Menu
▾
▴
Re: [Samtools-help] samTools on solaris 10: samtools view [main_samview] fail to open file for reading
|
From: Duhaime J. <Joh...@ir...> - 2010-06-21 13:14:58
|
Thank you for your help 1- about reading sam file Here are the first lines from my SAM file > more s_3.sam @HD VN:1.0 SO:unsorted @SQ SN:chr1 LN:197195432 @SQ SN:chr10 LN:129993255 @SQ SN:chr11 LN:121843856 @SQ SN:chr12 LN:121257530 @SQ SN:chr13 LN:120284312 @SQ SN:chr14 LN:125194864 @SQ SN:chr15 LN:103494974 @SQ SN:chr16 LN:98319150 @SQ SN:chr17 LN:95272651 @SQ SN:chr18 LN:90772031 @SQ SN:chr19 LN:61342430 @SQ SN:chr2 LN:181748087 @SQ SN:chr3 LN:159599783 @SQ SN:chr4 LN:155630120 @SQ SN:chr5 LN:152537259 @SQ SN:chr6 LN:149517037 @SQ SN:chr7 LN:152524553 @SQ SN:chr8 LN:131738871 @SQ SN:chr9 LN:124076172 @SQ SN:chrM LN:16299 @SQ SN:chrX LN:166650296 @SQ SN:chrY LN:15902555 @PG ID:Bowtie VN:0.12.3 CL:"/apps/programs/bin/bowtie0.12.3 --solexa1.3-qual --best --trim5 1 --chunkmbs 1024 -S all mouse s_3_sequence.txt s_3.sam" HWUSI-EAS548_0001:3:1:995:4652#0/1 0 chr1 68788263 255 35M * 0 0 GGGATGCTTCCTAATATTTA AGACTATCTTAAAGC ################################### XA:i:1 MD:Z:2A32 NM:i:1 HWUSI-EAS548_0001:3:1:999:14285#0/1 16 chr2 136278995 255 35M * 0 0 TGGCATCTTAGTTTTCCATC CTTGGCCTTGTTCTC ################################### XA:i:0 MD:Z:35 NM:i:0 HWUSI-EAS548_0001:3:1:1000:9511#0/1 0 chr14 101137979 255 35M * 0 0 ATCCAGGTAATCCAGGACAC AATGAGAAGACCAAA ################################### XA:i:0 MD:Z:35 NM:i:0 HWUSI-EAS548_0001:3:1:1001:11325#0/1 0 chr12 3110015 255 35M * 0 0 CATCCACTTGACGACTTGAAAAATGACA ACATCAC ################################### XA:i:0 MD:Z:29A5 NM:i:1 HWUSI-EAS548_0001:3:1:1002:2352#0/1 16 chr3 9433229 255 35M * 0 0 TTTTGAGTCAATAAACTCTTGGGAAGAT GTTTTCT ################################### XA:i:0 MD:Z:35 NM:i:0 HWUSI-EAS548_0001:3:1:1004:10964#0/1 0 chr11 73437934 255 35M * 0 0 AGCTTTGCAGTTTCATGAGG TCCCATTTGTCAATC ################################### XA:i:0 MD:Z:35 NM:i:0 HWUSI-EAS548_0001:3:1:1004:11973#0/1 0 chr3 96938889 255 35M * 0 0 GAAGATAAAAGATGACTAAA TCTTTCTCTGCTGGT ################################### XA:i:0 MD:Z:35 NM:i:0 HWUSI-EAS548_0001:3:1:1004:15543#0/1 16 chr10 72153021 255 35M * 0 0 TCTTTCTTTCTTTCTTTCTT TCTTTCTTTCTTTCT ################################### XA:i:0 MD:Z:35 NM:i:0 HWUSI-EAS548_0001:3:1:1004:12740#0/1 16 chr16 3234679 255 35M * 0 0 GCAGATCTCCACTGTGCTGTGACATTGC TCCACTG ################################### XA:i:1 MD:Z:0A3T0A18G10 NM:i:4 HWUSI-EAS548_0001:3:1:1006:10120#0/1 4 * 0 0 * * 0 0 GTGAATAAAGGCGAAGAAATCTGAAAAA GGTGGAT ################################### XM:i:0 > /apps/programs/bin/samtools view -S s_3.sam -b s_3_bam [main_samview] fail to open file for reading. 2- about compiling in 64 bits I do have the libraries except libncurses.so.5 (which I think is necessary only for tview) in /lib/64 and /usr/lib/64. It would be nice to have your 64 binaries if possible. I will continue to try to compile samtools but meanwhile users could use it. Thank you very much Johanne De : Davide Cittaro [mailto:dav...@if...] Envoyé : 19 juin 2010 09:23 À : Duhaime Johanne Cc : sam...@li... Objet : Re: [Samtools-help] samTools on solaris 10: samtools view [main_samview] fail to open file for reading On Jun 15, 2010, at 3:14 PM, Duhaime Johanne wrote: Hello I just installed samTools on Solaris 10 (SunOS 5.10 Generic_127128-11 i86pc i386 i86pc) with samtools-0.1.7a.tar.bz2<http://sourceforge.net/projects/samtools/files/samtools/0.1.7/samtools-0.1.7a.tar.bz2/download> Installation went OK (I could not installed in 64 bits but this is another problem). I could... we can share some hints. But I cannot make the program work as shown below. The SAM file input is from "bowtie -S". Here are the many tries I have done: -chmod 777 on my input file -run the program as ROOT -looking on the web, someone suggests to run the program from the directory where it is installed, which I did. -run MACS with -aligner SAM which was a success (so my file is recognized as a Sam file) Don't be surprised about it... I've written SAM/BAM loader for MACS in a very loose format (and pure python...), so it doesn't make assumptions on file compliance... Can you post some rows of your file (which are in text format)? My samtools+solaris (actually nexenta) combination works fine $ uname -a SunOS host001.instruments 5.11 NexentaOS_134e i86pc i386 i86pc Solaris $ gcc --version gcc (GCC) 4.2.3 (Ubuntu 4.2.3-2nexenta7) Copyright (C) 2007 Free Software Foundation, Inc. This is free software; see the source for copying conditions. There is NO warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. I may provide you the 64-bit binaries, as you have these libraries: $ ldd `which samtools` libm.so.2 => /lib/64/libm.so.2 libcurses.so.1 => /lib/64/libcurses.so.1 libz.so.1 => /usr/lib/64/libz.so.1 libsocket.so.1 => /lib/64/libsocket.so.1 libc.so.1 => /lib/64/libc.so.1 libgcc_s.so.1 => /lib/64/libgcc_s.so.1 libnsl.so.1 => /lib/64/libnsl.so.1 libmp.so.2 => /lib/64/libmp.so.2 libmd.so.1 => /lib/64/libmd.so.1 libscf.so.1 => /lib/64/libscf.so.1 libuutil.so.1 => /lib/64/libuutil.so.1 libgen.so.1 => /lib/64/libgen.so.1 libsmbios.so.1 => /usr/lib/64/libsmbios.so.1 Otherwise I can build a static 32/64 bit executable. d /* Davide Cittaro Next Generation Sequencing and Microarray Data Analyst Cogentech - Consortium for Genomic Technologies via adamello, 16 20139 Milano Italy tel.: +39(02)574303007 e-mail: dav...@if...<mailto:dav...@if...> */ |
