Find/Replace's auto suggestion -- disable?

[J Grub]

Hi everyone--

I love Notepad++ but Find's auto-suggestion (of whatever "word" the cursor is in or next to) is starting to drive me bonkers. Is there a way to disable this feature? I've tried to search this forum and haven't found anything. I have npp version 6.3 on a Windows 7 machine.

Basically, I'm working with DNA sequences, often searching for one within the other, and having the box auto-suggest with the DNA sequence I'm searching within is starting to get very confusing.

Thanks!

[Loreia2]

Hi J Grub,

you cannot disable this feature. The only thing to do is to press down arrow to go back to previous search item.

On the other hand repeating previous search can be done without dialog, just by pressing F3. This is standard Windows shortcut and a preferred way to repeat search.

F3 - repeat last search
Shift+F3 - repeat last search in backward direction

Ctrl+F3 - start new search with item under cursor
Ctrl+Shift+F3 - start new search with item under cursor in backward direction

Once you get used to these shortcuts, Ctrl+f becomes necessary only when you want to change search options.

BR,
Loreia

[THEVENOT Guy]

Hello J Grub,

If you regularly use DNA sequences, you may be interested by the \G assertion, in regular expression searches.

Indeed, the \G assertion ** matches the cursor position. So it can matches 3 different** positions :

• The very beginning of a file

• The position just after the previous regular expression search

• The new position of the cursor, in case of voluntary move of the cursor, by the user

---

Let's consider a part of DNA code, set up of the 42 bases below, as the first and unique line of a new file :

TGAATTCTTGAATTCAAATGAAGGTTCTGACGTCATGATGAC

It's important to point out that I don't know if this test
sequence could be a legal biologic DNA sequence !!!

Anyway, in this sequence, it's easy to notice that :

• The three consecutive bases TGA, at underlined positions 1, 19 and 28, are true codons

• The three consecutive bases TGA, at positions 9, 36 and 39, are not true codons

So, if cursor is at the beginning of the DNA sequence, we can assert that :

---

• .*TGA selects the longest string of bases, ending by the three bases TGA

• (\w\w\w)*TGA selects the longest string of bases, multiple of 3 characters, ending by the three bases TGA

• \G(\w\w\w)*TGA selects the longest string of codons, ending with the codon TGA

---

• .*?TGA selects the shortest string of bases, ending by the three bases TGA

• (\w\w\w)*?TGA selects the shortest string of bases, multiple of 3 characters, ending by the three bases TGA

• \G(\w\w\w)*?TGA selects the shortest string of codons, ending with the codon TGA

Hope it's will be useful to you !

Cheers,

guy038