|
From: Sean A. I. <sa...@xt...> - 2009-07-08 05:04:03
|
Thanks Bob and Alec for your input, it has helped resolved a couple of our issues, but we are still confused about some of the answers. If SAM is to support aligners that output multiple mappings, it seems that MRNM/MPOS should only be required if 0x0002 flag is set, since otherwise selection of any particular MRNM/MPOS would be arbitrary. The spec doesn't currently indicate under what conditions MRNM/MPOS are required, but the Java samtools requires MRNM/MPOS whenever 0x0008 indicates that a mapping exists for the mate. To help clarify what we are trying to achieve, consider the following contrived example with the following reference and a single read pair: > myref (reference sequence) TCCAGCTAAGGCTGCCTCACCACCGATTTTCGTATGGGGCCAGATATAGTGGACCTGTTGGAGCGTACAGATCCGGGCTT TTCTGAGTGTACTTTATTATATGAGCATATAATCTTCTGAGTGTACTTTATTATATGAGGAGAAGTCTTAACGAACAGTG TTCTGAGTGTACTTTATTATATGAGGCTGGACTATGATTAGGTCCTTACTCCCACGTCGAGCCGGTGGGTGCCTACCCAA TTTTTTTTTTTTTTTTTTTTTTTTTACCAGCTAAGGCTGCCTCACCACCGATTTTCGTATGGGGCCAGATATAGTGGACC TTTTTTTTTTTTTTTTTTTTTTTTTACCAGCTAAGGCTGCCTCACCACCGATTTTCGTATGGGGCCAGATATAGTGGACC > read-first (first read of the pair) TTCTGAGTGTACTTTATTATATGAG > read-second (second read of the pair) AAAAAAAAAAAAAAAAAAAAAAAAA Might produce individual read mappings of: #TEMPLATE FRAME READ-NAME TEMPLATE-START myref F read-first 81 myref F read-first 115 myref F read-first 161 myref R read-second 321 myref R read-second 241 Assuming no additional filtering of mappings, we might currently output the following SAM records (after identifying potential proper pairing for each mapping): read-first 73 myref 81 255 25M * 0 0 TTCTGAGTGTACTTTATTATATGAG * read-first 99 myref 115 255 25M = 241 151 TTCTGAGTGTACTTTATTATATGAG * read-first 99 myref 161 255 25M = 241 105 TTCTGAGTGTACTTTATTATATGAG * read-second 147 myref 241 255 25M = 161 -105 TTTTTTTTTTTTTTTTTTTTTTTTT * read-second 153 myref 321 255 25M * 0 0 TTTTTTTTTTTTTTTTTTTTTTTTT * The first mapping for read-first doesn't meet criteria for a proper pair with any of the read-second mappings. The alternatives that allow parsing by the JDK sam are: output a single record (as we have done above) with 0x0008 set to indicate the mate is unmapped (simply because we have no basis to prefer any of the other mappings); alternatively take the cross-product approach and output two SAM records, each one selecting a different one of the read-second mappings as its MRNM/MPOS (and allowing 0x0008 to be unset). This latter option seems to introduce a lot of redundancy for no real gain. >> 3. Sometimes reads can map with the 5'-end off the left of the reference; >> that is, with a nonpositive start position. The POS field requires a >> positive value for the start position. At present we are dealing with >> this by applying a hard clip to the left of the read. If we do this, >> then >> which start position should be used for the computation of the ISIZE >> field? (A similar problem can occur at the end of the reference, but >> it is less noticeable because it passes the current validation tests). >> > I think it would help me to know why the reads are aligning off the end > of the reference. > It is because the extra bases are vector or something? Or are they > garbage generated by the instrument? The reference used for mapping might not be an accurate representation of the sequenced genome. For example, the reference might consist of contigs, represent just coding regions, or be from a different species. In such cases it is not unreasonable that some reads will map overlap the ends of a reference sequence. >> 4. We would like to be able to report a count of the number of mappings >> in the case where there is a large number of mappings. That is, in the >> situation where a mapping is ambiguous we want to sometimes just report >> the number of mappings rather than any specific mapping. What is the >> recommended way of doing this? >> > There are the H0, H1 and H2 tags, although these are somewhat more > specific - would them do? > If you don't want to record any of the ambiguous mappings, then I think > you should flag the read as unmapped > (i.e. set flags 0x0004 and 0x0008 on the appropriate records). > Thus, to be more precise in this case, "is mapped" indicates whether the > aligner generated and stored in the sam file > at least one mapping for this read. We are pleased that this answer is broadly in line with the approach we have taken. Unfortunately, we cannot use H0, H1, and H2, because while we have a score for the ambiguous records we do not bother generating specific alignments for the ambiguous results and therefore do not know the precise count of differences. At present we are just using the tag "XC" to record the count, but perhaps a case could be made for inclusion of a tag like "HN" as a generalization of the H0, H1, and H2 tags. Is a revised draft of the SAM format specification going to be produced soon? It would seem a lot of questions in this forum could be answered if the specification were a little clearer. Regards, Sean |