Re: [Samtools-help] align to fasta DB with names

[Thomas W. B. <tb...@um...>]

The .fasta header line in the example below appears to have a space 
character in between '>' and 'EBV-MIR-BART13'.  Most aligners report 
the string of characters following '>' up to and not including the 
first whitespace character as the query sequence identifier.  For 
this example, that will be the empty string.

Don't be embarrassed.  I got caught by this too, many, many years ago, 
and had to have it explained to me.  It seems perfectly reasonable that 
one could add a space for readability, but that's not what's expected.

 	 	 	 	 	 	 	-  tom blackwell  -

On Tue, 27 May 2014, Lana Schaffer wrote:

> Tom,
> Sorry I am talking about the header in the fasta file, ie EBV-MIR-BART13 as
> In the example below:
>> EBV-MIR-BART13
> TGTAACTTGCCAGGGACGGCTGA
> Lana
>
> -----Original Message-----
> From: Thomas W. Blackwell [mailto:tb...@um...]
> Sent: Tuesday, May 27, 2014 10:58 AM
> To: Lana Schaffer
> Cc: Sam...@li...
> Subject: Re: [Samtools-help] align to fasta DB with names
>
>
> The usual hack is 'samtools view file.bam | cut -f 1 | sort | uniq -c'.
> If on Windows, you're on your own.
>
> 	 	 	 	 	 	 	-  tom blackwell  -
>
> On Tue, 27 May 2014, Lana Schaffer wrote:
>
>> Hi,
>> I am aligning to fasta DB of sequences and would like to count The
>> number of reads to each fasta entry by header names.
>> How do I designate to bowtie to store the names in the SAM File and
>> then use samtool to count them?
>>
>> Lana Schaffer
>> The Scripps Research Institute
>> Biostatistics, Informatics
>> DNA Array Core Facility
>> 858-784-2263
>>
>