From: Marisa M. <mar...@ut...> - 2013-02-12 17:30:19
|
Hello, I have a .bsp file (output file from BSMAP) that I have converted to a SAM file. When I try to use samtools to convert it into a BAM file I get the following error message: [samopen] SAM header is present: 7 sequences. [sam_read1] reference '1803809' is recognized as '*'. Parse error at line 9: sequence and quality are inconsistent Aborted Shown below are the first lines of the input file: @SQ SN:1 LN:30427671 @SQ SN:2 LN:19698289 @SQ SN:3 LN:23459830 @SQ SN:4 LN:18585056 @SQ SN:5 LN:26975502 @SQ SN:mitochondria LN:366924 @SQ SN:chloroplast LN:154478 @PG ID:BSMAP_2.43 HWI-EAS157:7:1:748:1316#0/1 1803809 ++ 255 65M * 0 0 TTAGAGGTGGAGTGAATGGTAGTTTGTGAGGATGGAGGGGGTAGTGATTTAGATTGGAGAGTTG A UM NM:i:nC:1803809:1803810:1803821:1803825:1803828:1803832:1803835: 1803841:1803850:1803863:1803870 ZS:Z:0 HWI-EAS157:7:1:748:1814#0/1 10334968 -+ 255 65M * 0 0 ATGAAGATTTGAAACGCGGTAGTGGAAAATGTTGGAGGAAGGGAATTGTAGATGAT AAGAAATAG UM NM:i:nC:10335031:10335025:10335024:10335003:10335000:103 34987:10334986:10334977:10334970 ZS:Z:1 Do you have any ideas about how I can convert this file to a BAM file? Thank you, Marisa Miller -- PhD Candidate Z.Jeffrey Chen Lab The University of Texas at Austin 205 W. 24th St. Stop A4800 Austin, TX 78712 512-475-9335 |