Any suggestion would be highly appreciated. > > Thanks, > > Pamela Mishra > > > > ------------------------------------------------------------------------------ > Subversion Kills Productivity. Get off Subversion & Make the Move to Perforce. > With Perforce, you get hassle-free workflows. Merge that actually works. > Faster operations. Version large binaries. Built-in WAN optimization and the > freedom to use Git, Perforce or both. Make the move to Perforce. > http://pubads.g.doubleclick.net/gampad/clk?id=122218951&iu=/4140/ostg.clktrk > > > _______________________________________________ > svtoolkit-help mailing list > svt...@li... > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help |
|
From: Mishra, P. <Pam...@bc...> - 2014-03-03 21:23:30
|
Hi, I am trying to find SV for 100 samples of chromosome 20. I already ran preprocessing and discovery on these samples without any error. The problem is when I look at the final vcf file, I see only 2 samples being called out having SVs in the discovery phase. I checked the logs and it looks like its reading and also making stats for all the 100 files. When I split the 100 samples in batches of 50 each (2 batches),one batch gives me the same 2 samples that show up in the 100 sample list. The other batch gives me only 1 sample. This same sample does not show any SV when its included in the 100 samples. I have done such kind of tests several times but I always find the same pattern again and again. I am not sure why this is happening. I understand there are a few filters listed here.(http://sourceforge.net/p/svtoolkit/mailman/message/28046131/) But my idea was that the samples that show discordant pairs should show up both in the list of 100 as well as when I run only 50. Could you please throw your suggestion and insight into this situation. Is there checks to be done? Any suggestion would be highly appreciated. Thanks, Pamela Mishra |
|
From: Noll, A. <an...@cm...> - 2013-12-20 19:50:57
|
This is in response to issue # 31773145 (no e-mail has shown up in my inbox yet that I could respond to as part of the list yet?)
To answer your questions:
1) The analysis directory was clean at start of the run
2) I have seen this error on and off SGE but in all cases I was using make to kick it off
3) There was a .fail file in the metadata directory
To rule out a potential timing issue I created a new directory and then attempted to run each Preprocess step individually.
Progress was made until Preprocess step 3 where there was an error related to writing the histogram file.
I have seen this error before but mainly when more than one instance of svtoolkit was running out of the same directory. (i.e. it resolved when sequential processing was used)
For the most part everything was stable until recently migrating to the most recent version of svtoolkit...
Error text is at top and entire log below that.
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR stack trace
java.lang.RuntimeException: Error writing to histogram file: /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/simHetHomoTest2/metadata/isd/sampleC_7723_del_40.align.sorted.hist.bin
at org.broadinstitute.sv.metadata.isize.ComputeInsertSizeHistogramsWalker.onTraversalDone(ComputeInsertSizeHistogramsWalker.java:75)
at org.broadinstitute.sv.metadata.isize.ComputeInsertSizeHistogramsWalker.onTraversalDone(ComputeInsertSizeHistogramsWalker.java:26)
at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:123)
at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:286)
at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:125)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:79)
at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:59)
Caused by: java.io.FileNotFoundException: /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/simHetHomoTest2/metadata/isd/sampleC_7723_del_40.align.sorted.hist.bin (No such file or directory)
at java.io.FileOutputStream.open(Native Method)
at java.io.FileOutputStream.<init>(FileOutputStream.java:212)
at org.broadinstitute.sv.metadata.isize.InsertSizeHistogramFile.addHistogram(InsertSizeHistogramFile.java:58)
at org.broadinstitute.sv.metadata.isize.ComputeInsertSizeHistogramsWalker.onTraversalDone(ComputeInsertSizeHistogramsWalker.java:71)
... 10 more
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A GATK RUNTIME ERROR has occurred (version 2.5-2-g5671483):
##### ERROR
##### ERROR Please check the documentation guide to see if this is a known problem
##### ERROR If not, please post the error, with stack trace, to the GATK forum
##### ERROR Visit our website and forum for extensive documentation and answers to
##### ERROR commonly asked questions http://www.broadinstitute.org/gatk
##### ERROR
##### ERROR MESSAGE: Error writing to histogram file: /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/simHetHomoTest2/metadata/isd/sampleC_7723_del_40.align.sorted.hist.bin
##### ERROR ------------------------------------------------------------------------------------------
INFO 12:45:09,420 HelpFormatter - ----------------------------------------------------------------
INFO 12:45:09,423 HelpFormatter - Program Name: org.broadinstitute.sv.apps.CreateMetaDataDirectory
DEBUG 12:45:09,423 HelpFormatter - Current directory: /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit
INFO 12:45:09,429 HelpFormatter - Program Args: -l DEBUG -md /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/simHetHomoTest2/metadata
INFO 12:45:09,429 HelpFormatter - Date/Time: 2013/12/20 12:45:09
INFO 12:45:09,429 HelpFormatter - ----------------------------------------------------------------
INFO 12:45:09,429 HelpFormatter - ----------------------------------------------------------------
INFO 12:45:09,465 MetaData - Opening metadata ...
INFO 12:45:09,465 MetaData - Adding metadata directory /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/simHetHomoTest2/metadata ...
INFO 12:45:09,466 MetaData - Opened metadata.
INFO 12:45:09,470 CommandLineProgram - Program completed.
INFO 12:46:18,134 HelpFormatter - -----------------------------------------------------------
INFO 12:46:18,136 HelpFormatter - Program Name: org.broadinstitute.sv.apps.ComputeGenomeSizes
INFO 12:46:18,139 HelpFormatter - Program Args: -O /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/simHetHomoTest2/metadata/genome_sizes.txt -R /home/anoll/sim/genomeSim/fasta/homo.sapiens.GRCh37.fa -ploidyMapFile /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/data/humgen_g1k_v37_ploidy.map -genomeMaskFile /home/anoll/sim/genomeSim/fasta/homo.sapiens.GRCh37.fa
INFO 12:46:18,140 HelpFormatter - Date/Time: 2013/12/20 12:46:18
INFO 12:46:18,140 HelpFormatter - -----------------------------------------------------------
INFO 12:46:18,140 HelpFormatter - -----------------------------------------------------------
INFO 12:46:18,147 ComputeGenomeSizes - Processing interval 10:1-135534747 ...
INFO 12:46:24,128 ComputeGenomeSizes - Processing interval 11:1-135006516 ...
INFO 12:46:29,681 ComputeGenomeSizes - Processing interval 12:1-133851895 ...
INFO 12:46:35,197 ComputeGenomeSizes - Processing interval 13:1-115169878 ...
INFO 12:46:39,973 ComputeGenomeSizes - Processing interval 14:1-107349540 ...
INFO 12:46:44,384 ComputeGenomeSizes - Processing interval 15:1-102531392 ...
INFO 12:46:48,623 ComputeGenomeSizes - Processing interval 16:1-90354753 ...
INFO 12:46:52,361 ComputeGenomeSizes - Processing interval 17:1-81195210 ...
INFO 12:46:55,680 ComputeGenomeSizes - Processing interval 18:1-78077248 ...
INFO 12:46:58,827 ComputeGenomeSizes - Processing interval 19:1-59128983 ...
INFO 12:47:01,193 ComputeGenomeSizes - Processing interval 1:1-249250621 ...
INFO 12:47:11,238 ComputeGenomeSizes - Processing interval 20:1-63025520 ...
INFO 12:47:13,750 ComputeGenomeSizes - Processing interval 21:1-48129895 ...
INFO 12:47:15,676 ComputeGenomeSizes - Processing interval 22:1-51304566 ...
INFO 12:47:17,714 ComputeGenomeSizes - Processing interval 2:1-243199373 ...
INFO 12:47:27,781 ComputeGenomeSizes - Processing interval 3:1-198022430 ...
INFO 12:47:35,980 ComputeGenomeSizes - Processing interval 4:1-191154276 ...
INFO 12:47:43,879 ComputeGenomeSizes - Processing interval 5:1-180915260 ...
INFO 12:47:51,341 ComputeGenomeSizes - Processing interval 6:1-171115067 ...
INFO 12:47:58,481 ComputeGenomeSizes - Processing interval 7:1-159138663 ...
INFO 12:48:05,076 ComputeGenomeSizes - Processing interval 8:1-146364022 ...
INFO 12:48:11,058 ComputeGenomeSizes - Processing interval 9:1-141213431 ...
INFO 12:48:16,863 ComputeGenomeSizes - Processing interval X:1-155270560 ...
INFO 12:48:23,330 ComputeGenomeSizes - Processing interval Y:1-59373566 ...
INFO 12:48:25,831 ComputeGenomeSizes - maskedSizeMale=5979749735; maskedSizeFemale=6072607692
INFO 12:48:25,831 ComputeGenomeSizes - nonGapSizeMale=5545900142; nonGapSizeFemale=5671347136
INFO 12:48:25,919 CommandLineProgram - Program completed.
INFO 12:51:04,066 HelpFormatter - --------------------------------------------------------------------------------
INFO 12:51:04,068 HelpFormatter - The Genome Analysis Toolkit (GATK) v2.5-2-g5671483, Compiled 2013/09/01 11:04:38
INFO 12:51:04,068 HelpFormatter - Copyright (c) 2010 The Broad Institute
INFO 12:51:04,068 HelpFormatter - For support and documentation go to http://www.broadinstitute.org/gatk
INFO 12:51:04,072 HelpFormatter - Program Args: -T ComputeInsertSizeHistogramsWalker -R /home/anoll/sim/genomeSim/fasta/homo.sapiens.GRCh37.fa -O /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/simHetHomoTest2/metadata/isd/sampleC_7723_del_40.align.sorted.hist.bin -disableGATKTraversal true -md /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/simHetHomoTest2/metadata -createEmpty
INFO 12:51:04,072 HelpFormatter - Date/Time: 2013/12/20 12:51:04
INFO 12:51:04,072 HelpFormatter - --------------------------------------------------------------------------------
INFO 12:51:04,072 HelpFormatter - --------------------------------------------------------------------------------
INFO 12:51:04,203 GenomeAnalysisEngine - Strictness is SILENT
INFO 12:51:04,293 GenomeAnalysisEngine - Downsampling Settings: No downsampling
INFO 12:51:04,353 GenomeAnalysisEngine - Creating shard strategy for 0 BAM files
INFO 12:51:04,401 GenomeAnalysisEngine - Done creating shard strategy
INFO 12:51:04,401 ProgressMeter - [INITIALIZATION COMPLETE; STARTING PROCESSING]
INFO 12:51:04,401 ProgressMeter - Location processed.reads runtime per.1M.reads completed total.runtime remaining
INFO 12:51:04,402 MetaData - Opening metadata ...
INFO 12:51:04,403 MetaData - Adding metadata directory /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/simHetHomoTest2/metadata ...
INFO 12:51:04,404 MetaData - Opened metadata.
INFO 12:51:34,406 ProgressMeter - Starting 0.00e+00 30.0 s 49.6 w 100.0% 30.0 s 0.0 s
INFO 12:52:04,408 ProgressMeter - Starting 0.00e+00 60.0 s 99.2 w 100.0% 60.0 s 0.0 s
INFO 12:52:34,410 ProgressMeter - Starting 0.00e+00 90.0 s 148.8 w 100.0% 90.0 s 0.0 s
INFO 12:53:04,411 ProgressMeter - Starting 0.00e+00 120.0 s 198.4 w 100.0% 120.0 s 0.0 s
INFO 12:53:34,412 ProgressMeter - Starting 0.00e+00 2.5 m 248.0 w 100.0% 2.5 m 0.0 s
INFO 12:54:04,414 ProgressMeter - Starting 0.00e+00 3.0 m 297.6 w 100.0% 3.0 m 0.0 s
INFO 12:54:34,415 ProgressMeter - Starting 0.00e+00 3.5 m 347.2 w 100.0% 3.5 m 0.0 s
INFO 12:55:04,417 ProgressMeter - Starting 0.00e+00 4.0 m 396.9 w 100.0% 4.0 m 0.0 s
INFO 12:55:34,418 ProgressMeter - Starting 0.00e+00 4.5 m 446.5 w 100.0% 4.5 m 0.0 s
INFO 12:56:04,419 ProgressMeter - Starting 0.00e+00 5.0 m 496.1 w 100.0% 5.0 m 0.0 s
INFO 12:56:34,421 ProgressMeter - Starting 0.00e+00 5.5 m 545.7 w 100.0% 5.5 m 0.0 s
INFO 12:57:04,422 ProgressMeter - Starting 0.00e+00 6.0 m 595.3 w 100.0% 6.0 m 0.0 s
INFO 12:57:34,424 ProgressMeter - Starting 0.00e+00 6.5 m 644.9 w 100.0% 6.5 m 0.0 s
INFO 12:58:04,425 ProgressMeter - Starting 0.00e+00 7.0 m 694.5 w 100.0% 7.0 m 0.0 s
INFO 12:58:34,426 ProgressMeter - Starting 0.00e+00 7.5 m 744.1 w 100.0% 7.5 m 0.0 s
INFO 12:59:04,427 ProgressMeter - Starting 0.00e+00 8.0 m 793.7 w 100.0% 8.0 m 0.0 s
INFO 12:59:34,428 ProgressMeter - Starting 0.00e+00 8.5 m 843.3 w 100.0% 8.5 m 0.0 s
INFO 13:00:04,430 ProgressMeter - Starting 0.00e+00 9.0 m 892.9 w 100.0% 9.0 m 0.0 s
INFO 13:00:34,431 ProgressMeter - Starting 0.00e+00 9.5 m 942.5 w 100.0% 9.5 m 0.0 s
INFO 13:01:04,434 ProgressMeter - Starting 0.00e+00 10.0 m 992.1 w 100.0% 10.0 m 0.0 s
INFO 13:01:34,435 ProgressMeter - Starting 0.00e+00 10.5 m 1041.7 w 100.0% 10.5 m 0.0 s
INFO 13:02:04,436 ProgressMeter - Starting 0.00e+00 11.0 m 1091.3 w 100.0% 11.0 m 0.0 s
INFO 13:02:34,437 ProgressMeter - Starting 0.00e+00 11.5 m 1140.9 w 100.0% 11.5 m 0.0 s
INFO 13:03:04,438 ProgressMeter - Starting 0.00e+00 12.0 m 1190.5 w 100.0% 12.0 m 0.0 s
INFO 13:03:34,441 ProgressMeter - Starting 0.00e+00 12.5 m 1240.1 w 100.0% 12.5 m 0.0 s
INFO 13:04:04,442 ProgressMeter - Starting 0.00e+00 13.0 m 1289.8 w 100.0% 13.0 m 0.0 s
INFO 13:04:34,443 ProgressMeter - Starting 0.00e+00 13.5 m 1339.4 w 100.0% 13.5 m 0.0 s
INFO 13:05:04,445 ProgressMeter - Starting 0.00e+00 14.0 m 1389.0 w 100.0% 14.0 m 0.0 s
INFO 13:05:34,446 ProgressMeter - Starting 0.00e+00 14.5 m 1438.6 w 100.0% 14.5 m 0.0 s
INFO 13:06:04,447 ProgressMeter - Starting 0.00e+00 15.0 m 1488.2 w 100.0% 15.0 m 0.0 s
INFO 13:06:34,448 ProgressMeter - Starting 0.00e+00 15.5 m 1537.8 w 100.0% 15.5 m 0.0 s
INFO 13:07:04,449 ProgressMeter - Starting 0.00e+00 16.0 m 1587.4 w 100.0% 16.0 m 0.0 s
INFO 13:07:34,450 ProgressMeter - Starting 0.00e+00 16.5 m 1637.0 w 100.0% 16.5 m 0.0 s
INFO 13:08:04,451 ProgressMeter - Starting 0.00e+00 17.0 m 1686.6 w 100.0% 17.0 m 0.0 s
INFO 13:08:34,452 ProgressMeter - Starting 0.00e+00 17.5 m 1736.2 w 100.0% 17.5 m 0.0 s
INFO 13:09:04,453 ProgressMeter - Starting 0.00e+00 18.0 m 1785.8 w 100.0% 18.0 m 0.0 s
INFO 13:09:34,454 ProgressMeter - Starting 0.00e+00 18.5 m 1835.4 w 100.0% 18.5 m 0.0 s
INFO 13:10:04,455 ProgressMeter - Starting 0.00e+00 19.0 m 1885.0 w 100.0% 19.0 m 0.0 s
INFO 13:10:34,456 ProgressMeter - Starting 0.00e+00 19.5 m 1934.6 w 100.0% 19.5 m 0.0 s
INFO 13:11:04,457 ProgressMeter - Starting 0.00e+00 20.0 m 1984.2 w 100.0% 20.0 m 0.0 s
INFO 13:11:34,458 ProgressMeter - Starting 0.00e+00 20.5 m 2033.8 w 100.0% 20.5 m 0.0 s
INFO 13:12:04,459 ProgressMeter - Starting 0.00e+00 21.0 m 2083.4 w 100.0% 21.0 m 0.0 s
INFO 13:12:34,460 ProgressMeter - Starting 0.00e+00 21.5 m 2133.0 w 100.0% 21.5 m 0.0 s
INFO 13:13:04,461 ProgressMeter - Starting 0.00e+00 22.0 m 2182.6 w 100.0% 22.0 m 0.0 s
INFO 13:13:34,462 ProgressMeter - Starting 0.00e+00 22.5 m 2232.2 w 100.0% 22.5 m 0.0 s
INFO 13:14:04,464 ProgressMeter - Starting 0.00e+00 23.0 m 2281.8 w 100.0% 23.0 m 0.0 s
INFO 13:14:34,465 ProgressMeter - Starting 0.00e+00 23.5 m 2331.5 w 100.0% 23.5 m 0.0 s
INFO 13:15:04,466 ProgressMeter - Starting 0.00e+00 24.0 m 2381.1 w 100.0% 24.0 m 0.0 s
INFO 13:15:34,467 ProgressMeter - Starting 0.00e+00 24.5 m 2430.7 w 100.0% 24.5 m 0.0 s
INFO 13:16:04,468 ProgressMeter - Starting 0.00e+00 25.0 m 2480.3 w 100.0% 25.0 m 0.0 s
INFO 13:16:34,469 ProgressMeter - Starting 0.00e+00 25.5 m 2529.9 w 100.0% 25.5 m 0.0 s
INFO 13:17:04,470 ProgressMeter - Starting 0.00e+00 26.0 m 2579.5 w 100.0% 26.0 m 0.0 s
INFO 13:17:34,472 ProgressMeter - Starting 0.00e+00 26.5 m 2629.1 w 100.0% 26.5 m 0.0 s
INFO 13:18:04,473 ProgressMeter - Starting 0.00e+00 27.0 m 2678.7 w 100.0% 27.0 m 0.0 s
INFO 13:18:34,474 ProgressMeter - Starting 0.00e+00 27.5 m 2728.3 w 100.0% 27.5 m 0.0 s
INFO 13:19:04,475 ProgressMeter - Starting 0.00e+00 28.0 m 2777.9 w 100.0% 28.0 m 0.0 s
INFO 13:19:34,476 ProgressMeter - Starting 0.00e+00 28.5 m 2827.5 w 100.0% 28.5 m 0.0 s
INFO 13:20:04,477 ProgressMeter - Starting 0.00e+00 29.0 m 2877.1 w 100.0% 29.0 m 0.0 s
INFO 13:20:34,478 ProgressMeter - Starting 0.00e+00 29.5 m 2926.7 w 100.0% 29.5 m 0.0 s
INFO 13:21:04,479 ProgressMeter - Starting 0.00e+00 30.0 m 2976.3 w 100.0% 30.0 m 0.0 s
INFO 13:21:34,480 ProgressMeter - Starting 0.00e+00 30.5 m 3025.9 w 100.0% 30.5 m 0.0 s
INFO 13:22:04,484 ProgressMeter - Starting 0.00e+00 31.0 m 3075.5 w 100.0% 31.0 m 0.0 s
INFO 13:22:34,485 ProgressMeter - Starting 0.00e+00 31.5 m 3125.1 w 100.0% 31.5 m 0.0 s
INFO 13:23:04,486 ProgressMeter - Starting 0.00e+00 32.0 m 3174.7 w 100.0% 32.0 m 0.0 s
INFO 13:23:34,488 ProgressMeter - Starting 0.00e+00 32.5 m 3224.3 w 100.0% 32.5 m 0.0 s
INFO 13:24:04,489 ProgressMeter - Starting 0.00e+00 33.0 m 3274.0 w 100.0% 33.0 m 0.0 s
INFO 13:24:34,490 ProgressMeter - Starting 0.00e+00 33.5 m 3323.6 w 100.0% 33.5 m 0.0 s
INFO 13:24:58,780 GATKRunReport - Uploaded run statistics report to AWS S3
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR stack trace
java.lang.RuntimeException: Error writing to histogram file: /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/simHetHomoTest2/metadata/isd/sampleC_7723_del_40.align.sorted.hist.bin
at org.broadinstitute.sv.metadata.isize.ComputeInsertSizeHistogramsWalker.onTraversalDone(ComputeInsertSizeHistogramsWalker.java:75)
at org.broadinstitute.sv.metadata.isize.ComputeInsertSizeHistogramsWalker.onTraversalDone(ComputeInsertSizeHistogramsWalker.java:26)
at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:123)
at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:286)
at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:125)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:79)
at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:59)
Caused by: java.io.FileNotFoundException: /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/simHetHomoTest2/metadata/isd/sampleC_7723_del_40.align.sorted.hist.bin (No such file or directory)
at java.io.FileOutputStream.open(Native Method)
at java.io.FileOutputStream.<init>(FileOutputStream.java:212)
at org.broadinstitute.sv.metadata.isize.InsertSizeHistogramFile.addHistogram(InsertSizeHistogramFile.java:58)
at org.broadinstitute.sv.metadata.isize.ComputeInsertSizeHistogramsWalker.onTraversalDone(ComputeInsertSizeHistogramsWalker.java:71)
... 10 more
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A GATK RUNTIME ERROR has occurred (version 2.5-2-g5671483):
##### ERROR
##### ERROR Please check the documentation guide to see if this is a known problem
##### ERROR If not, please post the error, with stack trace, to the GATK forum
##### ERROR Visit our website and forum for extensive documentation and answers to
##### ERROR commonly asked questions http://www.broadinstitute.org/gatk
##### ERROR
##### ERROR MESSAGE: Error writing to histogram file: /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/simHetHomoTest2/metadata/isd/sampleC_7723_del_40.align.sorted.hist.bin
##### ERROR ------------------------------------------------------------------------------------------
________________________________
Electronic mail from Children's Mercy Hospitals and Clinics. This communication is intended only for the use of the addressee. It may contain information that is privileged or confidential under applicable law. If you are not the intended recipient or the agent of the recipient, you are hereby notified that any dissemination, copy or disclosure of this communication is strictly prohibited. If you have received this communication in error, please immediately forward the message to Children's Mercy Hospital's Information Security Officer via return electronic mail at inf...@cm... and expunge this communication without making any copies. Thank you for your cooperation.
|
|
From: Bob H. <han...@br...> - 2013-12-20 17:47:57
|
That is odd - I don't have any easy explanation. And I haven't seen this or gotten any similar reports. Are you using a clean run directory (as opposed to trying to use the run directory already used by another run, like installtest)? You need to use a clean run directory for every run (and also in most cases if you change the input parameters). Are you running through LSF, SGE or some other load manager or just running serially (i.e. without -bsub)? It seems like somehow Queue is seeing a non-zero exit status from the process, even though it completed successfully. Did Queue create an .<output-file>.done sentinel file for these two output (e.g. metadata/.depth.dat.done) ? Is there a metadata/.depth.dat.fail ? -Bob On 12/20/13 12:13 PM, Noll, Aaron wrote: > > Hello, > > I am trying to use genomeStrip to identify known CNVs in a simulated > dataset. > > I have had success with the installTest so believe that svtoolkit is > properly installed/configured. > > When running the preprocess steps on my bam file I see an Error for > the 8^th step but no further information is provided. As you can see > the log file for that step only has "INFO" lines. > > This also occurs for the 9^th step. (pasted farther down) > > When I attempt to run these steps individually after getting these > errors there is no sign of any issues. > > I turned on the jobReports option but the output wasn't helpful. > > Any ideas on how to debug this, should I ignore these errors? > > Thanks, > > Aaron > > INFO 08:49:52,546 QGraph - 3 Pend, 2 Run, 0 Fail, 7 Done > > ERROR 08:49:52,558 FunctionEdge - Error: 'java' '-Xmx4096m' > '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' > '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' > '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > 'org.broadinstitute.sv.apps.MergeReadDepthCoverage' '-I' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth/sampleC_7723_del_40.align.sorted.depth.txt' > '-O' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth.dat' > > ERROR 08:49:52,563 FunctionEdge - Contents of > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-8.out: > > INFO 08:16:16,570 HelpFormatter - > --------------------------------------------------------------- > > INFO 08:16:16,572 HelpFormatter - Program Name: > org.broadinstitute.sv.apps.MergeReadDepthCoverage > > INFO 08:16:16,576 HelpFormatter - Program Args: -I > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth/sampleC_7723_del_40.align.sorted.depth.txt > -O > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth.dat > > INFO 08:16:16,576 HelpFormatter - Date/Time: 2013/12/20 08:16:16 > > INFO 08:16:16,577 HelpFormatter - > --------------------------------------------------------------- > > INFO 08:16:16,577 HelpFormatter - > --------------------------------------------------------------- > > INFO 08:16:16,585 CommandLineProgram - Program completed. > > INFO 08:49:52,571 FunctionEdge - Done: 'java' '-Xmx4096m' > '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' > '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' > '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > org.broadinstitute.sv.main.SVCommandLine '-T' > 'ComputeReadSpanCoverageWalker' '-R' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/data/human_b36_chr1.fasta' > '-I' > '/home/anoll/sim/readSim/wgsim/sampleC_7723_del_40.align.sorted.bam' > '-O' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans/sampleC_7723_del_40.align.sorted.spans.txt' > '-disableGATKTraversal' 'true' '-md' 'test1/metadata' > '-maxInsertSizeStandardDeviations' '3' > > INFO 08:49:52,571 QGraph - Writing incremental jobs reports... > > INFO 08:49:52,574 FunctionEdge - Starting: 'java' '-Xmx4096m' > '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' > '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' > '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > 'org.broadinstitute.sv.apps.MergeReadSpanCoverage' '-I' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans/sampleC_7723_del_40.align.sorted.spans.txt' > '-O' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans.dat' > > INFO 08:49:52,575 FunctionEdge - Output written to > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-10.out > > INFO 08:49:57,940 FunctionEdge - Starting: 'java' '-Xmx4096m' > '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' > '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' > '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > org.broadinstitute.sv.main.SVCommandLine '-T' > 'ComputeGCProfileWalker' '-R' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/data/human_b36_chr1.fasta' > '-I' > '/home/anoll/sim/readSim/wgsim/sampleC_7723_del_40.align.sorted.bam' > '-O' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofile/sampleC_7723_del_40.align.sorted.bam.gcprof.zip' > '-disableGATKTraversal' 'true' '-md' 'test1/metadata' > '-referenceProfile' 'test1/metadata/gcprofile/reference.gcprof.zip' > '-genomeMaskFile' 'data/human_b36_chr1.mask.fasta' > '-copyNumberMaskFile' 'data/cn2_mask_g1k_b36_chr1.fasta' > '-insertSizeRadius' '10.0' > > INFO 08:49:57,940 FunctionEdge - Output written to > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-11.out > > INFO 09:14:22,959 QGraph - 1 Pend, 2 Run, 1 Fail, 8 Done > > INFO 08:16:16,598 FunctionEdge - Output written to > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-9.out > > INFO 08:49:52,546 QGraph - 3 Pend, 2 Run, 0 Fail, 7 Done > > ERROR 08:49:52,558 FunctionEdge - Error: 'java' '-Xmx4096m' > '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' > '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' > '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > 'org.broadinstitute.sv.apps.MergeReadDepthCoverage' '-I' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth/sampleC_7723_del_40.align.sorted.depth.txt' > '-O' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth.dat' > > ERROR 08:49:52,563 FunctionEdge - Contents of > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-8.out: > > INFO 08:16:16,570 HelpFormatter - > --------------------------------------------------------------- > > INFO 08:16:16,572 HelpFormatter - Program Name: > org.broadinstitute.sv.apps.MergeReadDepthCoverage > > INFO 08:16:16,576 HelpFormatter - Program Args: -I > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth/sampleC_7723_del_40.align.sorted.depth.txt > -O > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth.dat > > INFO 08:16:16,576 HelpFormatter - Date/Time: 2013/12/20 08:16:16 > > INFO 08:16:16,577 HelpFormatter - > --------------------------------------------------------------- > > INFO 08:16:16,577 HelpFormatter - > --------------------------------------------------------------- > > INFO 08:16:16,585 CommandLineProgram - Program completed. > > INFO 08:49:52,571 FunctionEdge - Done: 'java' '-Xmx4096m' > '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' > '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' > '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > org.broadinstitute.sv.main.SVCommandLine '-T' > 'ComputeReadSpanCoverageWalker' '-R' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/data/human_b36_chr1.fasta' > '-I' > '/home/anoll/sim/readSim/wgsim/sampleC_7723_del_40.align.sorted.bam' > '-O' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans/sampleC_7723_del_40.align.sorted.spans.txt' > '-disableGATKTraversal' 'true' '-md' 'test1/metadata' > '-maxInsertSizeStandardDeviations' '3' > > INFO 08:49:52,571 QGraph - Writing incremental jobs reports... > > INFO 08:49:52,574 FunctionEdge - Starting: 'java' '-Xmx4096m' > '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' > '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' > '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > 'org.broadinstitute.sv.apps.MergeReadSpanCoverage' '-I' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans/sampleC_7723_del_40.align.sorted.spans.txt' > '-O' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans.dat' > > INFO 08:49:52,575 FunctionEdge - Output written to > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-10.out > > INFO 08:49:57,940 FunctionEdge - Starting: 'java' '-Xmx4096m' > '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' > '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' > '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > org.broadinstitute.sv.main.SVCommandLine '-T' > 'ComputeGCProfileWalker' '-R' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/data/human_b36_chr1.fasta' > '-I' > '/home/anoll/sim/readSim/wgsim/sampleC_7723_del_40.align.sorted.bam' > '-O' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofile/sampleC_7723_del_40.align.sorted.bam.gcprof.zip' > '-disableGATKTraversal' 'true' '-md' 'test1/metadata' > '-referenceProfile' 'test1/metadata/gcprofile/reference.gcprof.zip' > '-genomeMaskFile' 'data/human_b36_chr1.mask.fasta' > '-copyNumberMaskFile' 'data/cn2_mask_g1k_b36_chr1.fasta' > '-insertSizeRadius' '10.0' > > INFO 08:49:57,940 FunctionEdge - Output written to > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-11.out > > INFO 09:14:22,959 QGraph - 1 Pend, 2 Run, 1 Fail, 8 Done > > ERROR 09:14:22,971 FunctionEdge - Error: 'java' '-Xmx4096m' > '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' > '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' > '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > 'org.broadinstitute.sv.apps.MergeReadSpanCoverage' '-I' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans/sampleC_7723_del_40.align.sorted.spans.txt' > '-O' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans.dat' > > ERROR 09:14:22,973 FunctionEdge - Contents of > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-10.out: > > INFO 08:49:57,915 HelpFormatter - > -------------------------------------------------------------- > > INFO 08:49:57,917 HelpFormatter - Program Name: > org.broadinstitute.sv.apps.MergeReadSpanCoverage > > INFO 08:49:57,920 HelpFormatter - Program Args: -I > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans/sampleC_7723_del_40.align.sorted.spans.txt > -O > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans.dat > > INFO 08:49:57,921 HelpFormatter - Date/Time: 2013/12/20 08:49:57 > > INFO 08:49:57,921 HelpFormatter - > -------------------------------------------------------------- > > INFO 08:49:57,921 HelpFormatter - > -------------------------------------------------------------- > > INFO 08:49:57,927 CommandLineProgram - Program completed. > > INFO 09:14:22,987 FunctionEdge - Done: 'java' '-Xmx4096m' > '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' > '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' > '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > org.broadinstitute.sv.main.SVCommandLine '-T' > 'ComputeGCProfileWalker' '-R' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/data/human_b36_chr1.fasta' > '-I' > '/home/anoll/sim/readSim/wgsim/sampleC_7723_del_40.align.sorted.bam' > '-O' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofile/sampleC_7723_del_40.align.sorted.bam.gcprof.zip' > '-disableGATKTraversal' 'true' '-md' 'test1/metadata' > '-referenceProfile' 'test1/metadata/gcprofile/reference.gcprof.zip' > '-genomeMaskFile' 'data/human_b36_chr1.mask.fasta' > '-copyNumberMaskFile' 'data/cn2_mask_g1k_b36_chr1.fasta' > '-insertSizeRadius' '10.0' > > INFO 09:14:22,988 QGraph - Writing incremental jobs reports... > > INFO 09:14:22,991 FunctionEdge - Starting: 'java' '-Xmx4096m' > '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' > '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' > '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > 'org.broadinstitute.sv.apps.MergeGCProfiles' '-I' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofile/sampleC_7723_del_40.align.sorted.bam.gcprof.zip' > '-O' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofiles.zip' > > INFO 09:14:22,991 FunctionEdge - Output written to > /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-12.out > > INFO 09:14:28,331 QGraph - 0 Pend, 1 Run, 2 Fail, 9 Done > > INFO 09:14:52,970 FunctionEdge - Done: 'java' '-Xmx4096m' > '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' > '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' > '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > '-cp' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' > 'org.broadinstitute.sv.apps.MergeGCProfiles' '-I' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofile/sampleC_7723_del_40.align.sorted.bam.gcprof.zip' > '-O' > '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofiles.zip' > > INFO 09:14:52,971 QGraph - Writing incremental jobs reports... > > INFO 09:14:52,972 QGraph - 0 Pend, 0 Run, 2 Fail, 10 Done > > INFO 09:14:52,974 QCommandLine - Writing final jobs report... > > > ------------------------------------------------------------------------ > Electronic mail from Children's Mercy Hospitals and Clinics. This > communication is intended only for the use of the addressee. It may > contain information that is privileged or confidential under > applicable law. If you are not the intended recipient or the agent of > the recipient, you are hereby notified that any dissemination, copy or > disclosure of this communication is strictly prohibited. If you have > received this communication in error, please immediately forward the > message to Children's Mercy Hospital's Information Security Officer > via return electronic mail at inf...@cm... and > expunge this communication without making any copies. Thank you for > your cooperation. > > > ------------------------------------------------------------------------------ > Rapidly troubleshoot problems before they affect your business. Most IT > organizations don't have a clear picture of how application performance > affects their revenue. With AppDynamics, you get 100% visibility into your > Java,.NET, & PHP application. Start your 15-day FREE TRIAL of AppDynamics Pro! > http://pubads.g.doubleclick.net/gampad/clk?id=84349831&iu=/4140/ostg.clktrk > > > _______________________________________________ > svtoolkit-help mailing list > svt...@li... > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help |
|
From: Noll, A. <an...@cm...> - 2013-12-20 17:34:13
|
Hello, I am trying to use genomeStrip to identify known CNVs in a simulated dataset. I have had success with the installTest so believe that svtoolkit is properly installed/configured. When running the preprocess steps on my bam file I see an Error for the 8th step but no further information is provided. As you can see the log file for that step only has "INFO" lines. This also occurs for the 9th step. (pasted farther down) When I attempt to run these steps individually after getting these errors there is no sign of any issues. I turned on the jobReports option but the output wasn't helpful. Any ideas on how to debug this, should I ignore these errors? Thanks, Aaron INFO 08:49:52,546 QGraph - 3 Pend, 2 Run, 0 Fail, 7 Done ERROR 08:49:52,558 FunctionEdge - Error: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.MergeReadDepthCoverage' '-I' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth/sampleC_7723_del_40.align.sorted.depth.txt' '-O' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth.dat' ERROR 08:49:52,563 FunctionEdge - Contents of /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-8.out: INFO 08:16:16,570 HelpFormatter - --------------------------------------------------------------- INFO 08:16:16,572 HelpFormatter - Program Name: org.broadinstitute.sv.apps.MergeReadDepthCoverage INFO 08:16:16,576 HelpFormatter - Program Args: -I /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth/sampleC_7723_del_40.align.sorted.depth.txt -O /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth.dat INFO 08:16:16,576 HelpFormatter - Date/Time: 2013/12/20 08:16:16 INFO 08:16:16,577 HelpFormatter - --------------------------------------------------------------- INFO 08:16:16,577 HelpFormatter - --------------------------------------------------------------- INFO 08:16:16,585 CommandLineProgram - Program completed. INFO 08:49:52,571 FunctionEdge - Done: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' org.broadinstitute.sv.main.SVCommandLine '-T' 'ComputeReadSpanCoverageWalker' '-R' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/data/human_b36_chr1.fasta' '-I' '/home/anoll/sim/readSim/wgsim/sampleC_7723_del_40.align.sorted.bam' '-O' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans/sampleC_7723_del_40.align.sorted.spans.txt' '-disableGATKTraversal' 'true' '-md' 'test1/metadata' '-maxInsertSizeStandardDeviations' '3' INFO 08:49:52,571 QGraph - Writing incremental jobs reports... INFO 08:49:52,574 FunctionEdge - Starting: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.MergeReadSpanCoverage' '-I' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans/sampleC_7723_del_40.align.sorted.spans.txt' '-O' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans.dat' INFO 08:49:52,575 FunctionEdge - Output written to /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-10.out INFO 08:49:57,940 FunctionEdge - Starting: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' org.broadinstitute.sv.main.SVCommandLine '-T' 'ComputeGCProfileWalker' '-R' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/data/human_b36_chr1.fasta' '-I' '/home/anoll/sim/readSim/wgsim/sampleC_7723_del_40.align.sorted.bam' '-O' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofile/sampleC_7723_del_40.align.sorted.bam.gcprof.zip' '-disableGATKTraversal' 'true' '-md' 'test1/metadata' '-referenceProfile' 'test1/metadata/gcprofile/reference.gcprof.zip' '-genomeMaskFile' 'data/human_b36_chr1.mask.fasta' '-copyNumberMaskFile' 'data/cn2_mask_g1k_b36_chr1.fasta' '-insertSizeRadius' '10.0' INFO 08:49:57,940 FunctionEdge - Output written to /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-11.out INFO 09:14:22,959 QGraph - 1 Pend, 2 Run, 1 Fail, 8 Done INFO 08:16:16,598 FunctionEdge - Output written to /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-9.out INFO 08:49:52,546 QGraph - 3 Pend, 2 Run, 0 Fail, 7 Done ERROR 08:49:52,558 FunctionEdge - Error: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.MergeReadDepthCoverage' '-I' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth/sampleC_7723_del_40.align.sorted.depth.txt' '-O' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth.dat' ERROR 08:49:52,563 FunctionEdge - Contents of /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-8.out: INFO 08:16:16,570 HelpFormatter - --------------------------------------------------------------- INFO 08:16:16,572 HelpFormatter - Program Name: org.broadinstitute.sv.apps.MergeReadDepthCoverage INFO 08:16:16,576 HelpFormatter - Program Args: -I /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth/sampleC_7723_del_40.align.sorted.depth.txt -O /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/depth.dat INFO 08:16:16,576 HelpFormatter - Date/Time: 2013/12/20 08:16:16 INFO 08:16:16,577 HelpFormatter - --------------------------------------------------------------- INFO 08:16:16,577 HelpFormatter - --------------------------------------------------------------- INFO 08:16:16,585 CommandLineProgram - Program completed. INFO 08:49:52,571 FunctionEdge - Done: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' org.broadinstitute.sv.main.SVCommandLine '-T' 'ComputeReadSpanCoverageWalker' '-R' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/data/human_b36_chr1.fasta' '-I' '/home/anoll/sim/readSim/wgsim/sampleC_7723_del_40.align.sorted.bam' '-O' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans/sampleC_7723_del_40.align.sorted.spans.txt' '-disableGATKTraversal' 'true' '-md' 'test1/metadata' '-maxInsertSizeStandardDeviations' '3' INFO 08:49:52,571 QGraph - Writing incremental jobs reports... INFO 08:49:52,574 FunctionEdge - Starting: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.MergeReadSpanCoverage' '-I' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans/sampleC_7723_del_40.align.sorted.spans.txt' '-O' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans.dat' INFO 08:49:52,575 FunctionEdge - Output written to /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-10.out INFO 08:49:57,940 FunctionEdge - Starting: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' org.broadinstitute.sv.main.SVCommandLine '-T' 'ComputeGCProfileWalker' '-R' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/data/human_b36_chr1.fasta' '-I' '/home/anoll/sim/readSim/wgsim/sampleC_7723_del_40.align.sorted.bam' '-O' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofile/sampleC_7723_del_40.align.sorted.bam.gcprof.zip' '-disableGATKTraversal' 'true' '-md' 'test1/metadata' '-referenceProfile' 'test1/metadata/gcprofile/reference.gcprof.zip' '-genomeMaskFile' 'data/human_b36_chr1.mask.fasta' '-copyNumberMaskFile' 'data/cn2_mask_g1k_b36_chr1.fasta' '-insertSizeRadius' '10.0' INFO 08:49:57,940 FunctionEdge - Output written to /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-11.out INFO 09:14:22,959 QGraph - 1 Pend, 2 Run, 1 Fail, 8 Done ERROR 09:14:22,971 FunctionEdge - Error: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.MergeReadSpanCoverage' '-I' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans/sampleC_7723_del_40.align.sorted.spans.txt' '-O' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans.dat' ERROR 09:14:22,973 FunctionEdge - Contents of /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-10.out: INFO 08:49:57,915 HelpFormatter - -------------------------------------------------------------- INFO 08:49:57,917 HelpFormatter - Program Name: org.broadinstitute.sv.apps.MergeReadSpanCoverage INFO 08:49:57,920 HelpFormatter - Program Args: -I /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans/sampleC_7723_del_40.align.sorted.spans.txt -O /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/spans.dat INFO 08:49:57,921 HelpFormatter - Date/Time: 2013/12/20 08:49:57 INFO 08:49:57,921 HelpFormatter - -------------------------------------------------------------- INFO 08:49:57,921 HelpFormatter - -------------------------------------------------------------- INFO 08:49:57,927 CommandLineProgram - Program completed. INFO 09:14:22,987 FunctionEdge - Done: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' org.broadinstitute.sv.main.SVCommandLine '-T' 'ComputeGCProfileWalker' '-R' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/data/human_b36_chr1.fasta' '-I' '/home/anoll/sim/readSim/wgsim/sampleC_7723_del_40.align.sorted.bam' '-O' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofile/sampleC_7723_del_40.align.sorted.bam.gcprof.zip' '-disableGATKTraversal' 'true' '-md' 'test1/metadata' '-referenceProfile' 'test1/metadata/gcprofile/reference.gcprof.zip' '-genomeMaskFile' 'data/human_b36_chr1.mask.fasta' '-copyNumberMaskFile' 'data/cn2_mask_g1k_b36_chr1.fasta' '-insertSizeRadius' '10.0' INFO 09:14:22,988 QGraph - Writing incremental jobs reports... INFO 09:14:22,991 FunctionEdge - Starting: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.MergeGCProfiles' '-I' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofile/sampleC_7723_del_40.align.sorted.bam.gcprof.zip' '-O' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofiles.zip' INFO 09:14:22,991 FunctionEdge - Output written to /home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/logs/SVPreprocess-12.out INFO 09:14:28,331 QGraph - 0 Pend, 1 Run, 2 Fail, 9 Done INFO 09:14:52,970 FunctionEdge - Done: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/tmpdir' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' '-cp' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/SVToolkit.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.MergeGCProfiles' '-I' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofile/sampleC_7723_del_40.align.sorted.bam.gcprof.zip' '-O' '/home/anoll/tools/CNV/genome/doc/genomeStrip/svtoolkit/installtest/test1/metadata/gcprofiles.zip' INFO 09:14:52,971 QGraph - Writing incremental jobs reports... INFO 09:14:52,972 QGraph - 0 Pend, 0 Run, 2 Fail, 10 Done INFO 09:14:52,974 QCommandLine - Writing final jobs report... ________________________________ Electronic mail from Children's Mercy Hospitals and Clinics. This communication is intended only for the use of the addressee. It may contain information that is privileged or confidential under applicable law. If you are not the intended recipient or the agent of the recipient, you are hereby notified that any dissemination, copy or disclosure of this communication is strictly prohibited. If you have received this communication in error, please immediately forward the message to Children's Mercy Hospital's Information Security Officer via return electronic mail at inf...@cm... and expunge this communication without making any copies. Thank you for your cooperation. |
|
From: Bob H. <han...@br...> - 2013-10-15 11:32:41
|
There is post-filtering that goes on after discovery/genotyping and usually events that do not genotype well get filtered. What version are you running and did you run the default QC filters? The inbreeding coefficient filter, for example, would likely flag a site that is called all het (which can happen when there is too little data at a site to fit the mixture model). Can you send along the complete VCF record and maybe do a plot with PlotGenotypingResults ? -Bob On 10/14/13 10:00 PM, Young-jun Kwon wrote: > Dear, webmaster > > I'm a graduate student in SNU, Seoul, Korea. > > I used Genome STRiP for detecting CNVs, and Output vcf files were gained. > > Among the results, I found that there were some overlapped CNV regions > or some regions include other regions. > > Despite I considered combination of allele types, results were illogical. > > (real ex - all of 26 individuals have hetero(0/1) types, > 93755407-93818770, 93755562-93818886, 93756831-93821153, > 93757996-93821773,.........) > > > How do I have to handle this kind of result? > > > Thank you. > > sincerely, Young-jun > > > > ------------------------------------------------------------------------------ > October Webinars: Code for Performance > Free Intel webinars can help you accelerate application performance. > Explore tips for MPI, OpenMP, advanced profiling, and more. Get the most from > the latest Intel processors and coprocessors. See abstracts and register > > http://pubads.g.doubleclick.net/gampad/clk?id=60135031&iu=/4140/ostg.clktrk > > > _______________________________________________ > svtoolkit-help mailing list > svt...@li... > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help |
|
From: Young-jun K. <you...@gm...> - 2013-10-15 02:00:22
|
Dear, webmaster I'm a graduate student in SNU, Seoul, Korea. I used Genome STRiP for detecting CNVs, and Output vcf files were gained. Among the results, I found that there were some overlapped CNV regions or some regions include other regions. Despite I considered combination of allele types, results were illogical. (real ex - all of 26 individuals have hetero(0/1) types, 93755407-93818770, 93755562-93818886, 93756831-93821153, 93757996-93821773,.........) How do I have to handle this kind of result? Thank you. sincerely, Young-jun |
|
From: Bob H. <han...@br...> - 2013-10-09 17:41:06
|
Hi,
Yes, this problem comes up occasionally - I don't know whether it is
indel realignment or some other tool (but a corner case in indel
realignment is a good guess).
I find that I see it a few times in any largish data set that comes from
the bwa/GATK pipeline.
You can work around this problem by changing a configuration parameter
select.validateReadPairs:false.
You can do this by changing the config file, or in newer versions of
Genome STRiP the preferred way is to leave the standard config file
unmodified and put
-P select.validateReadPairs:false on the command line.
This flag controls several consistency checks.
I can't recommend turning this off by default, since if you have bad
input data you really do want to find out about it.
Best,
-Bob
On 10/9/13 12:30 PM, Anne-Katrin Emde wrote:
> Hello!
>
> I am running GenomeSTRiP on 50 genomes (bwa-aligned, GATK indel
> realigned and quality recalibrated) and I am getting the following error:
>
> ##### ERROR MESSAGE: Mismatched read pair insert sizes for sample
> 6837: [ {HS2000-910_287:1:1309:11124:98404 97 17 22252630
> 0 100M = 22251548 -983
> CTTTGAAGATTTCGTTGGAAACGGGATAATCTTCACAGAAAAGCTAAACAGAAGCATTCTCAGAAACTTCTTTGTGATGTTTGCTTTCAACTCACAGAGT
> >@??>>?=>=??=6=?==???<6==>>>?>=??=>;><=>??==?>??<>=>9==>=?=><=>>>?;>><>@?>=?>=<>>?><=?><=5;?=><>>>>=
> X0:i:5 X1:i:0
> XA:Z:17,+22255009,100M,0;17,+22259766,100M,0;17,+22247875,100M,0;17,+22245496,100M,0;
> BD:Z:NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
> MD:Z:100 RG:Z:6837 XG:i:0
> BI:Z:NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
> AM:i:0 NM:i:0 SM:i:0 XM:i:0 XO:i:0 MQ:i:47 XT:A:R},
> {HS2000-910_287:1:1309:11124:98404 145 17 22251548
> 47 2M1D98M = 22252630 981
> TTTGAGAGAGAAGCTTTGAAACACTCTTTTTCTAGAATCTGCAAGTGGACATTGGGAGGGCTGTGAGGTTTGTGGTGGAAAAGGAAATATCTCCACATAA
> @@>=?=?=?=>?<>=>?>?==>;=><>>>>><=><?=><=<=?>;======>>==<>====>;>=?=;??>;>=;===????==??=>=>=>>=<===@7
> X0:i:1 X1:i:0 OC:Z:100M
> BD:Z:NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
> RG:Z:6837 XG:i:0
> BI:Z:NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
> AM:i:0 NM:i:4 SM:i:37 XM:i:4 XO:i:0 OP:i:22251549 XT:A:U} ]
> ##### ERROR
> ------------------------------------------------------------------------------------------
>
> So the insert size of the left and right mate don't agree. We think
> that indel realignment might cause the mismatch in insert sizes. Has
> this error message been reported before on bwa-aligned reads (+ GATK
> realignment, recalibration)? Is there a way to prevent GenomeSTRiP
> from crashing at those instances, e.g. printing a warning instead of
> an error? It only happens very rarely - on 50 high-coverage whole
> genomes the error was reported 4 times.
>
> Thanks,
>
> Anne-Katrin
>
>
> --------------------------------------
> Anne-Katrin Emde, Ph.D.
> Bioinformatics Scientist
> New York Genome Center
> ak...@ny... <mailto:ak...@ny...>
> (917)-951-0167
> --------------------------------------
>
>
>
> ------------------------------------------------------------------------------
> October Webinars: Code for Performance
> Free Intel webinars can help you accelerate application performance.
> Explore tips for MPI, OpenMP, advanced profiling, and more. Get the most from
> the latest Intel processors and coprocessors. See abstracts and register >
> http://pubads.g.doubleclick.net/gampad/clk?id=60134071&iu=/4140/ostg.clktrk
>
>
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help
|
|
From: Anne-Katrin E. <ak...@ny...> - 2013-10-09 16:43:37
|
Hello!
I am running GenomeSTRiP on 50 genomes (bwa-aligned, GATK indel realigned and quality recalibrated) and I am getting the following error:
##### ERROR MESSAGE: Mismatched read pair insert sizes for sample 6837: [ {HS2000-910_287:1:1309:11124:98404 97 17 22252630 0 100M = 22251548 -983 CTTTGAAGATTTCGTTGGAAACGGGATAATCTTCACAGAAAAGCTAAACAGAAGCATTCTCAGAAACTTCTTTGTGATGTTTGCTTTCAACTCACAGAGT >@??>>?=>=??=6=?==???<6==>>>?>=??=>;><=>??==?>??<>=>9==>=?=><=>>>?;>><>@?>=?>=<>>?><=?><=5;?=><>>>>= X0:i:5 X1:i:0 XA:Z:17,+22255009,100M,0;17,+22259766,100M,0;17,+22247875,100M,0;17,+22245496,100M,0; BD:Z:NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN MD:Z:100 RG:Z:6837 XG:i:0 BI:Z:NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN AM:i:0 NM:i:0 SM:i:0 XM:i:0 XO:i:0 MQ:i:47 XT:A:R}, {HS2000-910_287:1:1309:11124:98404 145 17 22251548 47 2M1D98M = 22252630 981 TTTGAGAGAGAAGCTTTGAAACACTCTTTTTCTAGAATCTGCAAGTGGACATTGGGAGGGCTGTGAGGTTTGTGGTGGAAAAGGAAATATCTCCACATAA @@>=?=?=?=>?<>=>?>?==>;=><>>>>><=><?=><=<=?>;======>>==<>====>;>=?=;??>;>=;===????==??=>=>=>>=<===@7 X0:i:1 X1:i:0 OC:Z:100M BD:Z:NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN RG:Z:6837 XG:i:0 BI:Z:NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN AM:i:0 NM:i:4 SM:i:37 XM:i:4 XO:i:0 OP:i:22251549 XT:A:U} ]
##### ERROR ------------------------------------------------------------------------------------------
So the insert size of the left and right mate don't agree. We think that indel realignment might cause the mismatch in insert sizes. Has this error message been reported before on bwa-aligned reads (+ GATK realignment, recalibration)? Is there a way to prevent GenomeSTRiP from crashing at those instances, e.g. printing a warning instead of an error? It only happens very rarely - on 50 high-coverage whole genomes the error was reported 4 times.
Thanks,
Anne-Katrin
--------------------------------------
Anne-Katrin Emde, Ph.D.
Bioinformatics Scientist
New York Genome Center
ak...@ny...<mailto:ak...@ny...>
(917)-951-0167
--------------------------------------
|
|
From: Eric L. <lyz...@gm...> - 2013-08-29 18:41:03
|
Is svtoolkit open source? If so, where can I download the source code? |
|
From: Bob H. <han...@br...> - 2013-06-05 20:00:04
|
We corresponded about this - I put in a fix in release 1.04.1162. Did that not fix the problem? I understand that this is a reverse/reverse read pair, and I think you should no longer get any errors regarding the insert sizes in r1162. If you are still getting the problem, please send me a full stack trace (and if you can a small test bam). -Bob On 6/5/13 11:56 AM, John Broxholme wrote: > Hi Bob, > > I've had a bit of feedback from Gerton Lunter (the author of the > mapper I'm using, "stampy"), regarding the "Invalid sequence position" > error: > > "What's going on here, is that these two reads are BOTH mapped in the > reverse direction.  So it's unclear what's going on, and in > particular it's unclear what the fragment was originally.  > > "The trouble is that the SAM specification does not say what the ISIZE > field should be in this situation.  Stampy calculates the fragment > size as the distance between the two read starts, where "read start" > is the mapping position for FW reads, and the mapping position + read > length for BW reads (when there are no indels), but clearly this is > not what GATK / GenomeSTRiP expects. > > "Again, picard's ValidateSamFile and GATK's CountBases -S STRICT > accept this isize fine. > > "Since it's not specified in the BAM specification what the ISIZE > field should be in this case, I think the most practical solution is > to accept anything.  If Bob agrees perhaps he can change this in his > code.  If not we can filter the reads away (although they may be > informative for some structural variation, so that wouldn't be my > preferred solution.)  Or I could change Stampy to produce what > GenomeSTRiP expects; I'm somewhat reluctant to do that, since I don't > know which tools are relying on Stampy's ISIZE field in this case > (quite likely none, but who knows.)" > > Hopefully this can be resolved somehow.  I did introduce a filter > some time ago which removed some reads which were aberrant for some > other (similar) reason, but that was down to a bug in the mapper (stampy). > > Cheers > John > > > On Thu, May 23, 2013 at 3:21 PM, John Broxholme <jo...@we... > <mailto:jo...@we...>> wrote: > > Pre-processing of one(of 270+) deep BAM files has failed with: > > ... > INFO  12:54:38,366 ComputeGCProfiles - Processing input file > org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ... > Exception in thread "main" java.lang.RuntimeException: Invalid > sequence position: 17:81195230 > ... > > Where would this have come from?  The pipeline has been the > same to prepare all 270+ of the (25x deep) BAMs, and this is the > only failure.  Any suggestions on what might be wrong and how to > fix it will be most welcome! > > Thanks > John > > -- > John Broxholme > Wellcome Trust Centre for Human Genetics > Roosevelt Drive, Oxford, OX3 7BN, UK > > > > > -- > John Broxholme > Wellcome Trust Centre for Human Genetics > Roosevelt Drive, Oxford, OX3 7BN, UK > Tel: (+44 1865) 287611 FAX: 287697 > > > ------------------------------------------------------------------------------ > How ServiceNow helps IT people transform IT departments: > 1. A cloud service to automate IT design, transition and operations > 2. Dashboards that offer high-level views of enterprise services > 3. A single system of record for all IT processes > http://p.sf.net/sfu/servicenow-d2d-j > > > _______________________________________________ > svtoolkit-help mailing list > svt...@li... > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help |
|
From: John B. <jo...@we...> - 2013-06-05 15:56:39
|
Hi Bob, I've had a bit of feedback from Gerton Lunter (the author of the mapper I'm using, "stampy"), regarding the "Invalid sequence position" error: "What's going on here, is that these two reads are BOTH mapped in the reverse direction. So it's unclear what's going on, and in particular it's unclear what the fragment was originally. "The trouble is that the SAM specification does not say what the ISIZE field should be in this situation. Stampy calculates the fragment size as the distance between the two read starts, where "read start" is the mapping position for FW reads, and the mapping position + read length for BW reads (when there are no indels), but clearly this is not what GATK / GenomeSTRiP expects. "Again, picard's ValidateSamFile and GATK's CountBases -S STRICT accept this isize fine. "Since it's not specified in the BAM specification what the ISIZE field should be in this case, I think the most practical solution is to accept anything. If Bob agrees perhaps he can change this in his code. If not we can filter the reads away (although they may be informative for some structural variation, so that wouldn't be my preferred solution.) Or I could change Stampy to produce what GenomeSTRiP expects; I'm somewhat reluctant to do that, since I don't know which tools are relying on Stampy's ISIZE field in this case (quite likely none, but who knows.)" Hopefully this can be resolved somehow. I did introduce a filter some time ago which removed some reads which were aberrant for some other (similar) reason, but that was down to a bug in the mapper (stampy). Cheers John On Thu, May 23, 2013 at 3:21 PM, John Broxholme <jo...@we...> wrote: > Pre-processing of one(of 270+) deep BAM files has failed with: > > ... > INFO 12:54:38,366 ComputeGCProfiles - Processing input file > org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ... > Exception in thread "main" java.lang.RuntimeException: Invalid sequence > position: 17:81195230 > ... > > Where would this have come from? The pipeline has been the same to > prepare all 270+ of the (25x deep) BAMs, and this is the only failure. Any > suggestions on what might be wrong and how to fix it will be most welcome! > > Thanks > John > > -- > John Broxholme > Wellcome Trust Centre for Human Genetics > Roosevelt Drive, Oxford, OX3 7BN, UK > > -- John Broxholme Wellcome Trust Centre for Human Genetics Roosevelt Drive, Oxford, OX3 7BN, UK Tel: (+44 1865) 287611 FAX: 287697 |
|
From: John B. <jo...@we...> - 2013-06-03 15:53:44
|
Hi Bob,
Not sure what happened there - maybe I pasted in from 'less -S'. Anyway
here is the same error, hopefully intact.
Best,
John
##### ERROR
------------------------------------------------------------------------------------------
##### ERROR stack trace
java.lang.RuntimeException: Mismatched read pair insert sizes for sample
4070 Normal: [ {WTCHG_33730:2:1101:10772:19659 113 22 20047976
23 100M = 20047705
271
CGCTATTTTGCTATTTTGCCGAGGCTGGTCTTGAGCTCCTGGGCTCAAGTGTGCCTCCTGCCCCAGCCTCCCGATGTGCTGGGATTATAGGAGTGAGCCA
##########################################################?:DB000)6<EED
=FC33BIIIIEC,2<2<??DDDDD:D??? RG:Z:WTCHG_33730 NM:i:0 SM:i:37
MQ:i:23 PQ:i:51 UQ:i:0 XQ:i:11}, {WTCHG_33730:2:1101:10772:19659 177
22 20047705 23 100M
= 20047976 271
TCCTAAAATTAAAAATAATTATCCAGGCGGGGTGGCGGGTGCCTGTAGTCCAAGCTACGTGGGAGTCTGAGACAGGAGAATGGCGTGAACCCGGGAGGTG
###################################################
#CB=GF?00?0:00**BF<FBC:*9:**1<2+A+HGC0F?8B2++A1++ RG:Z:WTCHG_33730
NM:i:2 SM:i:23 MQ:i:37 PQ:i:51 UQ:i:11 XQ:i:0} ]
at
org.broadinstitute.sv.discovery.ReadPairRecordFilter.checkReadPair(ReadPairRecordFilter.java:259)
at
org.broadinstitute.sv.discovery.ReadPairRecordFilter.generateReadPairs(ReadPairRecordFilter.java:212)
at
org.broadinstitute.sv.discovery.ReadPairRecordFilter.filterReadPairs(ReadPairRecordFilter.java:98)
at
org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.finishReadPairSelection(DeletionDiscoveryAlgorithm.java:231)
at
org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:180)
at
org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:110)
at
org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:43)
at
org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
at
org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:97)
at
org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:97)
at
org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:281)
at
org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
at
org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:123)
at
org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:237)
at
org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:147)
at
org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:77)
at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
##### ERROR
------------------------------------------------------------------------------------------
On Fri, May 31, 2013 at 5:11 PM, John Broxholme <jo...@we...> wrote:
> I'm seeing several of these during discovery (I run a single discovery
> command per chromosome - this is from 22), using version 1.04.1162:
>
> INFO 15:23:08,823 HelpFormatter - Program Args: -T SVDiscoveryWalker -R
> /users/johnb/SV/Genomes/hs37d5.fa -O
> /well/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT-1162/d22/P0002.discovery.vcf
> -disableG
> ATKTraversal true -md
> /well/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT-1162/metadata -configFile
> conf/hs37d5.conf -runDirectory
> /well/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT-1162/d22 -genderMapFile /w
> ell/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT-1162/gender.map -genomeMaskFile
> /users/johnb/SV/Genomes/hs37d5.mask.fa -partitionName P0002 -runFilePrefix
> P0002 -L 22:9990000-21010000 -searchLocus 2
> 2:10000000-19999999 -searchWindow 22:9990000-21010000 -searchMinimumSize
> 100 -searchMaximumSize 1000000
>
> ##### ERROR stack trace
> java.lang.RuntimeException: Mismatched read pair insert sizes for sample
> 4070 Normal: [ {WTCHG_33730:2:1101:10772:19659 113 22 20047976
> 23 100M = 20047705
> =FC33BIIIIEC,2<2<??DDDDD:D??? RG:Z:WTCHG_33730 NM:i:0 SM:i:37
> MQ:i:23 PQ:i:51 UQ:i:0 XQ:i:11}, {WTCHG_33730:2:1101:10772:19659 177
> 22 20047705 23 100M
> #CB=GF?00?0:00**BF<FBC:*9:**1<2+A+HGC0F?8B2++A1++ RG:Z:WTCHG_33730
> NM:i:2 SM:i:23 MQ:i:37 PQ:i:51 UQ:i:11 XQ:i:0} ]
> at
> org.broadinstitute.sv.discovery.ReadPairRecordFilter.checkReadPair(ReadPairRecordFilter.java:259)
> at
> org.broadinstitute.sv.discovery.ReadPairRecordFilter.generateReadPairs(ReadPairRecordFilter.java:212)
> at
> org.broadinstitute.sv.discovery.ReadPairRecordFilter.filterReadPairs(ReadPairRecordFilter.java:98)
> at
> org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.finishReadPairSelection(DeletionDiscoveryAlgorithm.java:231)
> at
> org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:180)
> at
> org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:110)
> at
> org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:43)
> at
> org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
> at
> org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:97)
> at
> org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:281)
> at
> org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
> at
> org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:123)
> at
> org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:237)
> at
> org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:147)
> at
> org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:77)
> at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
> ##### ERROR
> ------------------------------------------------------------------------------------------
>
> Any clues as to what's wrong?
> Thanks
> John
>
> --
> John Broxholme
> Wellcome Trust Centre for Human Genetics
> Roosevelt Drive, Oxford, OX3 7BN, UK
> Tel: (+44 1865) 287611 FAX: 287697
>
--
John Broxholme
Wellcome Trust Centre for Human Genetics
Roosevelt Drive, Oxford, OX3 7BN, UK
Tel: (+44 1865) 287611 FAX: 287697
|
|
From: Bob H. <han...@br...> - 2013-05-31 19:23:58
|
Your output below appears to be truncated or otherwised messed up (and
note the strange characters too).
If you can send the exact output, probably we can figure out what's wrong.
Note that in particular the SEQ and TLEN fields are missing from these
sam records.
-Bob
On 5/31/13 12:11 PM, John Broxholme wrote:
> I'm seeing several of these during discovery (I run a single discovery
> command per chromosome - this is from 22), using version 1.04.1162:
>
> INFO Â 15:23:08,823 HelpFormatter - Program Args: -T SVDiscoveryWalker
> -R /users/johnb/SV/Genomes/hs37d5.fa -O
> /well/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT-1162/d22/P0002.discovery.vcf -disableG
> ATKTraversal true -md
> /well/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT-1162/metadata -configFile
> conf/hs37d5.conf -runDirectory
> /well/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT-1162/d22 -genderMapFile /w
> ell/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT-1162/gender.map
> -genomeMaskFile /users/johnb/SV/Genomes/hs37d5.mask.fa -partitionName
> P0002 -runFilePrefix P0002 -L 22:9990000-21010000 -searchLocus 2
> 2:10000000-19999999 -searchWindow 22:9990000-21010000
> -searchMinimumSize 100 -searchMaximumSize 1000000Â
>
> ##### ERROR stack traceÂ
> java.lang.RuntimeException: Mismatched read pair insert sizes for
> sample 4070 Normal: [ {WTCHG_33730:2:1101:10772:19659 113 Â Â 22 Â
> Â Â 20047976 Â Â Â Â 23 Â Â Â 100M Â Â = Â Â Â 20047705
> =FC33BIIIIEC,2<2<??DDDDD:D??? Â Â RG:Z:WTCHG_33730 Â Â Â Â NM:i:0
> Â SM:i:37 MQ:i:23 PQ:i:51 UQ:i:0 Â XQ:i:11},
> {WTCHG_33730:2:1101:10772:19659 Â Â Â 177 Â Â 22 Â Â Â 20047705
> Â Â Â Â 23 Â Â Â 100M
> #CB=GF?00?0:00**BF<FBC:*9:**1<2+A+HGC0F?8B2++A1++ Â
> Â RG:Z:WTCHG_33730 Â Â Â Â NM:i:2 Â SM:i:23 MQ:i:37 PQ:i:51 UQ:i:11
> XQ:i:0} ]
> Â Â Â Â at
> org.broadinstitute.sv.discovery.ReadPairRecordFilter.checkReadPair(ReadPairRecordFilter.java:259)
> Â Â Â Â at
> org.broadinstitute.sv.discovery.ReadPairRecordFilter.generateReadPairs(ReadPairRecordFilter.java:212)
> Â Â Â Â at
> org.broadinstitute.sv.discovery.ReadPairRecordFilter.filterReadPairs(ReadPairRecordFilter.java:98)
> Â Â Â Â at
> org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.finishReadPairSelection(DeletionDiscoveryAlgorithm.java:231)
> Â Â Â Â at
> org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:180)
> Â Â Â Â at
> org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:110)
> Â Â Â Â at
> org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:43)
> Â Â Â Â at
> org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
> Â Â Â Â at
> org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:97)
> Â Â Â Â at
> org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:281)
> Â Â Â Â at
> org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
> Â Â Â Â at
> org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:123)
> Â Â Â Â at
> org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:237)
> Â Â Â Â at
> org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:147)
> Â Â Â Â at
> org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:77)
> Â Â Â Â at
> org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
> ##### ERROR
> ------------------------------------------------------------------------------------------
>
> Any clues as to what's wrong?
> Thanks
> John
>
> --
> John Broxholme
> Wellcome Trust Centre for Human Genetics
> Roosevelt Drive, Oxford, OX3 7BN, UK
> Tel: (+44 1865) 287611 FAX: 287697
>
>
> ------------------------------------------------------------------------------
> Get 100% visibility into Java/.NET code with AppDynamics Lite
> It's a free troubleshooting tool designed for production
> Get down to code-level detail for bottlenecks, with <2% overhead.
> Download for free and get started troubleshooting in minutes.
> http://p.sf.net/sfu/appdyn_d2d_ap2
>
>
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help
|
|
From: John B. <jo...@we...> - 2013-05-31 16:11:28
|
I'm seeing several of these during discovery (I run a single discovery
command per chromosome - this is from 22), using version 1.04.1162:
INFO 15:23:08,823 HelpFormatter - Program Args: -T SVDiscoveryWalker -R
/users/johnb/SV/Genomes/hs37d5.fa -O
/well/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT-1162/d22/P0002.discovery.vcf
-disableG
ATKTraversal true -md
/well/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT-1162/metadata -configFile
conf/hs37d5.conf -runDirectory
/well/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT-1162/d22 -genderMapFile /w
ell/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT-1162/gender.map -genomeMaskFile
/users/johnb/SV/Genomes/hs37d5.mask.fa -partitionName P0002 -runFilePrefix
P0002 -L 22:9990000-21010000 -searchLocus 2
2:10000000-19999999 -searchWindow 22:9990000-21010000 -searchMinimumSize
100 -searchMaximumSize 1000000
##### ERROR stack trace
java.lang.RuntimeException: Mismatched read pair insert sizes for sample
4070 Normal: [ {WTCHG_33730:2:1101:10772:19659 113 22 20047976
23 100M = 20047705
=FC33BIIIIEC,2<2<??DDDDD:D??? RG:Z:WTCHG_33730 NM:i:0 SM:i:37
MQ:i:23 PQ:i:51 UQ:i:0 XQ:i:11}, {WTCHG_33730:2:1101:10772:19659 177
22 20047705 23 100M
#CB=GF?00?0:00**BF<FBC:*9:**1<2+A+HGC0F?8B2++A1++ RG:Z:WTCHG_33730
NM:i:2 SM:i:23 MQ:i:37 PQ:i:51 UQ:i:11 XQ:i:0} ]
at
org.broadinstitute.sv.discovery.ReadPairRecordFilter.checkReadPair(ReadPairRecordFilter.java:259)
at
org.broadinstitute.sv.discovery.ReadPairRecordFilter.generateReadPairs(ReadPairRecordFilter.java:212)
at
org.broadinstitute.sv.discovery.ReadPairRecordFilter.filterReadPairs(ReadPairRecordFilter.java:98)
at
org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.finishReadPairSelection(DeletionDiscoveryAlgorithm.java:231)
at
org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:180)
at
org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:110)
at
org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:43)
at
org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
at
org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:97)
at
org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:281)
at
org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
at
org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:123)
at
org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:237)
at
org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:147)
at
org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:77)
at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
##### ERROR
------------------------------------------------------------------------------------------
Any clues as to what's wrong?
Thanks
John
--
John Broxholme
Wellcome Trust Centre for Human Genetics
Roosevelt Drive, Oxford, OX3 7BN, UK
Tel: (+44 1865) 287611 FAX: 287697
|
|
From: Bob H. <han...@br...> - 2013-05-29 04:12:39
|
Hi, John, I put in a fix (hopefully) into release 1.04.1162 that we posted this evening. Let me know if that fixes the problem. -Bob On 5/28/13 4:36 PM, John Broxholme wrote: > Sorry, I missed the details. > > Initial command line: >   java -cp > /usr/local/genetics/svtoolkit_1.04.1068/lib/SVToolkit.jar:/usr/local/genetics/svtoolkit_1.04.1068/lib/gatk/GenomeAnalysisTK.jar:/usr/local/genetics/svtoolkit_1.04.1068/lib/gatk/Queue.jar > -Xmx4g \ >   org.broadinstitute.sting.queue.QCommandLine \ >   -S /usr/local/genetics/svtoolkit_1.04.1068/qscript/SVPreprocess.q \ >   -S /usr/local/genetics/svtoolkit_1.04.1068/qscript/SVQScript.q \ >   -gatk > /usr/local/genetics/svtoolkit_1.04.1068/lib/gatk/GenomeAnalysisTK.jar \ >   -cp > /usr/local/genetics/svtoolkit_1.04.1068/lib/SVToolkit.jar:/usr/local/genetics/svtoolkit_1.04.1068/lib/gatk/GenomeAnalysisTK.jar:/usr/local/genetics/svtoolkit_1.04.1068/lib/gatk/Queue.jar > \ >   -configFile conf/hs37d5.conf \ >   -tempDir /well/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT3/tmpdir \ >   -R /users/johnb/SV/Genomes/hs37d5.fa \ >   -reduceInsertSizeDistributions \ >   -genomeMaskFile /users/johnb/SV/Genomes/hs37d5.mask.fa \ >   -genderMapFile OUTPUT3/gender.map \ >   -runDirectory OUTPUT3/AS_CLL_156GL \ >   -md OUTPUT3/AS_CLL_156GL/metadata \ >   -computeGCProfiles \ >   -copyNumberMaskFile /users/johnb/SV/Genomes/hs37d5.cn2mask.fa \ >   -jobLogDir OUTPUT3/AS_CLL_156GL/logs \ >   -I AS_CLL_156GL.bam > > Contents of OUTPUT3/AS_CLL_156GL/logs/SVPreprocess-11.out: > > INFO  12:54:38,270 HelpFormatter - > ---------------------------------------------------------- > INFO  12:54:38,272 HelpFormatter - Program Name: > org.broadinstitute.sv.apps.ComputeGCProfiles > INFO  12:54:38,275 HelpFormatter - Program Args: -I > /gpfs1/well/htseq/ILLUMINA-WGS/SV-Freeze5/AS_CLL_156GL.bam -O > /gpfs1/well/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT3/AS_CLL_156GL/metadata/gcprofile/AS_CLL_156GL.bam.gcprof.zip > -R /users/johnb/SV/Genomes/hs37d5.fa -md OUTPUT3/AS_CLL_156GL/metadata > -referenceProfile > OUTPUT3/AS_CLL_156GL/metadata/gcprofile/reference.gcprof.zip > -genomeMaskFile /users/johnb/SV/Genomes/hs37d5.mask.fa > -copyNumberMaskFile /users/johnb/SV/Genomes/hs37d5.cn2mask.fa > -configFile conf/hs37d5.conf > INFO  12:54:38,276 HelpFormatter - Date/Time: 2013/05/23 12:54:38 > INFO  12:54:38,276 HelpFormatter - > ---------------------------------------------------------- > INFO  12:54:38,276 HelpFormatter - > ---------------------------------------------------------- > INFO  12:54:38,298 ComputeGCProfiles - Opening reference sequence ... > INFO  12:54:38,299 ComputeGCProfiles - Opened reference sequence. > INFO  12:54:38,299 ComputeGCProfiles - Opening genome mask ... > INFO  12:54:38,299 ComputeGCProfiles - Opened genome mask. > INFO  12:54:38,300 ComputeGCProfiles - Opening copy number mask ... > INFO  12:54:38,300 ComputeGCProfiles - Opened copy number mask. > INFO  12:54:38,300 ComputeGCProfiles - Initializing algorithm ... > #INFO: ReadCountAlgorithm: detected metadata version 1, forcing legacy > behavior > INFO  12:54:38,338 ComputeGCProfiles - Algorithm initialized. > INFO  12:54:38,338 ComputeGCProfiles - Opening reference GC profile ... > INFO  12:54:38,365 ComputeGCProfiles - Opened reference GC profile. > INFO  12:54:38,366 ComputeGCProfiles - Processing input file > org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ... > Exception in thread "main" java.lang.RuntimeException: Invalid > sequence position: 17:81195230 >     at > org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:46) >     at > org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:237) >     at > org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:147) >     at > org.broadinstitute.sv.commandline.CommandLineProgram.run(CommandLineProgram.java:24) >     at > org.broadinstitute.sv.apps.ComputeGCProfiles.main(ComputeGCProfiles.java:120) > Caused by: java.lang.IllegalArgumentException: Invalid sequence > position: 17:81195230 >     at > org.broadinstitute.sv.mask.GenomeMaskFastaFile.getMaskBit(GenomeMaskFastaFile.java:80) >     at > org.broadinstitute.sv.metadata.gc.GCProfileAlgorithm.processRecord(GCProfileAlgorithm.java:107) >     at > org.broadinstitute.sv.metadata.gc.GCProfileAlgorithm.processSAMFile(GCProfileAlgorithm.java:124) >     at > org.broadinstitute.sv.apps.ComputeGCProfiles.run(ComputeGCProfiles.java:181) >     at > org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:38) >     ... 4 more > > > > > On Tue, May 28, 2013 at 9:24 PM, > <svt...@li... > <mailto:svt...@li...>> wrote: > > Send svtoolkit-help mailing list submissions to >     svt...@li... > <mailto:svt...@li...> > > To subscribe or unsubscribe via the World Wide Web, visit >     https://lists.sourceforge.net/lists/listinfo/svtoolkit-help > or, via email, send a message with subject or body 'help' to >     svt...@li... > <mailto:svt...@li...> > > You can reach the person managing the list at >     svt...@li... > <mailto:svt...@li...> > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of svtoolkit-help digest..." > > > Today's Topics: > >   1. "Invalid sequence position" (John Broxholme) >   2. Re: "Invalid sequence position" (Bob Handsaker) >   3. Re: "Invalid sequence position" (John Broxholme) >   4. Re: "Invalid sequence position" (Bob Handsaker) > > > ---------------------------------------------------------------------- > > Message: 1 > Date: Thu, 23 May 2013 15:21:57 +0100 > From: John Broxholme <jo...@we... > <mailto:jo...@we...>> > Subject: [svtoolkit-help] "Invalid sequence position" > To: svt...@li... > <mailto:svt...@li...> > Cc: Linda Hughes <li...@we... <mailto:li...@we...>> > Message-ID: >     > <CADGtfyC7wyVAqJfRO3SAwEPVuhGQtjrGJMrZxu3B=Xjv...@ma... <mailto:Xjv...@ma...>> > Content-Type: text/plain; charset="utf-8" > > Pre-processing of one(of 270+) deep BAM files has failed with: > > ... > INFO  12:54:38,366 ComputeGCProfiles - Processing input file > org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ... > Exception in thread "main" java.lang.RuntimeException: Invalid > sequence > position: 17:81195230 > ... > > Where would this have come from?  The pipeline has been the same > to prepare > all 270+ of the (25x deep) BAMs, and this is the only failure.  Any > suggestions on what might be wrong and how to fix it will be most > welcome! > > Thanks > John > > -- > John Broxholme > Wellcome Trust Centre for Human Genetics > Roosevelt Drive, Oxford, OX3 7BN, UK > -------------- next part -------------- > An HTML attachment was scrubbed... > > ------------------------------ > > Message: 2 > Date: Thu, 23 May 2013 10:35:31 -0400 > From: Bob Handsaker <han...@br... > <mailto:han...@br...>> > Subject: Re: [svtoolkit-help] "Invalid sequence position" > To: svt...@li... > <mailto:svt...@li...> > Message-ID: <519...@br... > <mailto:519...@br...>> > Content-Type: text/plain; charset="iso-8859-1" > > Including the stack trace would be most helpful. > If you are using an hg19-based reference, then chr17 is only > 81195210 long. > Does ValidateSamFile like this bam? > This may be related to the bwa idiosyncracy of occasionally leaving > nominally-invalid POS fields in unmapped records. > If so, I will try to fix it if you can send me the command line and > stack trace. > -Bob > > On 5/23/13 10:21 AM, John Broxholme wrote: > > Pre-processing of one(of 270+) deep BAM files has failed with: > > > > ... > > INFO ? 12:54:38,366 ComputeGCProfiles - Processing input file > > org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ...? > > Exception in thread "main" java.lang.RuntimeException: Invalid > > sequence position: 17:81195230 > > ... > > > > Where would this have come from? ? The pipeline has been the > same? to > > prepare all 270+ of the (25x deep) BAMs, and this is the only > failure. > > ? Any suggestions on what might be wrong and how to fix it will be > > most welcome! > > > > Thanks > > John > > > > -- > > John Broxholme > > Wellcome Trust Centre for Human Genetics > > Roosevelt Drive, Oxford, OX3 7BN, UK > > > > > > > > > ------------------------------------------------------------------------------ > > Try New Relic Now & We'll Send You this Cool Shirt > > New Relic is the only SaaS-based application performance > monitoring service > > that delivers powerful full stack analytics. Optimize and > monitor your > > browser, app, & servers with just a few lines of code. Try New Relic > > and get this awesome Nerd Life shirt! > http://p.sf.net/sfu/newrelic_d2d_may > > > > > > _______________________________________________ > > svtoolkit-help mailing list > > svt...@li... > <mailto:svt...@li...> > > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help > > -------------- next part -------------- > An HTML attachment was scrubbed... > > ------------------------------ > > Message: 3 > Date: Tue, 28 May 2013 15:37:18 +0100 > From: John Broxholme <jo...@we... > <mailto:jo...@we...>> > Subject: Re: [svtoolkit-help] "Invalid sequence position" > To: svt...@li... > <mailto:svt...@li...> > Cc: Linda Hughes <li...@we... <mailto:li...@we...>> > Message-ID: >     > <CAD...@ma... <mailto:CADGtfyCYL1eH1oyhr5s-vzN7mMFiTuDRdEvi0A9V9%2Bj...@ma...>> > Content-Type: text/plain; charset="utf-8" > > Hi Bob, > > Thanks for the quick response.  Yes it is NCBI build37 (actually > the 1000G > reference with decoy).  I can fill in a bit more detail on this. >  The error > I sent earlier was using svtoolkit build 1.04.1068 (which I > couldn't use at > first since dependency on some new(?) R package required an > upgrade of R). >  I first saw this using our production version, build 1.04.857: > > ... > INFO  11:41:09,579 ComputeGCProfiles - Opened reference GC profile. > INFO  11:41:09,579 ComputeGCProfiles - Processing input file > /gpfs1/well/htseq/ILLUMINA-WGS/SV-Freeze5/AS_CLL_156GL.bam ... > Exception in thread "main" java.lang.RuntimeException: Invalid > sequence > position: 17:81195216 >     at > org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:40) >     at > org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221) >     at > org.broadinstitute.sv.commandline.CommandLineProgram.run(CommandLineProgram.java:23) >     at > org.broadinstitute.sv.apps.ComputeGCProfiles.main(ComputeGCProfiles.java:104) > Caused by: java.lang.IllegalArgumentException: Invalid sequence > position: > 17:81195216 > ... > I note that the invalid coordinate reported differs - 81195216 vs > 81195230, > although this is the same BAM. > > Anyhow, I have since updated picard-tools to 1.92 and run 'picard > validateSamFile on the offending BAM > The only error (in 10k errors) I see is "Mate not found for paired > read" (I > see many of these) which I assume has been caused by deduping (I used > picard for this). > Meanwhile I have removed reads mapping to the last 100bp of chr17 > from that > BAM, which is an ugly fix but it allows me to progress a bit. > And I have to resolve something else causing crashes with the current > (1.04.1068) version, which would be the subject of another thread... > > John > > On Thu, May 23, 2013 at 3:21 PM, John Broxholme > <jo...@we... <mailto:jo...@we...>> wrote: > > > Pre-processing of one(of 270+) deep BAM files has failed with: > > > > ... > > INFO  12:54:38,366 ComputeGCProfiles - Processing input file > > org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ... > > Exception in thread "main" java.lang.RuntimeException: Invalid > sequence > > position: 17:81195230 > > ... > > > > Where would this have come from?  The pipeline has been the same to > > prepare all 270+ of the (25x deep) BAMs, and this is the only > failure.  Any > > suggestions on what might be wrong and how to fix it will be > most welcome! > > > > Thanks > > John > > > > -- > > John Broxholme > > Wellcome Trust Centre for Human Genetics > > Roosevelt Drive, Oxford, OX3 7BN, UK > > > > > > > -- > John Broxholme > Wellcome Trust Centre for Human Genetics > Roosevelt Drive, Oxford, OX3 7BN, UK > Tel: (+44 1865) 287611 FAX: 287697 > -------------- next part -------------- > An HTML attachment was scrubbed... > > ------------------------------ > > Message: 4 > Date: Tue, 28 May 2013 16:23:48 -0400 > From: Bob Handsaker <han...@br... > <mailto:han...@br...>> > Subject: Re: [svtoolkit-help] "Invalid sequence position" > To: svt...@li... > <mailto:svt...@li...> > Message-ID: <51A...@br... > <mailto:51A...@br...>> > Content-Type: text/plain; charset="iso-8859-1" > > This doesn't look like the entire stack trace.  Did you truncate it? > I'm happy to try to help, but you need to send me the full stack trace > and you should send the full command line as well. > -Bob > > On 5/28/13 10:37 AM, John Broxholme wrote: > > Hi Bob, > > > > Thanks for the quick response. ? Yes it is NCBI build37 > (actually the > > 1000G reference with decoy). ? I can fill in a bit more detail on > > this. ? The error I sent earlier was using svtoolkit build 1.04.1068 > > (which I couldn't use at first since dependency on some new(?) R > > package required an upgrade of R). ? I first saw this using our > > production version, build 1.04.857: > > > > ... > > INFO ? 11:41:09,579 ComputeGCProfiles - Opened reference GC > profile.? > > INFO ? 11:41:09,579 ComputeGCProfiles - Processing input file > > /gpfs1/well/htseq/ILLUMINA-WGS/SV-Freeze5/AS_CLL_156GL.bam ...? > > Exception in thread "main" java.lang.RuntimeException: Invalid > > sequence position: 17:81195216 > > ?  ?  ?  ?  at > > > org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:40) > > ?  ?  ?  ?  at > > > org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221) > > ?  ?  ?  ?  at > > > org.broadinstitute.sv.commandline.CommandLineProgram.run(CommandLineProgram.java:23) > > ?  ?  ?  ?  at > > > org.broadinstitute.sv.apps.ComputeGCProfiles.main(ComputeGCProfiles.java:104) > > Caused by: java.lang.IllegalArgumentException: Invalid sequence > > position: 17:81195216 > > ... > > I note that the invalid coordinate reported differs -? 81195216 > > vs? 81195230, although this is the same BAM. > > > > Anyhow, I have since updated picard-tools to 1.92 and run 'picard > > validateSamFile on the offending BAM > > The only error (in 10k errors) I see is "Mate not found for paired > > read" (I see many of these) which I assume has been caused by > deduping > > (I used picard for this). > > Meanwhile I have removed reads mapping to the last 100bp of > chr17 from > > that BAM, which is an ugly fix but it allows me to progress a bit. > > And I have to resolve something else causing crashes with the > current > > (1.04.1068) version, which would be the subject of another thread... > > > > John > > > > On Thu, May 23, 2013 at 3:21 PM, John Broxholme > <jo...@we... <mailto:jo...@we...> > > <mailto:jo...@we... <mailto:jo...@we...>>> wrote: > > > >   Pre-processing of one(of 270+) deep BAM files has failed with: > > > >   ... > >   INFO ? 12:54:38,366 ComputeGCProfiles - Processing input file > >   org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ...? > >   Exception in thread "main" java.lang.RuntimeException: Invalid > >   sequence position: 17:81195230 > >   ... > > > >   Where would this have come from? ? The pipeline has been the > >   same? to prepare all 270+ of the (25x deep) BAMs, and this > is the > >   only failure. ? Any suggestions on what might be wrong and > how to > >   fix it will be most welcome! > > > >   Thanks > >   John > > > >   -- > >   John Broxholme > >   Wellcome Trust Centre for Human Genetics > >   Roosevelt Drive, Oxford, OX3 7BN, UK > > > > > > > > > > -- > > John Broxholme > > Wellcome Trust Centre for Human Genetics > > Roosevelt Drive, Oxford, OX3 7BN, UK > > Tel: (+44 1865) 287611 <tel:%28%2B44%201865%29%20287611> FAX: 287697 > > > > > > > ------------------------------------------------------------------------------ > > Try New Relic Now & We'll Send You this Cool Shirt > > New Relic is the only SaaS-based application performance > monitoring service > > that delivers powerful full stack analytics. Optimize and > monitor your > > browser, app, & servers with just a few lines of code. Try New Relic > > and get this awesome Nerd Life shirt! > http://p.sf.net/sfu/newrelic_d2d_may > > > > > > _______________________________________________ > > svtoolkit-help mailing list > > svt...@li... > <mailto:svt...@li...> > > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help > > -------------- next part -------------- > An HTML attachment was scrubbed... > > ------------------------------ > > ------------------------------------------------------------------------------ > Introducing AppDynamics Lite, a free troubleshooting tool for > Java/.NET > Get 100% visibility into your production application - at no cost. > Code-level diagnostics for performance bottlenecks with <2% overhead > Download for free and get started troubleshooting in minutes. > http://p.sf.net/sfu/appdyn_d2d_ap1 > > ------------------------------ > > _______________________________________________ > svtoolkit-help mailing list > svt...@li... > <mailto:svt...@li...> > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help > > > End of svtoolkit-help Digest, Vol 23, Issue 1 > ********************************************* > > > > > -- > John Broxholme > Wellcome Trust Centre for Human Genetics > Roosevelt Drive, Oxford, OX3 7BN, UK > Tel: (+44 1865) 287611 FAX: 287697 > > > ------------------------------------------------------------------------------ > Introducing AppDynamics Lite, a free troubleshooting tool for Java/.NET > Get 100% visibility into your production application - at no cost. > Code-level diagnostics for performance bottlenecks with <2% overhead > Download for free and get started troubleshooting in minutes. > http://p.sf.net/sfu/appdyn_d2d_ap1 > > > _______________________________________________ > svtoolkit-help mailing list > svt...@li... > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help |
|
From: John B. <jo...@we...> - 2013-05-28 20:36:51
|
Sorry, I missed the details.
Initial command line:
java -cp
/usr/local/genetics/svtoolkit_1.04.1068/lib/SVToolkit.jar:/usr/local/genetics/svtoolkit_1.04.1068/lib/gatk/GenomeAnalysisTK.jar:/usr/local/genetics/svtoolkit_1.04.1068/lib/gatk/Queue.jar
-Xmx4g \
org.broadinstitute.sting.queue.QCommandLine \
-S /usr/local/genetics/svtoolkit_1.04.1068/qscript/SVPreprocess.q \
-S /usr/local/genetics/svtoolkit_1.04.1068/qscript/SVQScript.q \
-gatk
/usr/local/genetics/svtoolkit_1.04.1068/lib/gatk/GenomeAnalysisTK.jar \
-cp
/usr/local/genetics/svtoolkit_1.04.1068/lib/SVToolkit.jar:/usr/local/genetics/svtoolkit_1.04.1068/lib/gatk/GenomeAnalysisTK.jar:/usr/local/genetics/svtoolkit_1.04.1068/lib/gatk/Queue.jar
\
-configFile conf/hs37d5.conf \
-tempDir /well/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT3/tmpdir \
-R /users/johnb/SV/Genomes/hs37d5.fa \
-reduceInsertSizeDistributions \
-genomeMaskFile /users/johnb/SV/Genomes/hs37d5.mask.fa \
-genderMapFile OUTPUT3/gender.map \
-runDirectory OUTPUT3/AS_CLL_156GL \
-md OUTPUT3/AS_CLL_156GL/metadata \
-computeGCProfiles \
-copyNumberMaskFile /users/johnb/SV/Genomes/hs37d5.cn2mask.fa \
-jobLogDir OUTPUT3/AS_CLL_156GL/logs \
-I AS_CLL_156GL.bam
Contents of OUTPUT3/AS_CLL_156GL/logs/SVPreprocess-11.out:
INFO 12:54:38,270 HelpFormatter -
----------------------------------------------------------
INFO 12:54:38,272 HelpFormatter - Program Name:
org.broadinstitute.sv.apps.ComputeGCProfiles
INFO 12:54:38,275 HelpFormatter - Program Args: -I
/gpfs1/well/htseq/ILLUMINA-WGS/SV-Freeze5/AS_CLL_156GL.bam -O
/gpfs1/well/htseq/ILLUMINA-WGS/SV-Freeze5/OUTPUT3/AS_CLL_156GL/metadata/gcprofile/AS_CLL_156GL.bam.gcprof.zip
-R /users/johnb/SV/Genomes/hs37d5.fa -md OUTPUT3/AS_CLL_156GL/metadata
-referenceProfile
OUTPUT3/AS_CLL_156GL/metadata/gcprofile/reference.gcprof.zip
-genomeMaskFile /users/johnb/SV/Genomes/hs37d5.mask.fa -copyNumberMaskFile
/users/johnb/SV/Genomes/hs37d5.cn2mask.fa -configFile conf/hs37d5.conf
INFO 12:54:38,276 HelpFormatter - Date/Time: 2013/05/23 12:54:38
INFO 12:54:38,276 HelpFormatter -
----------------------------------------------------------
INFO 12:54:38,276 HelpFormatter -
----------------------------------------------------------
INFO 12:54:38,298 ComputeGCProfiles - Opening reference sequence ...
INFO 12:54:38,299 ComputeGCProfiles - Opened reference sequence.
INFO 12:54:38,299 ComputeGCProfiles - Opening genome mask ...
INFO 12:54:38,299 ComputeGCProfiles - Opened genome mask.
INFO 12:54:38,300 ComputeGCProfiles - Opening copy number mask ...
INFO 12:54:38,300 ComputeGCProfiles - Opened copy number mask.
INFO 12:54:38,300 ComputeGCProfiles - Initializing algorithm ...
#INFO: ReadCountAlgorithm: detected metadata version 1, forcing legacy
behavior
INFO 12:54:38,338 ComputeGCProfiles - Algorithm initialized.
INFO 12:54:38,338 ComputeGCProfiles - Opening reference GC profile ...
INFO 12:54:38,365 ComputeGCProfiles - Opened reference GC profile.
INFO 12:54:38,366 ComputeGCProfiles - Processing input file
org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ...
Exception in thread "main" java.lang.RuntimeException: Invalid sequence
position: 17:81195230
at
org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:46)
at
org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:237)
at
org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:147)
at
org.broadinstitute.sv.commandline.CommandLineProgram.run(CommandLineProgram.java:24)
at
org.broadinstitute.sv.apps.ComputeGCProfiles.main(ComputeGCProfiles.java:120)
Caused by: java.lang.IllegalArgumentException: Invalid sequence position:
17:81195230
at
org.broadinstitute.sv.mask.GenomeMaskFastaFile.getMaskBit(GenomeMaskFastaFile.java:80)
at
org.broadinstitute.sv.metadata.gc.GCProfileAlgorithm.processRecord(GCProfileAlgorithm.java:107)
at
org.broadinstitute.sv.metadata.gc.GCProfileAlgorithm.processSAMFile(GCProfileAlgorithm.java:124)
at
org.broadinstitute.sv.apps.ComputeGCProfiles.run(ComputeGCProfiles.java:181)
at
org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:38)
... 4 more
On Tue, May 28, 2013 at 9:24 PM, <
svt...@li...> wrote:
> Send svtoolkit-help mailing list submissions to
> svt...@li...
>
> To subscribe or unsubscribe via the World Wide Web, visit
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help
> or, via email, send a message with subject or body 'help' to
> svt...@li...
>
> You can reach the person managing the list at
> svt...@li...
>
> When replying, please edit your Subject line so it is more specific
> than "Re: Contents of svtoolkit-help digest..."
>
>
> Today's Topics:
>
> 1. "Invalid sequence position" (John Broxholme)
> 2. Re: "Invalid sequence position" (Bob Handsaker)
> 3. Re: "Invalid sequence position" (John Broxholme)
> 4. Re: "Invalid sequence position" (Bob Handsaker)
>
>
> ----------------------------------------------------------------------
>
> Message: 1
> Date: Thu, 23 May 2013 15:21:57 +0100
> From: John Broxholme <jo...@we...>
> Subject: [svtoolkit-help] "Invalid sequence position"
> To: svt...@li...
> Cc: Linda Hughes <li...@we...>
> Message-ID:
> <CADGtfyC7wyVAqJfRO3SAwEPVuhGQtjrGJMrZxu3B=
> Xjv...@ma...>
> Content-Type: text/plain; charset="utf-8"
>
> Pre-processing of one(of 270+) deep BAM files has failed with:
>
> ...
> INFO 12:54:38,366 ComputeGCProfiles - Processing input file
> org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ...
> Exception in thread "main" java.lang.RuntimeException: Invalid sequence
> position: 17:81195230
> ...
>
> Where would this have come from? The pipeline has been the same to prepare
> all 270+ of the (25x deep) BAMs, and this is the only failure. Any
> suggestions on what might be wrong and how to fix it will be most welcome!
>
> Thanks
> John
>
> --
> John Broxholme
> Wellcome Trust Centre for Human Genetics
> Roosevelt Drive, Oxford, OX3 7BN, UK
> -------------- next part --------------
> An HTML attachment was scrubbed...
>
> ------------------------------
>
> Message: 2
> Date: Thu, 23 May 2013 10:35:31 -0400
> From: Bob Handsaker <han...@br...>
> Subject: Re: [svtoolkit-help] "Invalid sequence position"
> To: svt...@li...
> Message-ID: <519...@br...>
> Content-Type: text/plain; charset="iso-8859-1"
>
> Including the stack trace would be most helpful.
> If you are using an hg19-based reference, then chr17 is only 81195210 long.
> Does ValidateSamFile like this bam?
> This may be related to the bwa idiosyncracy of occasionally leaving
> nominally-invalid POS fields in unmapped records.
> If so, I will try to fix it if you can send me the command line and
> stack trace.
> -Bob
>
> On 5/23/13 10:21 AM, John Broxholme wrote:
> > Pre-processing of one(of 270+) deep BAM files has failed with:
> >
> > ...
> > INFO ? 12:54:38,366 ComputeGCProfiles - Processing input file
> > org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ...?
> > Exception in thread "main" java.lang.RuntimeException: Invalid
> > sequence position: 17:81195230
> > ...
> >
> > Where would this have come from? ? The pipeline has been the same? to
> > prepare all 270+ of the (25x deep) BAMs, and this is the only failure.
> > ? Any suggestions on what might be wrong and how to fix it will be
> > most welcome!
> >
> > Thanks
> > John
> >
> > --
> > John Broxholme
> > Wellcome Trust Centre for Human Genetics
> > Roosevelt Drive, Oxford, OX3 7BN, UK
> >
> >
> >
> >
> ------------------------------------------------------------------------------
> > Try New Relic Now & We'll Send You this Cool Shirt
> > New Relic is the only SaaS-based application performance monitoring
> service
> > that delivers powerful full stack analytics. Optimize and monitor your
> > browser, app, & servers with just a few lines of code. Try New Relic
> > and get this awesome Nerd Life shirt!
> http://p.sf.net/sfu/newrelic_d2d_may
> >
> >
> > _______________________________________________
> > svtoolkit-help mailing list
> > svt...@li...
> > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help
>
> -------------- next part --------------
> An HTML attachment was scrubbed...
>
> ------------------------------
>
> Message: 3
> Date: Tue, 28 May 2013 15:37:18 +0100
> From: John Broxholme <jo...@we...>
> Subject: Re: [svtoolkit-help] "Invalid sequence position"
> To: svt...@li...
> Cc: Linda Hughes <li...@we...>
> Message-ID:
> <
> CAD...@ma...>
> Content-Type: text/plain; charset="utf-8"
>
> Hi Bob,
>
> Thanks for the quick response. Yes it is NCBI build37 (actually the 1000G
> reference with decoy). I can fill in a bit more detail on this. The error
> I sent earlier was using svtoolkit build 1.04.1068 (which I couldn't use at
> first since dependency on some new(?) R package required an upgrade of R).
> I first saw this using our production version, build 1.04.857:
>
> ...
> INFO 11:41:09,579 ComputeGCProfiles - Opened reference GC profile.
> INFO 11:41:09,579 ComputeGCProfiles - Processing input file
> /gpfs1/well/htseq/ILLUMINA-WGS/SV-Freeze5/AS_CLL_156GL.bam ...
> Exception in thread "main" java.lang.RuntimeException: Invalid sequence
> position: 17:81195216
> at
>
> org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:40)
> at
>
> org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
> at
>
> org.broadinstitute.sv.commandline.CommandLineProgram.run(CommandLineProgram.java:23)
> at
>
> org.broadinstitute.sv.apps.ComputeGCProfiles.main(ComputeGCProfiles.java:104)
> Caused by: java.lang.IllegalArgumentException: Invalid sequence position:
> 17:81195216
> ...
> I note that the invalid coordinate reported differs - 81195216 vs 81195230,
> although this is the same BAM.
>
> Anyhow, I have since updated picard-tools to 1.92 and run 'picard
> validateSamFile on the offending BAM
> The only error (in 10k errors) I see is "Mate not found for paired read" (I
> see many of these) which I assume has been caused by deduping (I used
> picard for this).
> Meanwhile I have removed reads mapping to the last 100bp of chr17 from that
> BAM, which is an ugly fix but it allows me to progress a bit.
> And I have to resolve something else causing crashes with the current
> (1.04.1068) version, which would be the subject of another thread...
>
> John
>
> On Thu, May 23, 2013 at 3:21 PM, John Broxholme <jo...@we...>
> wrote:
>
> > Pre-processing of one(of 270+) deep BAM files has failed with:
> >
> > ...
> > INFO 12:54:38,366 ComputeGCProfiles - Processing input file
> > org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ...
> > Exception in thread "main" java.lang.RuntimeException: Invalid sequence
> > position: 17:81195230
> > ...
> >
> > Where would this have come from? The pipeline has been the same to
> > prepare all 270+ of the (25x deep) BAMs, and this is the only failure.
> Any
> > suggestions on what might be wrong and how to fix it will be most
> welcome!
> >
> > Thanks
> > John
> >
> > --
> > John Broxholme
> > Wellcome Trust Centre for Human Genetics
> > Roosevelt Drive, Oxford, OX3 7BN, UK
> >
> >
>
>
> --
> John Broxholme
> Wellcome Trust Centre for Human Genetics
> Roosevelt Drive, Oxford, OX3 7BN, UK
> Tel: (+44 1865) 287611 FAX: 287697
> -------------- next part --------------
> An HTML attachment was scrubbed...
>
> ------------------------------
>
> Message: 4
> Date: Tue, 28 May 2013 16:23:48 -0400
> From: Bob Handsaker <han...@br...>
> Subject: Re: [svtoolkit-help] "Invalid sequence position"
> To: svt...@li...
> Message-ID: <51A...@br...>
> Content-Type: text/plain; charset="iso-8859-1"
>
> This doesn't look like the entire stack trace. Did you truncate it?
> I'm happy to try to help, but you need to send me the full stack trace
> and you should send the full command line as well.
> -Bob
>
> On 5/28/13 10:37 AM, John Broxholme wrote:
> > Hi Bob,
> >
> > Thanks for the quick response. ? Yes it is NCBI build37 (actually the
> > 1000G reference with decoy). ? I can fill in a bit more detail on
> > this. ? The error I sent earlier was using svtoolkit build 1.04.1068
> > (which I couldn't use at first since dependency on some new(?) R
> > package required an upgrade of R). ? I first saw this using our
> > production version, build 1.04.857:
> >
> > ...
> > INFO ? 11:41:09,579 ComputeGCProfiles - Opened reference GC profile.?
> > INFO ? 11:41:09,579 ComputeGCProfiles - Processing input file
> > /gpfs1/well/htseq/ILLUMINA-WGS/SV-Freeze5/AS_CLL_156GL.bam ...?
> > Exception in thread "main" java.lang.RuntimeException: Invalid
> > sequence position: 17:81195216
> > ? ? ? ? at
> >
> org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:40)
> > ? ? ? ? at
> >
> org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
> > ? ? ? ? at
> >
> org.broadinstitute.sv.commandline.CommandLineProgram.run(CommandLineProgram.java:23)
> > ? ? ? ? at
> >
> org.broadinstitute.sv.apps.ComputeGCProfiles.main(ComputeGCProfiles.java:104)
> > Caused by: java.lang.IllegalArgumentException: Invalid sequence
> > position: 17:81195216
> > ...
> > I note that the invalid coordinate reported differs -? 81195216
> > vs? 81195230, although this is the same BAM.
> >
> > Anyhow, I have since updated picard-tools to 1.92 and run 'picard
> > validateSamFile on the offending BAM
> > The only error (in 10k errors) I see is "Mate not found for paired
> > read" (I see many of these) which I assume has been caused by deduping
> > (I used picard for this).
> > Meanwhile I have removed reads mapping to the last 100bp of chr17 from
> > that BAM, which is an ugly fix but it allows me to progress a bit.
> > And I have to resolve something else causing crashes with the current
> > (1.04.1068) version, which would be the subject of another thread...
> >
> > John
> >
> > On Thu, May 23, 2013 at 3:21 PM, John Broxholme <jo...@we...
> > <mailto:jo...@we...>> wrote:
> >
> > Pre-processing of one(of 270+) deep BAM files has failed with:
> >
> > ...
> > INFO ? 12:54:38,366 ComputeGCProfiles - Processing input file
> > org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ...?
> > Exception in thread "main" java.lang.RuntimeException: Invalid
> > sequence position: 17:81195230
> > ...
> >
> > Where would this have come from? ? The pipeline has been the
> > same? to prepare all 270+ of the (25x deep) BAMs, and this is the
> > only failure. ? Any suggestions on what might be wrong and how to
> > fix it will be most welcome!
> >
> > Thanks
> > John
> >
> > --
> > John Broxholme
> > Wellcome Trust Centre for Human Genetics
> > Roosevelt Drive, Oxford, OX3 7BN, UK
> >
> >
> >
> >
> > --
> > John Broxholme
> > Wellcome Trust Centre for Human Genetics
> > Roosevelt Drive, Oxford, OX3 7BN, UK
> > Tel: (+44 1865) 287611 <tel:%28%2B44%201865%29%20287611> FAX: 287697
> >
> >
> >
> ------------------------------------------------------------------------------
> > Try New Relic Now & We'll Send You this Cool Shirt
> > New Relic is the only SaaS-based application performance monitoring
> service
> > that delivers powerful full stack analytics. Optimize and monitor your
> > browser, app, & servers with just a few lines of code. Try New Relic
> > and get this awesome Nerd Life shirt!
> http://p.sf.net/sfu/newrelic_d2d_may
> >
> >
> > _______________________________________________
> > svtoolkit-help mailing list
> > svt...@li...
> > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help
>
> -------------- next part --------------
> An HTML attachment was scrubbed...
>
> ------------------------------
>
>
> ------------------------------------------------------------------------------
> Introducing AppDynamics Lite, a free troubleshooting tool for Java/.NET
> Get 100% visibility into your production application - at no cost.
> Code-level diagnostics for performance bottlenecks with <2% overhead
> Download for free and get started troubleshooting in minutes.
> http://p.sf.net/sfu/appdyn_d2d_ap1
>
> ------------------------------
>
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help
>
>
> End of svtoolkit-help Digest, Vol 23, Issue 1
> *********************************************
>
--
John Broxholme
Wellcome Trust Centre for Human Genetics
Roosevelt Drive, Oxford, OX3 7BN, UK
Tel: (+44 1865) 287611 FAX: 287697
|
|
From: Bob H. <han...@br...> - 2013-05-28 20:23:59
|
This doesn't look like the entire stack trace. Did you truncate it? I'm happy to try to help, but you need to send me the full stack trace and you should send the full command line as well. -Bob On 5/28/13 10:37 AM, John Broxholme wrote: > Hi Bob, > > Thanks for the quick response.  Yes it is NCBI build37 (actually the > 1000G reference with decoy).  I can fill in a bit more detail on > this.  The error I sent earlier was using svtoolkit build 1.04.1068 > (which I couldn't use at first since dependency on some new(?) R > package required an upgrade of R).  I first saw this using our > production version, build 1.04.857: > > ... > INFO  11:41:09,579 ComputeGCProfiles - Opened reference GC profile. > INFO  11:41:09,579 ComputeGCProfiles - Processing input file > /gpfs1/well/htseq/ILLUMINA-WGS/SV-Freeze5/AS_CLL_156GL.bam ... > Exception in thread "main" java.lang.RuntimeException: Invalid > sequence position: 17:81195216 >     at > org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:40) >     at > org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221) >     at > org.broadinstitute.sv.commandline.CommandLineProgram.run(CommandLineProgram.java:23) >     at > org.broadinstitute.sv.apps.ComputeGCProfiles.main(ComputeGCProfiles.java:104) > Caused by: java.lang.IllegalArgumentException: Invalid sequence > position: 17:81195216 > ... > I note that the invalid coordinate reported differs - 81195216 > vs 81195230, although this is the same BAM. > > Anyhow, I have since updated picard-tools to 1.92 and run 'picard > validateSamFile on the offending BAM > The only error (in 10k errors) I see is "Mate not found for paired > read" (I see many of these) which I assume has been caused by deduping > (I used picard for this). > Meanwhile I have removed reads mapping to the last 100bp of chr17 from > that BAM, which is an ugly fix but it allows me to progress a bit. > And I have to resolve something else causing crashes with the current > (1.04.1068) version, which would be the subject of another thread... > > John > > On Thu, May 23, 2013 at 3:21 PM, John Broxholme <jo...@we... > <mailto:jo...@we...>> wrote: > > Pre-processing of one(of 270+) deep BAM files has failed with: > > ... > INFO  12:54:38,366 ComputeGCProfiles - Processing input file > org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ... > Exception in thread "main" java.lang.RuntimeException: Invalid > sequence position: 17:81195230 > ... > > Where would this have come from?  The pipeline has been the > same to prepare all 270+ of the (25x deep) BAMs, and this is the > only failure.  Any suggestions on what might be wrong and how to > fix it will be most welcome! > > Thanks > John > > -- > John Broxholme > Wellcome Trust Centre for Human Genetics > Roosevelt Drive, Oxford, OX3 7BN, UK > > > > > -- > John Broxholme > Wellcome Trust Centre for Human Genetics > Roosevelt Drive, Oxford, OX3 7BN, UK > Tel: (+44 1865) 287611 <tel:%28%2B44%201865%29%20287611> FAX: 287697 > > > ------------------------------------------------------------------------------ > Try New Relic Now & We'll Send You this Cool Shirt > New Relic is the only SaaS-based application performance monitoring service > that delivers powerful full stack analytics. Optimize and monitor your > browser, app, & servers with just a few lines of code. Try New Relic > and get this awesome Nerd Life shirt! http://p.sf.net/sfu/newrelic_d2d_may > > > _______________________________________________ > svtoolkit-help mailing list > svt...@li... > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help |
|
From: John B. <jo...@we...> - 2013-05-28 14:37:28
|
Hi Bob,
Thanks for the quick response. Yes it is NCBI build37 (actually the 1000G
reference with decoy). I can fill in a bit more detail on this. The error
I sent earlier was using svtoolkit build 1.04.1068 (which I couldn't use at
first since dependency on some new(?) R package required an upgrade of R).
I first saw this using our production version, build 1.04.857:
...
INFO 11:41:09,579 ComputeGCProfiles - Opened reference GC profile.
INFO 11:41:09,579 ComputeGCProfiles - Processing input file
/gpfs1/well/htseq/ILLUMINA-WGS/SV-Freeze5/AS_CLL_156GL.bam ...
Exception in thread "main" java.lang.RuntimeException: Invalid sequence
position: 17:81195216
at
org.broadinstitute.sv.commandline.CommandLineProgram.execute(CommandLineProgram.java:40)
at
org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
at
org.broadinstitute.sv.commandline.CommandLineProgram.run(CommandLineProgram.java:23)
at
org.broadinstitute.sv.apps.ComputeGCProfiles.main(ComputeGCProfiles.java:104)
Caused by: java.lang.IllegalArgumentException: Invalid sequence position:
17:81195216
...
I note that the invalid coordinate reported differs - 81195216 vs 81195230,
although this is the same BAM.
Anyhow, I have since updated picard-tools to 1.92 and run 'picard
validateSamFile on the offending BAM
The only error (in 10k errors) I see is "Mate not found for paired read" (I
see many of these) which I assume has been caused by deduping (I used
picard for this).
Meanwhile I have removed reads mapping to the last 100bp of chr17 from that
BAM, which is an ugly fix but it allows me to progress a bit.
And I have to resolve something else causing crashes with the current
(1.04.1068) version, which would be the subject of another thread...
John
On Thu, May 23, 2013 at 3:21 PM, John Broxholme <jo...@we...> wrote:
> Pre-processing of one(of 270+) deep BAM files has failed with:
>
> ...
> INFO 12:54:38,366 ComputeGCProfiles - Processing input file
> org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ...
> Exception in thread "main" java.lang.RuntimeException: Invalid sequence
> position: 17:81195230
> ...
>
> Where would this have come from? The pipeline has been the same to
> prepare all 270+ of the (25x deep) BAMs, and this is the only failure. Any
> suggestions on what might be wrong and how to fix it will be most welcome!
>
> Thanks
> John
>
> --
> John Broxholme
> Wellcome Trust Centre for Human Genetics
> Roosevelt Drive, Oxford, OX3 7BN, UK
>
>
--
John Broxholme
Wellcome Trust Centre for Human Genetics
Roosevelt Drive, Oxford, OX3 7BN, UK
Tel: (+44 1865) 287611 FAX: 287697
|
|
From: Bob H. <han...@br...> - 2013-05-23 14:35:45
|
Including the stack trace would be most helpful. If you are using an hg19-based reference, then chr17 is only 81195210 long. Does ValidateSamFile like this bam? This may be related to the bwa idiosyncracy of occasionally leaving nominally-invalid POS fields in unmapped records. If so, I will try to fix it if you can send me the command line and stack trace. -Bob On 5/23/13 10:21 AM, John Broxholme wrote: > Pre-processing of one(of 270+) deep BAM files has failed with: > > ... > INFO  12:54:38,366 ComputeGCProfiles - Processing input file > org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ... > Exception in thread "main" java.lang.RuntimeException: Invalid > sequence position: 17:81195230 > ... > > Where would this have come from?  The pipeline has been the same to > prepare all 270+ of the (25x deep) BAMs, and this is the only failure. >  Any suggestions on what might be wrong and how to fix it will be > most welcome! > > Thanks > John > > -- > John Broxholme > Wellcome Trust Centre for Human Genetics > Roosevelt Drive, Oxford, OX3 7BN, UK > > > > ------------------------------------------------------------------------------ > Try New Relic Now & We'll Send You this Cool Shirt > New Relic is the only SaaS-based application performance monitoring service > that delivers powerful full stack analytics. Optimize and monitor your > browser, app, & servers with just a few lines of code. Try New Relic > and get this awesome Nerd Life shirt! http://p.sf.net/sfu/newrelic_d2d_may > > > _______________________________________________ > svtoolkit-help mailing list > svt...@li... > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help |
|
From: John B. <jo...@we...> - 2013-05-23 14:22:05
|
Pre-processing of one(of 270+) deep BAM files has failed with: ... INFO 12:54:38,366 ComputeGCProfiles - Processing input file org.broadinstitute.sv.dataset.SAMFileLocation@986cff74 ... Exception in thread "main" java.lang.RuntimeException: Invalid sequence position: 17:81195230 ... Where would this have come from? The pipeline has been the same to prepare all 270+ of the (25x deep) BAMs, and this is the only failure. Any suggestions on what might be wrong and how to fix it will be most welcome! Thanks John -- John Broxholme Wellcome Trust Centre for Human Genetics Roosevelt Drive, Oxford, OX3 7BN, UK |
|
From: Bob H. <han...@br...> - 2013-03-07 13:56:26
|
In Genome STRiP, most of the command line arguments that accept multiple values will let you pass them one of two ways (this includes -I for input bam files): -I single.bam -I file1.bam -I file2.bam -I file3.bam -I filelist.list To use the last form, the filename _must_ end in ".list" and you should list the input arguments (in this case bam files) one per line in the file. -Bob On 3/7/13 3:16 AM, lishiyong wrote: > Hi: > I have 22 samples(11 tumour samples and 11 matched adjacent non-tumour > samples). Each sample has been sequenced almost 50X whole genome. I > want to use the genome-strip to detect the SV. But it would take too > much time to merge into one bam,and too much memory to storage the > bam. Could it get a list of each sample's bam as the input? or is > There another way to solve this problem? > Best wishes to you. > Shiyong li > > > ------------------------------------------------------------------------------ > Symantec Endpoint Protection 12 positioned as A LEADER in The Forrester > Wave(TM): Endpoint Security, Q1 2013 and "remains a good choice" in the > endpoint security space. For insight on selecting the right partner to > tackle endpoint security challenges, access the full report. > http://p.sf.net/sfu/symantec-dev2dev > > > _______________________________________________ > svtoolkit-help mailing list > svt...@li... > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help |
3 messages has been excluded from this view by a project administrator.
