[Samtools-help] SamToFastQ reverse complement question

[SHAUN W. <sw...@st...>]

Hi, I have a question about the picard tool SamToFastq. I have a bam  
file containing paired end reads and I have attempted to convert this  
back to fastq using the following code:

java -Xmx10g -jar SamToFastq.jar VALIDATION_STRINGENCY=LENIENT  
INPUT=$i FASTQ=$i.fq SECOND_END_FASTQ=$i.2.fq

The reads have been mapped with bwa and I have used lenient validation  
as Picard was complaining about some unmapped reads having a mapping  
quality>0. I'm not sure why bwa has given these reads a mapping  
quality, I suspect it is to do with the other pair but there are only  
~200 out of ~200,000,000 so not that bothered about them.

The main question I have is regarding reverse complement of sequence  
when converting to FastQ. I have the following paired end reads:

HS18_6811:3:1304:5092:136893    1145    chr1    3009956 25      75M     
  =       3009956 0        
CTCTTCCGATCTTTTTCCATTTTCCATTTTCTTTGATTGTTGTGCCGATGTTCTCTATGGAATCTTCTGCACCTG     
   
?ED@IIICKMBIK@KGGCJLBGHILKIMFIJGH<IJJKHJFIHLHLKIJHKOIAGFHJKL@DABJDJJIIIIFBC     
  X0:i:1  X1:i:0  MD:Z:0G1A2A0G68 RG:Z:1  XG:i:0  AM:i:0  NM:i:4   
SM:i:25 XM:i:4  XO:i:0  XT:A:U


HS18_6811:3:1304:5092:136893    181     chr1    3009956 0       *       
  =       3009956 0        
CTCTTCCGATCTCAGGTGCAGAAGATTCCATAGAGAACATCGGCACAACAATCAAAGAAAATGGAAAATGGAAAA     
   
CFD@DIDKNHJ@ILDEJHEEFEFHGJFDICCGL=DG5CI:FIHJGCJCILIE@LKKEFICGHGIEHIDFFF?*59     
  RG:Z:1


The first is mapped to the reverse strand and flagged correctly. The  
second is unmapped but bwa gives it the reverse strand flag as this is  
where it's pair is mapped. In the output FastQ files both sequences  
are reverse complemented. I am unsure whether the unmapped read  
sequence in the bam file is the original read sequence or is rc'd when  
the bam file is written? Does the picard tool just check for a reverse  
flag or does it look to see if the read is mapped also?

Thanks for any help

Shaun Webb

-- 
The University of Edinburgh is a charitable body, registered in
Scotland, with registration number SC005336.