Re: [Samtools-help] samTools on solaris 10: samtools view [main_samview] fail to open file for read

SourceForge Headquarters 1320 Columbia Street Suite 310 San Diego, CA 92101 +1 (858) 422-6466

Johanne  -

Ahhh.  Then maybe this is a compilation or linking issue.  Somehow, 
samtools is not succeeding in opening whatever filename it thinks it 
was passed.  'Fraid I won't be much help on porting across systems.

 	 	 	 	 	 	-  tom blackwell  -

On Mon, 21 Jun 2010, Duhaime Johanne wrote:

> Yes, the file is present and readable.
>
>> ls -l s_3.sam
> -rwxrwxrwx   1 duhaimj  si       5053665320 Jun 14 16:26 s_3.sam
>> /apps/programs/samtools view -bS ./s_3.sam > s_3_bam
> [main_samview] fail to open file for reading.
>> /apps/programs/samtools view -bS s_3.sam > s_3_bam
> [main_samview] fail to open file for reading.
>> more s_3.sam
> @HD     VN:1.0  SO:unsorted
> @SQ     SN:chr1 LN:197195432
> @SQ     SN:chr10        LN:129993255
> @SQ     SN:chr11        LN:121843856
> @SQ     SN:chr12        LN:121257530
> @SQ     SN:chr13        LN:120284312
> @SQ     SN:chr14        LN:125194864
> @SQ     SN:chr15        LN:103494974
> @SQ     SN:chr16        LN:98319150
> @SQ     SN:chr17        LN:95272651
> @SQ     SN:chr18        LN:90772031
> @SQ     SN:chr19        LN:61342430
> @SQ     SN:chr2 LN:181748087
> @SQ     SN:chr3 LN:159599783
> @SQ     SN:chr4 LN:155630120
> @SQ     SN:chr5 LN:152537259
> @SQ     SN:chr6 LN:149517037
> @SQ     SN:chr7 LN:152524553
> @SQ     SN:chr8 LN:131738871
> @SQ     SN:chr9 LN:124076172
> @SQ     SN:chrM LN:16299
> @SQ     SN:chrX LN:166650296
> @SQ     SN:chrY LN:15902555
> @PG     ID:Bowtie       VN:0.12.3       CL:"/apps/programs/bin/bowtie0.12.3 --solexa1.3-qual --best --trim5 1 --chunkmbs 1024 -S all
> mouse s_3_sequence.txt s_3.sam"
> HWUSI-EAS548_0001:3:1:995:4652#0/1      0       chr1    68788263        255     35M     *       0       0       GGGATGCTTCCTAATATTTA
> AGACTATCTTAAAGC ###################################     XA:i:1  MD:Z:2A32       NM:i:1
> HWUSI-EAS548_0001:3:1:999:14285#0/1     16      chr2    136278995       255     35M     *       0       0       TGGCATCTTAGTTTTCCATC
> CTTGGCCTTGTTCTC ###################################     XA:i:0  MD:Z:35 NM:i:0
> HWUSI-EAS548_0001:3:1:1000:9511#0/1     0       chr14   101137979       255     35M     *       0       0       ATCCAGGTAATCCAGGACAC
> AATGAGAAGACCAAA ###################################     XA:i:0  MD:Z:35 NM:i:0
> HWUSI-EAS548_0001:3:1:1001:11325#0/1    0       chr12   3110015 255     35M     *       0       0       CATCCACTTGACGACTTGAAAAATGACA
> ACATCAC ###################################     XA:i:0  MD:Z:29A5       NM:i:1
> HWUSI-EAS548_0001:3:1:1002:2352#0/1     16      chr3    9433229 255     35M     *       0       0       TTTTGAGTCAATAAACTCTTGGGAAGAT
> GTTTTCT ###################################     XA:i:0  MD:Z:35 NM:i:0
> HW
>
>
>
> Thank you
> -----Message d'origine-----
> De : Tom Blackwell [mailto:tb...@um...]
> Envoyé : 21 juin 2010 09:38
> À : Duhaime Johanne; Thomas W Blackwell
> Objet : RE: [Samtools-help] samTools on solaris 10: samtools view [main_samview] fail to open file for reading
>
> Johanne (off-list)  -
>
> Works for me.  Is the input file name spelled correctly ?  Is the
> input file in the current working directory ?  I would trust the
> samtools error message.
>
> 	 	 	 	 	-  tom blackwell  -
>
> On Mon, 21 Jun 2010, Duhaime Johanne wrote:
>
>> thank for the precision. But I still have the problem.
>>> /apps/programs/samtools view -bS s_3.sam > s_3_bam
>> [main_samview] fail to open file for reading.
>>
>> -----Message d'origine-----
>> De : Tom Blackwell [mailto:tb...@um...]
>> Envoyé : 21 juin 2010 09:26
>> À : Duhaime Johanne
>> Cc : Davide Cittaro; sam...@li...
>> Objet : Re: [Samtools-help] samTools on solaris 10: samtools view [main_samview] fail to open file for reading
>>
>> Johanne  -
>>
>> In the samtools command line, all flags come before the
>> input file name, and the output -- even in .bam format --
>> is written to stdout.  I would have used instead:
>>
>> /apps/programs/bin/samtools view -bS s_3.sam > s_3_bam
>>
>> 	 	 	 	 	-  tom blackwell  -
>>
>> On Mon, 21 Jun 2010, Duhaime Johanne wrote:
>>
>>> Thank you for your help
>>>
>>> 1-      about reading  sam file
>>>
>>> /apps/programs/bin/samtools view -S s_3.sam -b s_3_bam
>>>
>>> [main_samview] fail to open file for reading.
>>>
>>> 2-      about compiling in 64 bits
>>> I do have the libraries except libncurses.so.5 (which I think is necessary only for tview) in /lib/64 and /usr/lib/64. It would be nice to have your 64 binaries if possible. I will continue to try to compile samtools but meanwhile users could use it.
>>>
>>> Thank you very much
>>> Johanne
>>>
>>> De : Davide Cittaro [mailto:dav...@if...]
>>> Envoyé : 19 juin 2010 09:23
>>> À : Duhaime Johanne
>>> Cc : sam...@li...
>>> Objet : Re: [Samtools-help] samTools on solaris 10: samtools view [main_samview] fail to open file for reading
>>>
>>>
>>> On Jun 15, 2010, at 3:14 PM, Duhaime Johanne wrote:
>>>
>>>
>>> Hello
>>>
>>> I just installed samTools on Solaris 10 (SunOS 5.10 Generic_127128-11 i86pc i386 i86pc)  with samtools-0.1.7a.tar.bz2<http://sourceforge.net/projects/samtools/files/samtools/0.1.7/samtools-0.1.7a.tar.bz2/download>
>>>
>>> Installation went OK (I could not installed in 64 bits but this is another problem).
>>>
>>>
>>> I could... we can share some hints.
>>>
>>>
>>>
>>> But I cannot make the program work as shown below. The SAM file input is from "bowtie -S".
>>> Here are the many tries I have done:
>>> -chmod 777 on my input file
>>> -run the program as ROOT
>>> -looking on the web, someone suggests to run the program from the directory where it is installed, which I did.
>>> -run MACS with -aligner SAM which was a success (so my file is recognized as a Sam file)
>>>
>>> Don't be surprised about it... I've written SAM/BAM loader for MACS in a very loose format (and pure python...), so it doesn't make assumptions on file compliance...
>>> Can you post some rows of your file (which are in text format)? My samtools+solaris (actually nexenta) combination works fine
>>>
>>> $ uname -a
>>> SunOS host001.instruments 5.11 NexentaOS_134e i86pc i386 i86pc Solaris
>>>
>>> $ gcc --version
>>> gcc (GCC) 4.2.3 (Ubuntu 4.2.3-2nexenta7)
>>> Copyright (C) 2007 Free Software Foundation, Inc.
>>> This is free software; see the source for copying conditions.  There is NO
>>> warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
>>>
>>> I may provide you the 64-bit binaries, as you have these libraries:
>>>
>>>
>>> $ ldd `which samtools`
>>>        libm.so.2 =>     /lib/64/libm.so.2
>>>        libcurses.so.1 =>        /lib/64/libcurses.so.1
>>>        libz.so.1 =>     /usr/lib/64/libz.so.1
>>>        libsocket.so.1 =>        /lib/64/libsocket.so.1
>>>        libc.so.1 =>     /lib/64/libc.so.1
>>>        libgcc_s.so.1 =>         /lib/64/libgcc_s.so.1
>>>        libnsl.so.1 =>   /lib/64/libnsl.so.1
>>>        libmp.so.2 =>    /lib/64/libmp.so.2
>>>        libmd.so.1 =>    /lib/64/libmd.so.1
>>>        libscf.so.1 =>   /lib/64/libscf.so.1
>>>        libuutil.so.1 =>         /lib/64/libuutil.so.1
>>>        libgen.so.1 =>   /lib/64/libgen.so.1
>>>        libsmbios.so.1 =>        /usr/lib/64/libsmbios.so.1
>>>
>>> Otherwise I can build a static 32/64 bit executable.
>>>
>>> d
>>>
>>> /*
>>> Davide Cittaro
>>> Next Generation Sequencing and Microarray Data Analyst
>>> Cogentech - Consortium for Genomic Technologies
>>> via adamello, 16
>>> 20139 Milano
>>> Italy
>>>
>>> tel.: +39(02)574303007
>>> e-mail: dav...@if...<mailto:dav...@if...>
>>> */
>>>
>>>
>>>
>>>
>>>
>>>
>>
>>
>>
>
>
>