I'm using a library preperation protocol, that adds a random nonamer to the end of my insert. It is 5' to the adapter and hence I need to trim it off. Currently, my workflow entails trimming the adapter first with cutadapt or BBduk and then running the 3' end hard clip of 10 bp again. This is a huge waste of computational time. Since Skewer is very good for my use but lacks the user defined hard trimming option, I have the follwoing request. Would it be possible to add an option like this:
--hardTrim3 10
example of BBduk command:
bbduk2.sh \
in=reads.fq \
out=stdin.out \
rliteral=GATCGGAAGAGCACACGTCT \
mink=3 \
trimq=13 \
ktrim=r | \
bbduk2.sh \
in=stdin.fq \
out=reads.trimed.fq \
forcetrimright2=10 \
minlength=20 \
overwrite=true
which would trim 10 bp of the 3' end, AFTER the adapter has been removed. However, to ensure proper aligning, I need to hard trim 10 bp of the 3' end even from reads that do not contain an adapter. Hence this option would need to trim 10 bp at the 3' end of each read of both adapter containing reads as well as adapter less reads. I'm using it in single end sequencing currently if that helps.
Thanks and congrats for Skewer - I think it is really outstanding!