gusdev-gusdev — Topics concerning GUS development

[Gusdev-gusdev] Error with WDK

[MICHAEL L. <lu...@cs...>]

Hello All-
Since the list has been quite for a couple of days, I will go ahead and
ask a question with regard to the (unsupported) WDK.
This is my first go 'round with tomcat-apache-mod_jk, but I believe that I
have it set up correctly.  I will give you my set-up:
Apache 1.3
Tomcat 4
workers.properties:

	worker.list=wrkr
	worker.wrkr.port=8009
	worker.wrkr.host=tcruzidb-gusdev.ctegd.uga.edu

server.xml(attached)

$CATALINA_HOME/webapps/tcruzidb-gusdev/WEB-INF/web.xml (attached)

relevant tcruzidb-gusdev.conf for apache:
	JkMount /*.jsp wrkr
	JkMount /servlets/* wrkr

relevant httpd.conf:
	JkWorkersFile "/usr/local/tomcat/conf/jk/workers.properties"
	JkLogFile "/usr/local/tomcat/logs/mod_jk.log"
	JkLogLevel debug
	JkLogStampFormat "[%a %b %d %H:%M:%S %Y]"

servlet.log:

	[Jan 29, 2004 2:59:07 PM] <ConnectionPool:MSG> An instance of
	oracle.jdbc.driver.OracleDriver has already been registered.
	[Jan 29, 2004 2:59:07 PM] <ConnectionPool:MSG> Opened JDBC connection 0 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:07 PM] <ConnectionPool:MSG> Opened JDBC connection 1 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:07 PM] <ConnectionPool:MSG> Opened JDBC connection 2 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 3 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 4 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 5 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 6 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 7 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:19 PM] <ProcessPool-seqAlignment-0:MSG> Init
	[Jan 29, 2004 2:59:20 PM] <ProcessPool-seqAlignment-1:MSG> Init
	[Jan 29, 2004 2:59:20 PM] <ProcessPool-seqAlignment-2:MSG> Init
	[Jan 29, 2004 2:59:20 PM] <ProcessPool-seqAlignment:MSG> initialized 3
	processes
	[Jan 29, 2004 2:59:21 PM] <ProcessPool-Motifs(G)-0:MSG> Init
	[Jan 29, 2004 2:59:22 PM] <ProcessPool-Motifs(G)-1:MSG> Init
	[Jan 29, 2004 2:59:22 PM] <ProcessPool-Motifs(G)-2:MSG> Init
	[Jan 29, 2004 2:59:22 PM] <ProcessPool-Motifs(G):MSG> initialized 3
	processes
	[Jan 29, 2004 2:59:23 PM] <ProcessPool-NRDB(G)-0:MSG> Init
	[Jan 29, 2004 2:59:23 PM] <ProcessPool-NRDB(G)-1:MSG> Init
	[Jan 29, 2004 2:59:24 PM] <ProcessPool-NRDB(G)-2:MSG> Init
	[Jan 29, 2004 2:59:24 PM] <ProcessPool-NRDB(G):MSG> initialized 3
	processes
	[Jan 29, 2004 2:59:25 PM] <ProcessPool-BLAT search-0:MSG> Init
	[Jan 29, 2004 2:59:25 PM] <ProcessPool-BLAT search-1:MSG> Init
	[Jan 29, 2004 2:59:25 PM] <ProcessPool-BLAT search:MSG> initialized 2
	processes
	[Jan 29, 2004 2:59:27 PM] <ProcessPool-Assembly(G)-0:MSG> Init
	[Jan 29, 2004 2:59:27 PM] <ProcessPool-Assembly(G)-1:MSG> Init
	[Jan 29, 2004 2:59:28 PM] <ProcessPool-Assembly(G)-2:MSG> Init
	[Jan 29, 2004 2:59:29 PM] <ProcessPool-Assembly(G)-3:MSG> Init
	[Jan 29, 2004 2:59:29 PM] <ProcessPool-Assembly(G)-4:MSG> Init
	[Jan 29, 2004 2:59:29 PM] <ProcessPool-Assembly(G):MSG> initialized 5
	processes
	[Jan 29, 2004 2:59:30 PM] <ProcessPool-Features(G)-0:MSG> Init
	[Jan 29, 2004 2:59:31 PM] <ProcessPool-Features(G)-1:MSG> Init
	[Jan 29, 2004 2:59:31 PM] <ProcessPool-Features(G)-2:MSG> Init
	[Jan 29, 2004 2:59:32 PM] <ProcessPool-Features(G)-3:MSG> Init
	[Jan 29, 2004 2:59:32 PM] <ProcessPool-Features(G)-4:MSG> Init
	[Jan 29, 2004 2:59:32 PM] <ProcessPool-Features(G):MSG>
	initialized 5 processes
	[Jan 29, 2004 2:59:34 PM] <ObjectFile:ERROR> No value provided for
	mandatory property gene.DefaultTaxonId
	[Jan 29, 2004 2:59:35 PM] <ObjectFile:ERROR> Could not determine class for
	dummyF
	[Jan 29, 2004 2:59:36 PM] <ProcessPool-sequence-0:MSG> Init
	[Jan 29, 2004 2:59:37 PM] <ProcessPool-sequence-1:MSG> Init
	[Jan 29, 2004 2:59:37 PM] <ProcessPool-sequence:MSG> initialized 2
	processes
	[Jan 29, 2004 2:59:38 PM] <SiteServlet:MSG> init() completed
	[Jan 29, 2004 2:59:38 PM] <SiteServlet:MSG> debug = true



I did an install of the WDK, just using the dotsgenes pages, but when I
try to follow a link for a server, for example for the URL:
http://tcruzidb-gusdev.ctegd.uga.edu/servlets/?page=query&showForm=1&query=locuslinkID
I get the following message:

Apache Tomcat/4.0.6 - HTTP Status 404 - /servlets/

type Status report

message /servlets/

description The requested resource (/servlets/) is not available.


What confuses me a little is that the URL does not request an obvious
servlet.  When looking at tomcat examples, the URL will reflect the name
of the servlet, and one can easily find the corresponding class file.
The contents of the servlets directory:
 servlets]# ls -l
total 600
-rwxr-xr-x    1 tomcat   tomcat     433964 Jan 29 14:33 gus-servlet.jar
drwxr-xr-x    2 tomcat   tomcat       4096 Jan 29 14:33 scripts
-rwxr-xr-x    1 tomcat   tomcat     161084 Jan 29 14:33 servlet-config
-rwxr-xr-x    1 tomcat   tomcat       3378 Jan 29 14:59 servlet.log
and the scripts:
 servlets]# ls scripts/ -l
total 36
-rwxr-xr-x    1 tomcat   tomcat        199 Jan 29 14:33 README
-rwxr-xr-x    1 tomcat   tomcat       1375 Jan 29 14:33 assemblyCAP2.pl
-rwxr-xr-x    1 tomcat   tomcat       1142 Jan 29 14:33 assemblyGraphic.pl
-rwxr-xr-x    1 tomcat   tomcat       4463 Jan 29 14:33 blatLink.pl
-rwxr-xr-x    1 tomcat   tomcat       1632 Jan 29 14:33 naSeq.pl
-rwxr-xr-x    1 tomcat   tomcat       1166 Jan 29 14:33 proteinGraphic.pl
-rwxr-xr-x    1 tomcat   tomcat       1159 Jan 29 14:33 rnaMotifs.pl
-rwxr-xr-x    1 tomcat   tomcat       1096 Jan 29 14:33 rnaProtSim.pl


I know that this e-mail is all over the place, but I'm not sure where the
problem lies and wanted to make sure that everyone had any necessary
information.
Can anyone give me some tips?



Michael Luchtan
http://www.cs.uga.edu/~luchtan

[Gusdev-gusdev] GBParser - problems with the perl modules

[Thomas O. <th...@gm...>]

Hello -

I am still fighting with the perl moduls.

I.e. the GBParser to upload Genbank datasets gives following error:
ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
--file=/seq/tcruzi_3.fcgi --commit

 ------------------ entry number 2 -----------------

 SQL ERROR!! involving
 
    INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
sequence_type_id, user_read, other_write, modification_date, subcla
ss_view, row_group_id, user_write, other_read, group_write,
external_database_release_id, source_id, g_count, c_count, taxon_id, nam
e, secondary_identifier, description, row_user_id, a_count, t_count, length,
row_project_id, row_alg_invocation_id, sequence_version
, na_sequence_id )
    VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?, ?,
?, ?, ?, '', '', ?, ?, ?, ?, ? )  

Values:
ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31 Trypanosoma
cruzi Berenice putative chimeric protein gene, partial
cds., 1, 177, 1, 28, 1, 1 at
/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
      

GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a} SQL ERROR!! involving\x{a} \x{a}    INSE
RT INTO DoTS.ExternalNASequ...') called at
/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
      

GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO DoTS.ExternalNASequence (
sequence, group_r...') called at /home/oracle/gus_home/lib/pe
rl/GUS/ObjRelP/DbiRow.pm line 674
      

GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)') called at /
home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
      

GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/per
l/GUS/Model/GusRow.pm line 1677
      

GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/perl/
GUS/Common/Plugin/GBParser.pm line 284
      

GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
=HASH(0x8ec41bc)') called at
/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
        eval {...} called at
/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
      

GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)') called at /home/oracle
/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
        eval {...} called at
/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 427
      

GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
ser') called at
/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 283
      

GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
) called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
line 192
      

GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at /
home/oracle/gus_home/bin/ga line 11




on the prompt, following error is to see:



********GEtting loc below30

VLD     CBIL::Bio::GenBank::Locus       1
VLD     CBIL::Bio::GenBank::Definition  1
VLD     CBIL::Bio::GenBank::Accession   1
VLD     CBIL::Bio::GenBank::Version     1
VLD     CBIL::Bio::GenBank::Keywords    1
VLD     CBIL::Bio::GenBank::Source      1
VLD     CBIL::Bio::GenBank::Reference   1
VLD     CBIL::Bio::GenBank::Reference   1
RUN     1..177
RUN     1..46
RUN     <30..>177
RUN     30..>177
VLD     CBIL::Bio::GenBank::Features    1
VLD     CBIL::Bio::GenBank::Origin      1
Fri Jan 30 15:41:11 2004        STATUS  N=2 ACC=AY488502        
TOTAL_OBJECTS=16
Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
GUS::Model::DoTS::Source        ::      mol_type        ::      genomic DNA

Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
GUS::Model::DoTS::Source        ::      transgenic      ::

Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
GUS::Model::DoTS::Source        ::      mol_type        ::      genomic DNA

DBD::Oracle::st execute failed: ORA-02291: integrity constraint
(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
: OCIStmtExecute) [for Statement "
    INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
sequence_type_id, user_read, other_write, modification_date, subcla
ss_view, row_group_id, user_write, other_read, group_write,
external_database_release_id, source_id, g_count, c_count, taxon_id, nam
e, secondary_identifier, description, row_user_id, a_count, t_count, length,
row_project_id, row_alg_invocation_id, sequence_version
, na_sequence_id )
    VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?, ?,
?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502', :p15='GI:41056860',
:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
Trypanosoma cruzi Berenice putative chimeric protein gene, partia
l cds.', :p6='ExternalNASequence',
:p3='1',
:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa', :p7='1', :p17='1', :p22=1, :p9=1, :
p11=135] at /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
145, <GEN0> line 112.
Fri Jan 30 15:41:12 2004        Genbank entries inserted= 0;  updated= 0;
total #(inserted::updated::deleted)=16::::

Fri Jan 30 15:41:12 2004        FAILURES        Unable to process 2 entries.
See gbparserFailures/
Fri Jan 30 15:41:12 2004        RESULT  Genbank entries inserted= 0;
updated= 0;  failed= 2



I see the problem, that the table DOTS.NASEQUENCEIMP is not set by the
perlprogramm. I thought about setting the variables manually, but doesn't
make
sence.

To inserte the values ot the the ExternalDatabaseRelease tables, I
orientited myself on the
installguide_UGA.html .
The registration of the perl class InsertNewExtDbRelease gave following
error:

ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
Reading properties from /home/oracle/gus_home/config/GUS-PluginMgr.prop
Reading properties from /home/oracle/.gus.properties
Warning: Use of "require" without parens is ambiguous at (eval 3) line 1.
 
ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval 3) line
1.
Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed while
"strict subs" in use at (eval 3) line 1.
 
 
--------------------------- STACK TRACE -------------------------
      

GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword "pm" not allowed while "strict subs" in use at
(eval...') called at
/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
line 248
      

GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
line 664
      

GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm') called at
/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 456
      

GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
line 283
      

GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
line
192
      

GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at
/home/oracle/gus_home/bin/ga line 11

I hope, that someone can help me.

I wish a nice weekend and good luck with the grand -
Thomas

[Gusdev-gusdev] GUS grant - we need your help

[Steve F. <sfi...@pc...>]

GUS Users-

Back in June we got a very strong review of the GUS grant.  

It looked like funding was going to go forward.   However, as you might 
know, the federal budget was delayed by six months, and just passed a 
week ago.   The funding agency still doesn't have its budget.   And, 
their budget, it seems, is expected to be pinched.

Because of this uncertainty, we are resubmitting for a March 1 deadline.

Here is how you can help.   Please send us answers to these questions:

1. Who and where are you?

2. For what project are you using or considering GUS?

3. What is the status of your effort with GUS?

4. How successfully or unsuccessfully has GUS assisted your project?

5. If GUS has successfully assisted your project, would you be prepared 
to write a letter in support of the grant?

6. Is there any particular direction you think the GUS project should go 
in that we might not be aware of?

7. Is there anything else you want to mention

Thanks very much,

Steve

[Gusdev-gusdev] InsertNewExternalSequences / insert of DNA sequences

[Thomas O. <th...@gm...>]

Hey everybody,

I wanted to know, if the bug in the InsertNewExternalSequences.pm is fixed,
or I did an error in the usage...
Maybe just give me a workaround to insert my DNA sequences in the DB with a
perl modul.

Thanks,

Thomas

Re: Please disregard--Re: [Gusdev-gusdev] wdk installconfig

[Fidel S. <fi...@vb...>]

Michael,

Thanks for your answer.  I was following the configuring file in the
wdk but the instructions do not mention PerlTools.jar.  Once I got
that file, the compilation worked fine.

One thing to note, however, is that jar files do not need to be put in
the $JAVA_HOME/jre/lib/ext directory because the installServlet
program sets the CLASSPATH variable using the
<your_java_lib>_JAR_FILES variable in InstallConfig.  Therefore, the
only thing that was missing was getting the PerlTools.jar file and
adding the location of that jar file to the JAR_FILES variable.

Fidel


MICHAEL LUCHTAN <lu...@cs...> writes:

     > Hey Fidel-
     > I placed the following jar files in my $JAVA_HOME/jre/lib/ext directory;
     > JCSP-0.9.jar <-- from GUS
     > PerlTools.jar
     > cos.jar <-- from www.servlet.com/cos
     > jakarta-oro-2.0.8.jar <--from apache web site
     > oracle-classes12.jar
>
>
     > I'm not sure where one would get PerlTools or oracle-classes12.  I found
     > them lying around on a legacy system.
     > Hope this helps.  Let me know
>
>
     > Michael Luchtan
     > http://www.cs.uga.edu/~luchtan
>
>
     > On Thu, 22 Jan 2004, Fidel Salas wrote:
>
>> Michael,
>>
>> I am glad to hear you solved your problem.  I have not seen that.
>> What I am getting are errors because the oreilly and oroinc packages
>> (see below) are not found.  Did you experience the same?  How did you
>> solve the issues?
>>
>> 	compiling Java files...javac `find . -name '*.java' | grep -v 'annotator'`
>> 	./db/params/DataSetCSPParam.java:29: package com.oreilly.servlet does not exist
>> 	import com.oreilly.servlet.MultipartWrapper;
>> 	                           ^
>> 	./SiteServlet.java:14: package com.oroinc.text.perl does not exist
>> 	import com.oroinc.text.perl.*;
>> 	^
>> 	./util/ObjectFile.java:10: package com.oroinc.text.perl does not exist
>> 	import com.oroinc.text.perl.*;
>> 	^
>> 	./SiteServlet.java:276: cannot resolve symbol
>> 	symbol  : class Perl5Util
>> 	location: class cbil.gus.servlet.SiteServlet
>> 	    protected Perl5Util p5 = new Perl5Util();
>>
>> .
>> .
>> .
>>
>> Thanks
>>
>> Fidel
>>
>>
>> MICHAEL LUCHTAN <lu...@cs...> writes:
>>
>>      > Hello All
>>      > Please disregard my previous message.  I solved the problem by placing the
>>      > jar files in the CORRECT location.  JDKHOME/jre/lib/ext/ instead of
>>      > manipulating my CLASS_PATH for each one.
>> >
>>      > Michael Luchtan
>>      > http://www.cs.uga.edu/~luchtan
>> >
>> >
>>      > On Thu, 22 Jan 2004, MICHAEL LUCHTAN wrote:
>> >
>> >> Hello-
>> >> I'm trying to work the WDK install myself.  When trying to compile the
>> >> java files by installServlet.pl, I'm having an error trying to find a
>> >> class:
>> >> RadioTableParam
>> >>
>> >> Any idea where this class would be?  A google search on it yielded no
>> >> results.  I found it not in the CBIL releases 1.1,1.2,and1.3 which are
>> >> availble from the CVS server.  I would assume that it should be in
>> >> cbil.csp.dialog
>> >> Does anyone have this class, or installed the wdk from the tarball and
>> >> encountered this problem?
>> >>
>> >> Michael Luchtan
>> >> http://www.cs.uga.edu/~luchtan
>> >>
>> >>
>> >>
>> >>
>> >>
>> >> -------------------------------------------------------
>> >> The SF.Net email is sponsored by EclipseCon 2004
>> >> Premiere Conference on Open Tools Development and Integration
>> >> See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>> >> http://www.eclipsecon.org/osdn
>> >> _______________________________________________
>> >> Gusdev-gusdev mailing list
>> >> Gus...@li...
>> >> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>> >>
>>
>>

[Gusdev-gusdev] Core::WorkflowNode missing?

[Dave B. <db...@pc...>]

We seem to be missing the table Core::WorkflowNode.  It should exist as 
the 'superclass view' of the implementation table Core::WorkflowNodeImp, 
which is the case with all the other implementation tables.

Is this correct?  Right now it is giving the java object generator 
some problems.  I can add it as a schema change request if there is no 
reason for it not to be there.

thanks,
dave

Re: [Gusdev-gusdev] wdk installconfig

[Steve F. <st...@pc...>]

its probably in a slightly later vesion of the CBIL releases.  i'll look 
around.

steve

MICHAEL LUCHTAN wrote:

>Hello-
>I'm trying to work the WDK install myself.  When trying to compile the
>java files by installServlet.pl, I'm having an error trying to find a
>class:
>RadioTableParam
>
>Any idea where this class would be?  A google search on it yielded no
>results.  I found it not in the CBIL releases 1.1,1.2,and1.3 which are
>availble from the CVS server.  I would assume that it should be in
>cbil.csp.dialog
>Does anyone have this class, or installed the wdk from the tarball and
>encountered this problem?
>
>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>
>
>
>
>-------------------------------------------------------
>The SF.Net email is sponsored by EclipseCon 2004
>Premiere Conference on Open Tools Development and Integration
>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>http://www.eclipsecon.org/osdn
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

Please disregard--Re: [Gusdev-gusdev] wdk installconfig

[MICHAEL L. <lu...@cs...>]

Hello All
Please disregard my previous message.  I solved the problem by placing the
jar files in the CORRECT location.  JDKHOME/jre/lib/ext/ instead of
manipulating my CLASS_PATH for each one.

Michael Luchtan
http://www.cs.uga.edu/~luchtan


On Thu, 22 Jan 2004, MICHAEL LUCHTAN wrote:

> Hello-
> I'm trying to work the WDK install myself.  When trying to compile the
> java files by installServlet.pl, I'm having an error trying to find a
> class:
> RadioTableParam
>
> Any idea where this class would be?  A google search on it yielded no
> results.  I found it not in the CBIL releases 1.1,1.2,and1.3 which are
> availble from the CVS server.  I would assume that it should be in
> cbil.csp.dialog
> Does anyone have this class, or installed the wdk from the tarball and
> encountered this problem?
>
> Michael Luchtan
> http://www.cs.uga.edu/~luchtan
>
>
>
>
>
> -------------------------------------------------------
> The SF.Net email is sponsored by EclipseCon 2004
> Premiere Conference on Open Tools Development and Integration
> See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> http://www.eclipsecon.org/osdn
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>

Re: [Gusdev-gusdev] wdk installconfig

[MICHAEL L. <lu...@cs...>]

Hello-
I'm trying to work the WDK install myself.  When trying to compile the
java files by installServlet.pl, I'm having an error trying to find a
class:
RadioTableParam

Any idea where this class would be?  A google search on it yielded no
results.  I found it not in the CBIL releases 1.1,1.2,and1.3 which are
availble from the CVS server.  I would assume that it should be in
cbil.csp.dialog
Does anyone have this class, or installed the wdk from the tarball and
encountered this problem?

Michael Luchtan
http://www.cs.uga.edu/~luchtan

Re: [Gusdev-gusdev] wdk installconfig

[Steve F. <sfi...@pc...>]

In general, the things in that file are values that are substituted into 
the WDK code.  

PROJECT_ID: some queries are constrained by project_id.   Eg, find all 
na_sequences that are from a given project.   If you don't plan on using 
this i think you can ignore this property

SHOW_PRIVATE_IDS and PRIVATE_SEQ_DB_IDS has to do with storing sequences 
that are proprietary.   I woudld set the first to true and ignore the 
second.

steve

Fidel Salas wrote:

>I am trying to install the WDK.  I have a question wrt the
>InstallConfig.pm file, which is used to configure each servlet.
>
>The variable $InstallConfig::CONFIG uses a hash with some params.
>Would someone elaborate on what PROJECT_ID, SHOW_PRIVATE_SEQS, and
>PRIVATE_SEQ_DB_IDS (see below for $InstallConfig::CONFIG example) are
>supposed to be for?  I assume that PROJECT_ID comes from
>core.projectinfo.
>
>Thanks 
>
>Fidel
>
>
>'dotsgenes'=> {
>               ...
>               params {
>                       ...
>                       PROJECT_ID => 839,                        # AllGenes-6.0
>                       SHOW_PRIVATE_SEQS => 0,
>                       PRIVATE_SEQ_DB_IDS => '(178,3392,3892)',
>                       ....
>
>
>
>
>-------------------------------------------------------
>The SF.Net email is sponsored by EclipseCon 2004
>Premiere Conference on Open Tools Development and Integration
>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>http://www.eclipsecon.org/osdn
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

Re: [Gusdev-gusdev] DoTS:NAEntry and topology

[Fidel S. <fi...@vb...>]

Angel,

I am not sure I totally understand your mail because I first want to
make sure you understand what I am trying to do.  What I want to do is
to add a column to a table before installing GUS.  That is, I want to
add a column to the SQL statement that creates the table 
(dots-tables.sql:CREATE TABLE DoTS.NAENTRY ().  From Chris's and your
previous answer nothing will break.  By nothing, I understand not the
installation and not the parsers. Correct?

Thanks

Fidel


Angel Pizarro <an...@pc...> writes:

     > BTW,
>
     > I did not mention this, but adding a column in the GUS system is not
     > completely trivial. Since the default columns are assumed to be at the
     > end of the column list, and adding a column in most RDBMSs appends to
     > the column list, you in fact have to create a new temporary table
     > where the added column precedes the "modification_date".
     > The added column is usually nullable and thus a select statement is
     > used to populate the temp table from the old:
>
     > insert into <new_table>  (<column list from old table>) select * from
     > <original_table>;
>
     > If the column is to be non-null, then you have to provide some default
     > value in the column listing of the select clause of the insert
     > statement:
>
     > insert into <new_table>  (<column list from NEW table>) select <non
     > default columns from old table>, <default_value>, <GUS default column
     > list>  from <original_table>;
>
     > Then you rename the old/new tables, drop and recreate the constraints
     > (the constraints will follow the old table as you rename, so if you
     > don't drop them first or you will have name clashes) and then the
     > object layer sees the new table definition. I'll release this as GUS
     > 3.1.1
>
     > Angel
     > Angel Pizarro wrote:
>
>> Adding the column will not break anythiing, although I ask you to
>> post a tracker item on the SF.net site. :
>>
>> http://sourceforge.net/tracker/?atid=479181&group_id=54213&func=browse
>>
>> Also, please attach the SQL to make that makes the new table,
>> transfers the data, apply constraints  and rename the tables
>> appropriately, etc., to the tracker item. Since you have to do these
>> actions regardless, it would be nice to share them as a script ;)
>>
>> I'll commit the change to CVS when I make the other changes that are
>> needed for GUS 3.1
>>
>> Angel
>>
>> Fidel Salas wrote:
>>
>>> Chris Stoeckert <sto...@pc...> writes:
>>>
>>>     > Hi Fidel,
>>>
>>> Hi Chris.  Thanks for your response.
>>>
>>>     > What are you trying to get from LOCUS?
>>>     > Here's an example for the kit gene (maybe you can send me a more
>>>     > relevant one for you).
>>>     > LOCUS NM_021099 5132 bp mRNA linear ROD 20-DEC-2003
>>>     > Is it the "linear" info?
>>>
>>> Yes, it is the "linear" (or "circular") info.
>>>
>>>     > I agree that NAEntry table would be a good place for this and
>>> I would
>>>     > recommend that the NAEntry table have a "topology" attribute
>>> added.
>>>     > I'm guessing that this information was lost because it's not
>>> something
>>>     > that we at CBIL use.
>>>
>>> Understood.
>>>
>>>     > My understanding is that nothing should should break by
>>> adding this
>>>     > column but would like others to confirm (Steve? Angel?)
>>>
>>> It sounds good.
>>>
>>> Fidel
>>>
>>>
>>>     > I also don't think that you would need to add set/get methods just
>>>     > alter the existing one for NAEntry.
>>>      > Chris
>>>      > On Jan 6, 2004, at 11:35 AM, Fidel Salas wrote:
>>>      > I need help in finding a quick solution to the following
>>> requirement.
>>>      > I need topology information for any given GenBank DNA
>>> sequence or
>>>     > entry.  This information is found in the LOCUS line of a GenBank
>>>     > entry.  For reasons unclear to me, the GBParser plugin parses
>>> this and
>>>     > then silently drops it.
>>>      > Since I am about to create a new GUS database, I would like
>>> to add a
>>>     > column to DoTS:NAEntry that will hold the topology
>>> information.  The
>>>     > main question is: will I break anything if I add this column
>>> to the
>>>     > tables sql script?
>>>      > Also, what is the reason this information is dropped?
>>>      > I am assuming getting GBParser to populate this new column
>>> would
>>>     > involve just getting the objrelp generator to add set and get
>>> methods.
>>>     > Is this all that would need to be done?
>>>      > Thanks
>>>      > Fidel
>>>
>>>>
>>>>
>>>>
>>>
>>>     > -------------------------------------------------------
>>>     > This SF.net email is sponsored by: IBM Linux Tutorials.
>>>     > Become an expert in LINUX or just sharpen your skills.  Sign
>>> up for
>>>     > IBM's
>>>     > Free Linux Tutorials.  Learn everything from the bash shell to sys
>>>     > admin.
>>>     > Click now! http://ads.osdn.com/?ad_id=1278&alloc_id=3371&op=click
>>>     > _______________________________________________
>>>     > Gusdev-gusdev mailing list
>>>     > Gus...@li...
>>>     > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>
>>>
>>>
>>> -------------------------------------------------------
>>> The SF.Net email is sponsored by EclipseCon 2004
>>> Premiere Conference on Open Tools Development and Integration
>>> See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>>> http://www.eclipsecon.org/osdn
>>> _______________________________________________
>>> Gusdev-gusdev mailing list
>>> Gus...@li...
>>> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>
>>
>>
>>
>> -------------------------------------------------------
>> The SF.Net email is sponsored by EclipseCon 2004
>> Premiere Conference on Open Tools Development and Integration
>> See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>> http://www.eclipsecon.org/osdn
>> _______________________________________________
>> Gusdev-gusdev mailing list
>> Gus...@li...
>> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev

[Gusdev-gusdev] wdk installconfig

[Fidel S. <fi...@vb...>]

I am trying to install the WDK.  I have a question wrt the
InstallConfig.pm file, which is used to configure each servlet.

The variable $InstallConfig::CONFIG uses a hash with some params.
Would someone elaborate on what PROJECT_ID, SHOW_PRIVATE_SEQS, and
PRIVATE_SEQ_DB_IDS (see below for $InstallConfig::CONFIG example) are
supposed to be for?  I assume that PROJECT_ID comes from
core.projectinfo.

Thanks 

Fidel


'dotsgenes'=> {
               ...
               params {
                       ...
                       PROJECT_ID => 839,                        # AllGenes-6.0
                       SHOW_PRIVATE_SEQS => 0,
                       PRIVATE_SEQ_DB_IDS => '(178,3392,3892)',
                       ....

Re: [Gusdev-gusdev] DoTS:NAEntry and topology

[Angel P. <an...@pc...>]

BTW,

I did not mention this, but adding a column in the GUS system is not 
completely trivial. Since the default columns are assumed to be at the 
end of the column list, and adding a column in most RDBMSs appends to 
the column list, you in fact have to create a new temporary table where 
the added column precedes the "modification_date".
The added column is usually nullable and thus a select statement is used 
to populate the temp table from the old:

insert into <new_table>  (<column list from old table>) select * from 
<original_table>;

If the column is to be non-null, then you have to provide some default 
value in the column listing of the select clause of the insert statement:

insert into <new_table>  (<column list from NEW table>) select <non 
default columns from old table>, <default_value>, <GUS default column 
list>  from <original_table>;

Then you rename the old/new tables, drop and recreate the constraints 
(the constraints will follow the old table as you rename, so if you 
don't drop them first or you will have name clashes) and then the object 
layer sees the new table definition. I'll release this as GUS 3.1.1

Angel
Angel Pizarro wrote:

> Adding the column will not break anythiing, although I ask you to post 
> a tracker item on the SF.net site. :
>
> http://sourceforge.net/tracker/?atid=479181&group_id=54213&func=browse
>
> Also, please attach the SQL to make that makes the new table, 
> transfers the data, apply constraints  and rename the tables 
> appropriately, etc., to the tracker item. Since you have to do these 
> actions regardless, it would be nice to share them as a script ;)
>
> I'll commit the change to CVS when I make the other changes that are 
> needed for GUS 3.1
>
> Angel
>
> Fidel Salas wrote:
>
>> Chris Stoeckert <sto...@pc...> writes:
>>
>>     > Hi Fidel,
>>
>> Hi Chris.  Thanks for your response.
>>
>>     > What are you trying to get from LOCUS?
>>     > Here's an example for the kit gene (maybe you can send me a more
>>     > relevant one for you).
>>     > LOCUS NM_021099 5132 bp mRNA linear ROD 20-DEC-2003
>>     > Is it the "linear" info?
>>
>> Yes, it is the "linear" (or "circular") info.
>>
>>     > I agree that NAEntry table would be a good place for this and I 
>> would
>>     > recommend that the NAEntry table have a "topology" attribute 
>> added.
>>     > I'm guessing that this information was lost because it's not 
>> something
>>     > that we at CBIL use.
>>
>> Understood.
>>
>>     > My understanding is that nothing should should break by adding 
>> this
>>     > column but would like others to confirm (Steve? Angel?)
>>
>> It sounds good.
>>
>> Fidel
>>
>>
>>     > I also don't think that you would need to add set/get methods just
>>     > alter the existing one for NAEntry.
>>  
>>
>>     > Chris
>>  
>>
>>     > On Jan 6, 2004, at 11:35 AM, Fidel Salas wrote:
>>  
>>
>>     > I need help in finding a quick solution to the following 
>> requirement.
>>  
>>
>>     > I need topology information for any given GenBank DNA sequence or
>>     > entry.  This information is found in the LOCUS line of a GenBank
>>     > entry.  For reasons unclear to me, the GBParser plugin parses 
>> this and
>>     > then silently drops it.
>>  
>>
>>     > Since I am about to create a new GUS database, I would like to 
>> add a
>>     > column to DoTS:NAEntry that will hold the topology 
>> information.  The
>>     > main question is: will I break anything if I add this column to 
>> the
>>     > tables sql script?
>>  
>>
>>     > Also, what is the reason this information is dropped?
>>  
>>
>>     > I am assuming getting GBParser to populate this new column would
>>     > involve just getting the objrelp generator to add set and get 
>> methods.
>>     > Is this all that would need to be done?
>>  
>>
>>     > Thanks
>>  
>>
>>     > Fidel
>>  
>>
>>>
>>>
>>>   
>>
>>     > -------------------------------------------------------
>>     > This SF.net email is sponsored by: IBM Linux Tutorials.
>>     > Become an expert in LINUX or just sharpen your skills.  Sign up 
>> for
>>     > IBM's
>>     > Free Linux Tutorials.  Learn everything from the bash shell to sys
>>     > admin.
>>     > Click now! http://ads.osdn.com/?ad_id=1278&alloc_id=3371&op=click
>>     > _______________________________________________
>>     > Gusdev-gusdev mailing list
>>     > Gus...@li...
>>     > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>
>>
>>
>> -------------------------------------------------------
>> The SF.Net email is sponsored by EclipseCon 2004
>> Premiere Conference on Open Tools Development and Integration
>> See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>> http://www.eclipsecon.org/osdn
>> _______________________________________________
>> Gusdev-gusdev mailing list
>> Gus...@li...
>> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>  
>>
>
>
>
> -------------------------------------------------------
> The SF.Net email is sponsored by EclipseCon 2004
> Premiere Conference on Open Tools Development and Integration
> See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> http://www.eclipsecon.org/osdn
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev

Re: [Gusdev-gusdev] DoTS:NAEntry and topology

[Angel P. <an...@pc...>]

Adding the column will not break anythiing, although I ask you to post a 
tracker item on the SF.net site. :

http://sourceforge.net/tracker/?atid=479181&group_id=54213&func=browse

Also, please attach the SQL to make that makes the new table, transfers 
the data, apply constraints  and rename the tables appropriately, etc., 
to the tracker item. Since you have to do these actions regardless, it 
would be nice to share them as a script ;)

I'll commit the change to CVS when I make the other changes that are 
needed for GUS 3.1

Angel

Fidel Salas wrote:

>Chris Stoeckert <sto...@pc...> writes:
>
>     > Hi Fidel,
>
>Hi Chris.  Thanks for your response.
>
>     > What are you trying to get from LOCUS?
>     > Here's an example for the kit gene (maybe you can send me a more
>     > relevant one for you).
>     > LOCUS NM_021099 5132 bp mRNA linear ROD 20-DEC-2003
>     > Is it the "linear" info?
>
>Yes, it is the "linear" (or "circular") info.
>
>     > I agree that NAEntry table would be a good place for this and I would
>     > recommend that the NAEntry table have a "topology" attribute added.
>     > I'm guessing that this information was lost because it's not something
>     > that we at CBIL use.
>
>Understood.
>
>     > My understanding is that nothing should should break by adding this
>     > column but would like others to confirm (Steve? Angel?)
>
>It sounds good.
>
>Fidel
>
>
>     > I also don't think that you would need to add set/get methods just
>     > alter the existing one for NAEntry.
>  
>
>     > Chris
>  
>
>     > On Jan 6, 2004, at 11:35 AM, Fidel Salas wrote:
>  
>
>     > I need help in finding a quick solution to the following requirement.
>  
>
>     > I need topology information for any given GenBank DNA sequence or
>     > entry.  This information is found in the LOCUS line of a GenBank
>     > entry.  For reasons unclear to me, the GBParser plugin parses this and
>     > then silently drops it.
>  
>
>     > Since I am about to create a new GUS database, I would like to add a
>     > column to DoTS:NAEntry that will hold the topology information.  The
>     > main question is: will I break anything if I add this column to the
>     > tables sql script?
>  
>
>     > Also, what is the reason this information is dropped?
>  
>
>     > I am assuming getting GBParser to populate this new column would
>     > involve just getting the objrelp generator to add set and get methods.
>     > Is this all that would need to be done?
>  
>
>     > Thanks
>  
>
>     > Fidel
>  
>
>>
>>
>>    
>>
>     > -------------------------------------------------------
>     > This SF.net email is sponsored by: IBM Linux Tutorials.
>     > Become an expert in LINUX or just sharpen your skills.  Sign up for
>     > IBM's
>     > Free Linux Tutorials.  Learn everything from the bash shell to sys
>     > admin.
>     > Click now! http://ads.osdn.com/?ad_id=1278&alloc_id=3371&op=click
>     > _______________________________________________
>     > Gusdev-gusdev mailing list
>     > Gus...@li...
>     > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>
>
>
>-------------------------------------------------------
>The SF.Net email is sponsored by EclipseCon 2004
>Premiere Conference on Open Tools Development and Integration
>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>http://www.eclipsecon.org/osdn
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

Re: [Gusdev-gusdev] DoTS:NAEntry and topology

[Fidel S. <fi...@vb...>]

Chris Stoeckert <sto...@pc...> writes:

     > Hi Fidel,

Hi Chris.  Thanks for your response.

     > What are you trying to get from LOCUS?
     > Here's an example for the kit gene (maybe you can send me a more
     > relevant one for you).
     > LOCUS NM_021099 5132 bp mRNA linear ROD 20-DEC-2003
     > Is it the "linear" info?

Yes, it is the "linear" (or "circular") info.

     > I agree that NAEntry table would be a good place for this and I would
     > recommend that the NAEntry table have a "topology" attribute added.
     > I'm guessing that this information was lost because it's not something
     > that we at CBIL use.

Understood.

     > My understanding is that nothing should should break by adding this
     > column but would like others to confirm (Steve? Angel?)

It sounds good.

Fidel


     > I also don't think that you would need to add set/get methods just
     > alter the existing one for NAEntry.
>
     > Chris
>
     > On Jan 6, 2004, at 11:35 AM, Fidel Salas wrote:
>
     > I need help in finding a quick solution to the following requirement.
>
     > I need topology information for any given GenBank DNA sequence or
     > entry.  This information is found in the LOCUS line of a GenBank
     > entry.  For reasons unclear to me, the GBParser plugin parses this and
     > then silently drops it.
>
     > Since I am about to create a new GUS database, I would like to add a
     > column to DoTS:NAEntry that will hold the topology information.  The
     > main question is: will I break anything if I add this column to the
     > tables sql script?
>
     > Also, what is the reason this information is dropped?
>
     > I am assuming getting GBParser to populate this new column would
     > involve just getting the objrelp generator to add set and get methods.
     > Is this all that would need to be done?
>
     > Thanks
>
     > Fidel
>
>
>
>
     > -------------------------------------------------------
     > This SF.net email is sponsored by: IBM Linux Tutorials.
     > Become an expert in LINUX or just sharpen your skills.  Sign up for
     > IBM's
     > Free Linux Tutorials.  Learn everything from the bash shell to sys
     > admin.
     > Click now! http://ads.osdn.com/?ad_id=1278&alloc_id=3371&op=click
     > _______________________________________________
     > Gusdev-gusdev mailing list
     > Gus...@li...
     > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev

Re: [Gusdev-gusdev] DoTS:NAEntry and topology

[Chris S. <sto...@pc...>]

Hi Fidel,

What are you trying to get from LOCUS?
Here's an example for the kit gene (maybe you can send me a more 
relevant one for you).
LOCUS       NM_021099               5132 bp    mRNA    linear   ROD 
20-DEC-2003
Is it the "linear" info?
I agree that NAEntry table would be a good place for this and I would 
recommend that the NAEntry table have a "topology" attribute added.
I'm guessing that this information was lost because it's not something 
that we at CBIL use.
My understanding is that nothing should should break by adding this 
column but would like others to confirm (Steve? Angel?)
I also don't think that you would need to add set/get methods just 
alter the existing one for NAEntry.

Chris

On Jan 6, 2004, at 11:35 AM, Fidel Salas wrote:

> I need help in finding a quick solution to the following requirement.
>
> I need topology information for any given GenBank DNA sequence or
> entry.  This information is found in the LOCUS line of a GenBank
> entry.  For reasons unclear to me, the GBParser plugin parses this and
> then silently drops it.
>
> Since I am about to create a new GUS database, I would like to add a
> column to DoTS:NAEntry that will hold the topology information.  The
> main question is:  will I break anything if I add this column to the
> tables sql script?
>
> Also, what is the reason this information is dropped?
>
> I am assuming getting GBParser to populate this new column would
> involve just getting the objrelp generator to add set and get methods.
> Is this all that would need to be done?
>
> Thanks
>
> Fidel
>
>
>
>
> -------------------------------------------------------
> This SF.net email is sponsored by: IBM Linux Tutorials.
> Become an expert in LINUX or just sharpen your skills.  Sign up for 
> IBM's
> Free Linux Tutorials.  Learn everything from the bash shell to sys 
> admin.
> Click now! http://ads.osdn.com/?ad_id=1278&alloc_id=3371&op=click
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>

Re: [Gusdev-gusdev] Re: the nasty java package question

[Steve F. <sfi...@pc...>]

oops.   i meant gusdb instead of gusdev.  

so, again:
   org_type, org, project, component, subcomponent, subsubcomponent, etc

org.gusdb.gus.wdk.model.query.QuerySet;
org.gusdb.rad.studannot.whatever.WhyNot;

steve

Dave Barkan wrote:

>Right now, java classes in the GUS project have a package structure like 
>the following:
>
>org.gusdb.<componentName>.
>
>Steve, before you said that you wanted to change this to
>
>org.gusdb.<projectName>.<componentName>, which would make the package name 
>more like the one you originally proposed.
>
>  
>
>>my feelings about "gusdev" as the project named are thumbs down. Makes 
>>it look like a hack project. 
>>    
>>
>
>We are currently using 'gusdb' instead of 'gusdev' in the GUS build 
>system, although I don't know if there's a reason for that.  'gusdb' looks 
>a lot less like a hack project though.  
>
>I don't think there's too much wrong with long package names.  Right now, 
>the typical java GUS object looks like this:
>
>org.gusdb.model.schema.tableName
>
>and it will eventually have 'gus' in between 'gusdb' and 'model.'  And 
>don't even get me started on what the Annotators Interface package 
>structure looks like.
>
>dave
>
>
>  
>
>>org.gus.wdk.
>>org.gus.db.* or org,gus.model.*
>>org.gus.rad.*
>>org.gus.dots.*
>>etc.
>>
>>Angel
>>
>>Steve Fischer wrote:
>>
>>    
>>
>>>folks-
>>>
>>>i am gearing up to right my first WDK java code (xml parser using 
>>>digester).  this is also my first java code for GUS.
>>>
>>>and so, i am confronted with the nasty package name question.
>>>
>>>officially, this is kind of what i think the package name should be, 
>>>but, its so darn long:
>>>  org.gusdev.gus.wdk.model.config.Parser;
>>>
>>>ie, organization_type.organization.project.component.subcomponent.package
>>>
>>>note that while we don't yet, we do expect to have other projects, 
>>>such as rad, be under the gusdev umbrella.
>>>
>>>i did a quick surf to see if others are having this problem.  here is 
>>>the first package name i stumbled on:
>>>
>>>oracle.security.rdbms.server.AppCtx.AppCtxManager
>>>
>>>I suppose we could drop the leading org:
>>>
>>> gusdev.gus.wdk.model.config.Parser
>>>
>>>any ideas?
>>>      
>>>
>>    
>>
>
>
>
>-------------------------------------------------------
>The SF.Net email is sponsored by EclipseCon 2004
>Premiere Conference on Open Tools Development and Integration
>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>http://www.eclipsecon.org/osdn
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

[Gusdev-gusdev] Re: the nasty java package question

[Dave B. <db...@pc...>]

Right now, java classes in the GUS project have a package structure like 
the following:

org.gusdb.<componentName>.

Steve, before you said that you wanted to change this to

org.gusdb.<projectName>.<componentName>, which would make the package name 
more like the one you originally proposed.

> my feelings about "gusdev" as the project named are thumbs down. Makes 
> it look like a hack project. 

We are currently using 'gusdb' instead of 'gusdev' in the GUS build 
system, although I don't know if there's a reason for that.  'gusdb' looks 
a lot less like a hack project though.  

I don't think there's too much wrong with long package names.  Right now, 
the typical java GUS object looks like this:

org.gusdb.model.schema.tableName

and it will eventually have 'gus' in between 'gusdb' and 'model.'  And 
don't even get me started on what the Annotators Interface package 
structure looks like.

dave


> 
> org.gus.wdk.
> org.gus.db.* or org,gus.model.*
> org.gus.rad.*
> org.gus.dots.*
> etc.
> 
> Angel
> 
> Steve Fischer wrote:
> 
> > folks-
> >
> > i am gearing up to right my first WDK java code (xml parser using 
> > digester).  this is also my first java code for GUS.
> >
> > and so, i am confronted with the nasty package name question.
> >
> > officially, this is kind of what i think the package name should be, 
> > but, its so darn long:
> >   org.gusdev.gus.wdk.model.config.Parser;
> >
> > ie, organization_type.organization.project.component.subcomponent.package
> >
> > note that while we don't yet, we do expect to have other projects, 
> > such as rad, be under the gusdev umbrella.
> >
> > i did a quick surf to see if others are having this problem.  here is 
> > the first package name i stumbled on:
> >
> > oracle.security.rdbms.server.AppCtx.AppCtxManager
> >
> > I suppose we could drop the leading org:
> >
> >  gusdev.gus.wdk.model.config.Parser
> >
> > any ideas?
> 
> 

[Gusdev-gusdev] Re: the nasty java package question

[Angel P. <an...@pc...>]

my feelings about "gusdev" as the project named are thumbs down. Makes 
it look like a hack project. What about collapsing "gusdev.gus" into "gus"?

org.gus.wdk.
org.gus.db.* or org,gus.model.*
org.gus.rad.*
org.gus.dots.*
etc.

Angel

Steve Fischer wrote:

> folks-
>
> i am gearing up to right my first WDK java code (xml parser using 
> digester).  this is also my first java code for GUS.
>
> and so, i am confronted with the nasty package name question.
>
> officially, this is kind of what i think the package name should be, 
> but, its so darn long:
>   org.gusdev.gus.wdk.model.config.Parser;
>
> ie, organization_type.organization.project.component.subcomponent.package
>
> note that while we don't yet, we do expect to have other projects, 
> such as rad, be under the gusdev umbrella.
>
> i did a quick surf to see if others are having this problem.  here is 
> the first package name i stumbled on:
>
> oracle.security.rdbms.server.AppCtx.AppCtxManager
>
> I suppose we could drop the leading org:
>
>  gusdev.gus.wdk.model.config.Parser
>
> any ideas?

[Gusdev-gusdev] the nasty java package question

[Steve F. <st...@pc...>]

folks-

i am gearing up to right my first WDK java code (xml parser using 
digester).  this is also my first java code for GUS.

and so, i am confronted with the nasty package name question.

officially, this is kind of what i think the package name should be, 
but, its so darn long:
   org.gusdev.gus.wdk.model.config.Parser;

ie, organization_type.organization.project.component.subcomponent.package

note that while we don't yet, we do expect to have other projects, such 
as rad, be under the gusdev umbrella.

i did a quick surf to see if others are having this problem.  here is 
the first package name i stumbled on:

oracle.security.rdbms.server.AppCtx.AppCtxManager

I suppose we could drop the leading org:

  gusdev.gus.wdk.model.config.Parser

any ideas?

Re: [Gusdev-gusdev] SubmitRow fixed

[Fidel S. <fi...@vb...>]

Steve,

I agree with you about writing a new plugin.  Being short on time to
do what I needed to do, I decided to go for what I did.

Fidel


Steve Fischer <st...@pc...> writes:

     > Fidel-
>
     > that feature pre-dates my stewardship.  i can look into it, but i
     > suspect that it is there for the latter reason you describe.
>
     > an alternative you can explore is to create a new plugin to do your
     > task.   use SubmitRow as a starting point and stream your data
     > through.  steve
>
     > Fidel Salas wrote:
>
>>Steve,
>>
>>The SubmitRow algo_invo option does not seem to work, or at least does
>>not work as I would expect it to.
>>
>>Needing to upload some type of data that GUS does not currently
>>address, I needed to use SubmitRow for inserting 10s of thousands of
>>rows into a view.  I thought that if I used the algo_invo option I
>>could use the same algorithm_invocation_id for all inserts.
>>Therefore, I wrote a script that would do the initial insertion, get
>>that initial insertion's algorithm invocation id, and then invoke
>>SubmitRow with the algo_invo option (with the value being the initial
>>algorithm invocation id).  SubmitRow then proceeds to do the
>>insertions but ignores the algo_invo option and creates algorithm
>>invocation ids for all the new inserts.
>>
>>Is my interpretation of how the algo_invo option should work not
>>correct?  Or is that option only to be used when the system can
>>absolutely not generate new ids?  If the latter, it seems to me that
>>if the system cannot generate new ids, one should not be inserting new
>>data and fix the problem of not being able to generate new ids.
>>
>>Thanks
>>
>>Fidel
>>
>>
>>
>>	> Message: 3
>>	> Date: Thu, 15 Jan 2004 19:45:02 -0500
>>	> From: Steve Fischer <sfi...@pc...>
>>	> To: gusdev-gusdev <gus...@li...>
>>	> Subject: [Gusdev-gusdev] SubmitRow fixed
>> 	> 	> Folks-
>> 	> 	> I have fixed up GUS::Common::Plugin::SubmitRow.  It
>> now works on 	> updates.  Also, the code is cleaner, so it is a good
>> sample plugin.
>> 	> 	> Steve
>>
>>
>>
>>-------------------------------------------------------
>>The SF.Net email is sponsored by EclipseCon 2004
>>Premiere Conference on Open Tools Development and Integration
>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>>http://www.eclipsecon.org/osdn
>>_______________________________________________
>>Gusdev-gusdev mailing list
>>Gus...@li...
>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>

Re: [Gusdev-gusdev] SubmitRow fixed

[Steve F. <st...@pc...>]

Fidel-

that feature pre-dates my stewardship.  i can look into it, but i 
suspect that it is there for the latter reason you describe.

an alternative you can explore is to create a new plugin to do your 
task.   use SubmitRow as a starting point and stream your data through.  

steve

Fidel Salas wrote:

>Steve,
>
>The SubmitRow algo_invo option does not seem to work, or at least does
>not work as I would expect it to.
>
>Needing to upload some type of data that GUS does not currently
>address, I needed to use SubmitRow for inserting 10s of thousands of
>rows into a view.  I thought that if I used the algo_invo option I
>could use the same algorithm_invocation_id for all inserts.
>Therefore, I wrote a script that would do the initial insertion, get
>that initial insertion's algorithm invocation id, and then invoke
>SubmitRow with the algo_invo option (with the value being the initial
>algorithm invocation id).  SubmitRow then proceeds to do the
>insertions but ignores the algo_invo option and creates algorithm
>invocation ids for all the new inserts.
>
>Is my interpretation of how the algo_invo option should work not
>correct?  Or is that option only to be used when the system can
>absolutely not generate new ids?  If the latter, it seems to me that
>if the system cannot generate new ids, one should not be inserting new
>data and fix the problem of not being able to generate new ids.
>
>Thanks
>
>Fidel
>
>
>
>	> Message: 3
>	> Date: Thu, 15 Jan 2004 19:45:02 -0500
>	> From: Steve Fischer <sfi...@pc...>
>	> To: gusdev-gusdev <gus...@li...>
>	> Subject: [Gusdev-gusdev] SubmitRow fixed
>	> 
>	> Folks-
>	> 
>	> I have fixed up GUS::Common::Plugin::SubmitRow.  It now works on 
>	> updates.  Also, the code is cleaner, so it is a good sample plugin.
>	> 
>	> Steve
>
>
>
>-------------------------------------------------------
>The SF.Net email is sponsored by EclipseCon 2004
>Premiere Conference on Open Tools Development and Integration
>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>http://www.eclipsecon.org/osdn
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

[Gusdev-gusdev] SubmitRow fixed

[Fidel S. <fi...@vb...>]

Steve,

The SubmitRow algo_invo option does not seem to work, or at least does
not work as I would expect it to.

Needing to upload some type of data that GUS does not currently
address, I needed to use SubmitRow for inserting 10s of thousands of
rows into a view.  I thought that if I used the algo_invo option I
could use the same algorithm_invocation_id for all inserts.
Therefore, I wrote a script that would do the initial insertion, get
that initial insertion's algorithm invocation id, and then invoke
SubmitRow with the algo_invo option (with the value being the initial
algorithm invocation id).  SubmitRow then proceeds to do the
insertions but ignores the algo_invo option and creates algorithm
invocation ids for all the new inserts.

Is my interpretation of how the algo_invo option should work not
correct?  Or is that option only to be used when the system can
absolutely not generate new ids?  If the latter, it seems to me that
if the system cannot generate new ids, one should not be inserting new
data and fix the problem of not being able to generate new ids.

Thanks

Fidel



	> Message: 3
	> Date: Thu, 15 Jan 2004 19:45:02 -0500
	> From: Steve Fischer <sfi...@pc...>
	> To: gusdev-gusdev <gus...@li...>
	> Subject: [Gusdev-gusdev] SubmitRow fixed
	> 
	> Folks-
	> 
	> I have fixed up GUS::Common::Plugin::SubmitRow.  It now works on 
	> updates.  Also, the code is cleaner, so it is a good sample plugin.
	> 
	> Steve

[Gusdev-gusdev] SubmitRow fixed

[Steve F. <sfi...@pc...>]

Folks-

I have fixed up GUS::Common::Plugin::SubmitRow.  It now works on 
updates.  Also, the code is cleaner, so it is a good sample plugin.

Steve

[Gusdev-gusdev] mail archive down for maintenance

[Steve F. <st...@pc...>]

our mailing list archive is down.  sourceforge is doing "routine 
maintenance."

should be back up tomorrow.

steve