Re: [Samtools-help] ArrayIndexOutOfBoundsException in CollectMultipleMetrics

SourceForge Headquarters 225 Broadway Suite 1600 San Diego, CA 92101 +1 (858) 454-5900

That sounds a bwa-backtrack bug. Could you reproduce the problem with a smaller sample file?

Thanks,

Heng

On Jul 18, 2013, at 1:47 PM, Gavin Sherlock <gsh...@st...> wrote:

> Alas, as soon as it's hits the first problem read, FixMateInformation dies with a SAM validation error:
> 
> Exception in thread "main" net.sf.samtools.SAMFormatException: SAM validation error: ERROR: Record 1, Read name MAGNUM:3:25:5065:10022#0, Alignment start should != 0 because reference name != *.
> 
> The data were originally aligned using bwa 0.75a
> 
> I can run FixMateInformation with VALIDATION_STRINGENCY set to silent, but the underlying problem then remains in place, and the resulting file still has the same issue that seems to be unfixable unfortunately.
> 
> When I look at the data for the offending read, I see:
> 
> MAGNUM:3:25:5065:10022#0	97	NC_002516.2	0	37	36M	=	455	491	ACCTGGGTTGACGACTTGAGGTCGCAGTGACCCCGT	IIIIIIIIIIIIIIIIHIIIIHIIIGIIGIIIIIII	X0:i:1	X1:i:0	MD:Z:0	RG:Z:GSRG000012	XG:i:0	AM:i:37	NM:i:0	SM:i:37	XM:i:1	XO:i:0	MQ:i:37	XT:A:U
> MAGNUM:3:25:5065:10022#0	145	NC_002516.2	455	37	36M	=	0	-491	CCGCCTTTCCAATCTTTGGGGGATATCCGTGTCCGT	IHGGIIHGIDIHGEIIIHIIIIIIIIIIIIIIIIII	X0:i:1	X1:i:0	MD:Z:36	RG:Z:GSRG000012	XG:i:0	AM:i:37	NM:i:0	SM:i:37	XM:i:0	XO:i:0	MQ:i:37	XT:A:U
> 
> Cheers,
> Gavin
> 
> On Jul 18, 2013, at 10:27 AM, Alec Wysoker wrote:
> 
>> Try Picard FixMateInformation
>> 
>> On Jul 18, 2013, at 12:38 PM, Gavin Sherlock <gsh...@st...> wrote:
>> 
>>> Thanks - I ran CleanSam, but still get exactly the same error when I try to run CollectAlignmentSummaryMetrics on the cleaned file.  I should note, that when I ran CleanSam, there were a handful (~30) of errors that ended with:
>>> 
>>> Alignment start should be != 0 because reference name != *.
>>> 
>>> or:
>>> 
>>> Mate Alignment start should be != 0 because reference name != *.
>>> 
>>> The same reads were mentioned for the two error types.
>>> 
>>> Cheers,
>>> Gavin
>>> 
>>> On Jul 18, 2013, at 8:43 AM, Alec Wysoker wrote:
>>> 
>>>> Hi Gavin,
>>>> 
>>>> Running ValidateSamFile should tell you what the problem is.  My guess is that you have a read that maps off the end of the reference.  You could run CleanSam, as described here: http://sourceforge.net/apps/mediawiki/picard/index.php?title=Main_Page#Q:___A_Picard_program_complains_that_CIGAR_M_operator_maps_off_the_end_of_reference.__I_want_this_record_to_be_treated_as_valid_despite_the_fact_that_the_alignment_end_is_greater_than_the_length_of_the_reference_sequence.
>>>> 
>>>> Setting VALIDATION_STRINGENCY=SILENT won't help in this case because CollectAlignmentSummaryMetrics tries to count mismatches.  
>>>> 
>>>> -Alec
>>>> 
>>>> 
>>>> On Jul 16, 2013, at 12:18 PM, Gavin Sherlock <gsh...@st...> wrote:
>>>> 
>>>>> Hi,
>>>>> 
>>>>> When running:
>>>>> 
>>>>> java -jar /usr/local/bin/CollectMultipleMetrics.jar I=/Volumes/Data/sherlock/Pseudomonas/110218_MAGNUM_00056_FC62DJ5_L3.sf.dedup.bam O=/Volumes/Data/sherlock/Pseudomonas/110218_MAGNUM_00056_FC62DJ5_L3.sf.dedup.statistics REFERENCE_SEQUENCE=/Volumes/Data/sherlock/Pseudomonas/PAO1_NC_002516.fasta VALIDATION_STRINGENCY=SILENT PROGRAM=CollectAlignmentSummaryMetrics PROGRAM=QualityScoreDistribution PROGRAM=MeanQualityByCycle
>>>>> 
>>>>> I get the following error:
>>>>> 
>>>>> [Tue Jul 16 09:16:28 PDT 2013] net.sf.picard.analysis.CollectMultipleMetrics INPUT=/Volumes/Data/sherlock/Pseudomonas/110218_MAGNUM_00056_FC62DJ5_L3.sf.dedup.bam REFERENCE_SEQUENCE=/Volumes/Data/sherlock/Pseudomonas/PAO1_NC_002516.fasta OUTPUT=/Volumes/Data/sherlock/Pseudomonas/110218_MAGNUM_00056_FC62DJ5_L3.sf.dedup.statistics PROGRAM=[CollectAlignmentSummaryMetrics, CollectInsertSizeMetrics, QualityScoreDistribution, MeanQualityByCycle, CollectAlignmentSummaryMetrics, QualityScoreDistribution, MeanQualityByCycle] VALIDATION_STRINGENCY=SILENT    ASSUME_SORTED=true STOP_AFTER=0 VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
>>>>> [Tue Jul 16 09:16:28 PDT 2013] Executing as <name_removed> on Mac OS X 10.8.4 x86_64; Java HotSpot(TM) 64-Bit Server VM 1.6.0_51-b11-457-11M4509; Picard version: 1.95(1496)
>>>>> [Tue Jul 16 09:16:28 PDT 2013] net.sf.picard.analysis.CollectMultipleMetrics done. Elapsed time: 0.00 minutes.
>>>>> Runtime.totalMemory()=85000192
>>>>> To get help, see http://picard.sourceforge.net/index.shtml#GettingHelp
>>>>> Exception in thread "main" java.lang.ArrayIndexOutOfBoundsException: -1
>>>>> 	at net.sf.picard.analysis.AlignmentSummaryMetricsCollector$GroupAlignmentSummaryMetricsPerUnitMetricCollector$IndividualAlignmentSummaryMetricsCollector.collectQualityData(AlignmentSummaryMetricsCollector.java:326)
>>>>> 	at net.sf.picard.analysis.AlignmentSummaryMetricsCollector$GroupAlignmentSummaryMetricsPerUnitMetricCollector$IndividualAlignmentSummaryMetricsCollector.addRecord(AlignmentSummaryMetricsCollector.java:224)
>>>>> 	at net.sf.picard.analysis.AlignmentSummaryMetricsCollector$GroupAlignmentSummaryMetricsPerUnitMetricCollector.acceptRecord(AlignmentSummaryMetricsCollector.java:147)
>>>>> 	at net.sf.picard.analysis.AlignmentSummaryMetricsCollector$GroupAlignmentSummaryMetricsPerUnitMetricCollector.acceptRecord(AlignmentSummaryMetricsCollector.java:122)
>>>>> 	at net.sf.picard.metrics.MultiLevelCollector$AllReadsDistributor.acceptRecord(MultiLevelCollector.java:174)
>>>>> 	at net.sf.picard.metrics.MultiLevelCollector.acceptRecord(MultiLevelCollector.java:277)
>>>>> 	at net.sf.picard.analysis.AlignmentSummaryMetricsCollector.acceptRecord(AlignmentSummaryMetricsCollector.java:66)
>>>>> 	at net.sf.picard.analysis.CollectAlignmentSummaryMetrics.acceptRead(CollectAlignmentSummaryMetrics.java:112)
>>>>> 	at net.sf.picard.analysis.SinglePassSamProgram.makeItSo(SinglePassSamProgram.java:119)
>>>>> 	at net.sf.picard.analysis.CollectMultipleMetrics.doWork(CollectMultipleMetrics.java:136)
>>>>> 	at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:177)
>>>>> 	at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:119)
>>>>> 	at net.sf.picard.analysis.CollectMultipleMetrics.main(CollectMultipleMetrics.java:100)
>>>>> 
>>>>> Does anyone have any suggestions as to what I might be doing wrong, or how I might troubleshoot it?
>>>>> 
>>>>> Many thanks,
>>>>> Gavin
>>>>> ------------------------------------------------------------------------------
>>>>> See everything from the browser to the database with AppDynamics
>>>>> Get end-to-end visibility with application monitoring from AppDynamics
>>>>> Isolate bottlenecks and diagnose root cause in seconds.
>>>>> Start your free trial of AppDynamics Pro today!
>>>>> http://pubads.g.doubleclick.net/gampad/clk?id=48808831&iu=/4140/ostg.clktrk
>>>>> _______________________________________________
>>>>> Samtools-help mailing list
>>>>> Sam...@li...
>>>>> https://lists.sourceforge.net/lists/listinfo/samtools-help
>>>> 
>>> 
>> 
> 
> 
> ------------------------------------------------------------------------------
> See everything from the browser to the database with AppDynamics
> Get end-to-end visibility with application monitoring from AppDynamics
> Isolate bottlenecks and diagnose root cause in seconds.
> Start your free trial of AppDynamics Pro today!
> http://pubads.g.doubleclick.net/gampad/clk?id=48808831&iu=/4140/ostg.clktrk
> _______________________________________________
> Samtools-help mailing list
> Sam...@li...
> https://lists.sourceforge.net/lists/listinfo/samtools-help

-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 