can't excute command: RNAfold

[Oleg]

Hi!

I am trying to run mirPro on the example data set, however I get following error:
RNAfold < ./run/SRR333598/novel/tmp/precursors.fa --noPS > ./run/SRR333598/novel/tmp/precursors.str

RNAfold 2.0 is installed and it functiones with mirDeep2.

Do you have any suggestions how ti fix this issue?

I use following command to run miRpro:

mirpro \
-i SRR333597.fastq \
-i SRR333598.fastq \
-i SRR333599.fastq \
-i SRR333600.fastq \
-d . \
-m mature.fa \
-p hairpin.fa \
-s mmu \
-a ATCTCGTATGCCGTCTTCTGCTTG \
-f miFam.dat \
--novel 1 \
--other rno \
-g Mus_musculus.GRCm38.dna.toplevel.fa \
--index Mus_musculus.GRCm38.dna.toplevel.idx \
-t 4

All the input files are in current dirrectory.

[Jieming Shi]

Please test with RNAfold version 2.1.9+.