gusdev-gusdev — Topics concerning GUS development

Re: [Gusdev-gusdev] WDK classic install, setting sql

[Angel P. <an...@pc...>]

query parameters (eg. "$$0$$", "$$1$$") get set by the "Params" 
attribute. In your case :

gseqDescrQ.Params=intP

where "intP" is defined later in the file as :

intP.class=IntParam
intP.Prompt=Integer

You must define two parameters for "$$0$$" and $$1$$ in your query.

gseqDescrQ.SQL=select *\
  from dots.ExternalNASequence\
  where external_database_release_id = $$0$$ \
  and source_id = $$1$$

you can keep "intP" for $$0$$, since this is an integer, but source_id is a string, hence you must use a StringParam

change "gseqDescrQ.Params=intP" to "gseqDescrQ.Params=intP,stringP" since "stringP" is already defined in this config file as:

stringP.class=StringParam
stringP.Prompt=Enter a string:
stringP.Description=String


Angel


MICHAEL LUCHTAN wrote:

>Just a quick question, in case anyone knows.  Elsewise I'll still be
>digging around:
>
>In the WDK-classic installation, you supply a configuration file which
>specifies which pages you want to serve up, and certain paramaters, like
>the sql statement that is used.  I've changed some stuff for
>GenomicSequencePage to make it more applicable to CTEGD web apps, and
>altered following in the supplied config file:
>
>gseqDescrQ.SQL=select ena.source_id, ena.name, ena.description, ed.name
>dbname, \
>  tn.name, ena.length \
>  from dots.ExternalNASequence ena, sres.TaxonName tn,
>sres.ExternalDatabase ed, \
>  sres.ExternalDatabaseRelease edr \
>  where ena.na_sequence_id = $$0$$ \
>  and ena.taxon_id = tn.taxon_id \
>  and tn.name_class = 'scientific name' \
>  and ena.external_database_release_id = edr.external_database_release_id \
>  and edr.external_database_id = ed.external_database_id \
>  and edr.external_database_release_id not in (@PRIVATE_SEQ_DB_IDS@)
>
>to:
>
>gseqDescrQ.SQL=select *\
>  from dots.ExternalNASequence\
>  where external_database_release_id = $$0$$ \
>  and source_id = $$1$$
>
>I know that this gets set, but for some reason the number of parameters
>does not change.  Is this hard coded somewhere?  In my error
>file(CATALINA.OUT) I get the following:
>
>Running query:
>select *  from dots.ExternalNASequence  where external_database_release_id
>= 35   and source_id = $$1$$
>java.sql.SQLException: ORA-00911: invalid character
>
>But I know that I am passing an array with two elements in it, and it is
>obviously getting the first one.
>
>
>If any knows why it won't insert the second parameter, please let me know.
>
>
>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>
>
>
>-------------------------------------------------------
>The SF.Net email is sponsored by EclipseCon 2004
>Premiere Conference on Open Tools Development and Integration
>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>http://www.eclipsecon.org/osdn
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

[Gusdev-gusdev] WDK classic install, setting sql

[MICHAEL L. <lu...@cs...>]

Just a quick question, in case anyone knows.  Elsewise I'll still be
digging around:

In the WDK-classic installation, you supply a configuration file which
specifies which pages you want to serve up, and certain paramaters, like
the sql statement that is used.  I've changed some stuff for
GenomicSequencePage to make it more applicable to CTEGD web apps, and
altered following in the supplied config file:

gseqDescrQ.SQL=select ena.source_id, ena.name, ena.description, ed.name
dbname, \
  tn.name, ena.length \
  from dots.ExternalNASequence ena, sres.TaxonName tn,
sres.ExternalDatabase ed, \
  sres.ExternalDatabaseRelease edr \
  where ena.na_sequence_id = $$0$$ \
  and ena.taxon_id = tn.taxon_id \
  and tn.name_class = 'scientific name' \
  and ena.external_database_release_id = edr.external_database_release_id \
  and edr.external_database_id = ed.external_database_id \
  and edr.external_database_release_id not in (@PRIVATE_SEQ_DB_IDS@)

to:

gseqDescrQ.SQL=select *\
  from dots.ExternalNASequence\
  where external_database_release_id = $$0$$ \
  and source_id = $$1$$

I know that this gets set, but for some reason the number of parameters
does not change.  Is this hard coded somewhere?  In my error
file(CATALINA.OUT) I get the following:

Running query:
select *  from dots.ExternalNASequence  where external_database_release_id
= 35   and source_id = $$1$$
java.sql.SQLException: ORA-00911: invalid character

But I know that I am passing an array with two elements in it, and it is
obviously getting the first one.


If any knows why it won't insert the second parameter, please let me know.


Michael Luchtan
http://www.cs.uga.edu/~luchtan

[Gusdev-gusdev] Re: [Fwd: Porting GUS to a Open SourceDB ?]

[Angel P. <an...@pc...>]

Steve,
This is a very accurate and complete synopsis of the issues we have 
discussed so far. Without actually starting the project, I don't foresee 
us coming up with anything else.

As for translation between DB platforms, there is a Sourceforge.net 
project that Allen Day belongs to named SQLFairy. See more about it at 
http://sqlfairy.sourceforge.net/

They claim to translate between Oracle and PostgreSQL, but this has not 
worked in practice for me when I tried to translate the GUS schema files 
to postgresql. Part of the problem is that we separate tables, views and 
constraints into their own files in addition to separate file groups for 
schemas. It also had trouble with multi-line comments.

They have listed a platform independent XML syntax, but they as yet do 
not have a formal DTD or XML schema (I asked already) . They said they 
were willing to formalize on an XML schema if we provide it and is close 
to what they have already. I don't see any reason to re-invent the wheel 
here.

Angel

Steve Fischer wrote:

> (Cesare and Giuseppe, are you on the gusdev mailing list?  If not, you 
> can subscribe at: 
> http://lists.sourceforge.net/lists/listinfo/gusdev-gusdev)
>
> Folks-
>
> Here is a quick outline of what might need to be done to make GUS 
> RDBMS independent.    I discuss the two major subsystems of GUS:  the 
> schema and the application framework.
>
> Please bear in mind that i am not a DB expert.   Comments and 
> corrections encouraged.
>
> GUS Schema
>   - schema definition.     it appears that different RDBMSs have 
> differences in their data types and in the way they create tables and 
> specify constraints.   it seems that this we need to define the schema 
> in a system neutral syntax, say, xml, and then transform that into 
> system-specific syntax.   i wonder if there are third party tools to 
> do this.
>
>    - schema spaces.   the definition of the schema currently assumes 
> "schema name spaces."     for example, we have RAD.Process.    For 
> systems that don't support this, we may need to define the schema as, 
> say, RAD_Process.   In other words, prepend the schema name to the 
> table names.
>
>   - schema installation.    this will need to be system-specific, and 
> will probably be generated by transforming a schema definition in a 
> neutral syntax
>
>
> GUS Application Framework
>    - the application framework currently uses DBI and JDBC.   these 
> are fine.
>
>   - the object layer API (and all the code that uses it) assumes that 
> there is a schema space.   worse still, it hard codes the names as 
> DoTS, RAD, Core, TESS and SRes.   The changes I envision here are:
>           - removing hard coded references to schema names, replacing 
> them with logical names.
>           - allow the API to *keep* the schema space assumption.    
> however, inside the object layer, use a RDBMS-specific "driver" to 
> handle them in a system specific way.   for example, it would use '.' 
> as the concatenation character for oracle and '_' for mySql.
>            - the object layer's code generator (generates all the 
> objects) has a system-specific module for discovering meta-information 
> about the tables.   this is segregated into system specific modules.   
> for any new system, we would need to write new ones.    note:  any 
> system that we support would need to offer this meta information 
> somehow!!!!
>
>    - sql code.   there is plenty of direct SQL in our application code 
> and in plugins.   here are the problems:
>           - Wherever this sql refers to table names, the sql would 
> need to be modified to get the table names from an API which can 
> provide them in correct syntax.  
>           - some of the code relies on system specific optimization 
> directives.   i don't know how we'll handle this.
>           - are there any other sql incompatibilities?   how about 
> join and/or outer join syntax?
>
> Any other ideas?
>
> Steve
>
>
>
> Giuseppe Jurman wrote:
>
>>>Thanks Elisabetta,
>>>
>>>An important question would be also why PostgreSQL and not MySQL, the
>>>latter appears to be evolved well and have now a good support to
>>>transactions via InnoDB, etc. I am very inclined to use Gmod and chado
>>>por our project, but would like to have a final check on the potential
>>>of GUS before starting things.
>>>    
>>>
>>
>>ITC-irst has started a working group for a full open source version of
>>GUS, so to allow the substitution of the Oracle database management
>>system for data tables and relations within GUS with an open source
>>solution. In principle we are not oriented to the substitution
>>of Oracle with another specific DMBS.
>>
>>It might be worthwhile to consider the possibility to turn DB
>>independent the whole object-related part of GUS and then choosing the
>>suitable DB-dedicated driver depending on the user's system. The first
>>(heavy) step towards this option requires to check the existing code
>>looking for the Oracle-specific SQL, and then designing an ad-hoc
>>strategy to transform into either a DBI (better) or into a DBD (here
>>the choice of the DBMS becomes a constraint).
>>
>>An important issue, for us, is how to align the DBD portions of the
>>code along the next releases of GUS. In this view, we see the need of
>>a DBI-DBD separation really relevant.
>>
>>We would like to perform the Oracle-PostgreSQL conversion in the most
>>automated way possible. Before, the Oracle proprietary SQL code has to
>>be somehow moved to the upper Perl Object Layer level, or to a new
>>Perl Object Layer.
>>
>>Comments welcomed
>>
>>
>>Giuseppe Jurman
>>Cersare Furlanello
>>
>>  
>>

[Gusdev-gusdev] Re: [Fwd: Porting GUS to a Open SourceDB ?]

[Steve F. <st...@pc...>]

(Cesare and Giuseppe, are you on the gusdev mailing list?  If not, you 
can subscribe at: http://lists.sourceforge.net/lists/listinfo/gusdev-gusdev)

Folks-

Here is a quick outline of what might need to be done to make GUS RDBMS 
independent.    I discuss the two major subsystems of GUS:  the schema 
and the application framework.

Please bear in mind that i am not a DB expert.   Comments and 
corrections encouraged.

GUS Schema
  - schema definition.     it appears that different RDBMSs have 
differences in their data types and in the way they create tables and 
specify constraints.   it seems that this we need to define the schema 
in a system neutral syntax, say, xml, and then transform that into 
system-specific syntax.   i wonder if there are third party tools to do 
this.

   - schema spaces.   the definition of the schema currently assumes 
"schema name spaces."     for example, we have RAD.Process.    For 
systems that don't support this, we may need to define the schema as, 
say, RAD_Process.   In other words, prepend the schema name to the table 
names.

  - schema installation.    this will need to be system-specific, and 
will probably be generated by transforming a schema definition in a 
neutral syntax


GUS Application Framework
   - the application framework currently uses DBI and JDBC.   these are 
fine.

  - the object layer API (and all the code that uses it) assumes that 
there is a schema space.   worse still, it hard codes the names as DoTS, 
RAD, Core, TESS and SRes.   The changes I envision here are:
          - removing hard coded references to schema names, replacing 
them with logical names.
          - allow the API to *keep* the schema space assumption.    
however, inside the object layer, use a RDBMS-specific "driver" to 
handle them in a system specific way.   for example, it would use '.' as 
the concatenation character for oracle and '_' for mySql.
           - the object layer's code generator (generates all the 
objects) has a system-specific module for discovering meta-information 
about the tables.   this is segregated into system specific modules.   
for any new system, we would need to write new ones.    note:  any 
system that we support would need to offer this meta information somehow!!!!

   - sql code.   there is plenty of direct SQL in our application code 
and in plugins.   here are the problems:
          - Wherever this sql refers to table names, the sql would need 
to be modified to get the table names from an API which can provide them 
in correct syntax.  
          - some of the code relies on system specific optimization 
directives.   i don't know how we'll handle this.
          - are there any other sql incompatibilities?   how about join 
and/or outer join syntax?

Any other ideas?

Steve



Giuseppe Jurman wrote:

>>Thanks Elisabetta,
>>
>>An important question would be also why PostgreSQL and not MySQL, the
>>latter appears to be evolved well and have now a good support to
>>transactions via InnoDB, etc. I am very inclined to use Gmod and chado
>>por our project, but would like to have a final check on the potential
>>of GUS before starting things.
>>    
>>
>
>ITC-irst has started a working group for a full open source version of
>GUS, so to allow the substitution of the Oracle database management
>system for data tables and relations within GUS with an open source
>solution. In principle we are not oriented to the substitution
>of Oracle with another specific DMBS.
>
>It might be worthwhile to consider the possibility to turn DB
>independent the whole object-related part of GUS and then choosing the
>suitable DB-dedicated driver depending on the user's system. The first
>(heavy) step towards this option requires to check the existing code
>looking for the Oracle-specific SQL, and then designing an ad-hoc
>strategy to transform into either a DBI (better) or into a DBD (here
>the choice of the DBMS becomes a constraint).
>
>An important issue, for us, is how to align the DBD portions of the
>code along the next releases of GUS. In this view, we see the need of
>a DBI-DBD separation really relevant.
>
>We would like to perform the Oracle-PostgreSQL conversion in the most
>automated way possible. Before, the Oracle proprietary SQL code has to
>be somehow moved to the upper Perl Object Layer level, or to a new
>Perl Object Layer.
>
>Comments welcomed
>
>
>Giuseppe Jurman
>Cersare Furlanello
>
>  
>

[Gusdev-gusdev] Re: [Fwd: Porting GUS to a Open SourceDB ?]

[Steve F. <sfi...@pc...>]

Giuseppe-

GUS uses Perl DBI and Java JDBC to interact with the database.

I just did a quick grep of the Perl code base.   There is one place 
where we use DBD.  It is in our DBAdmin toolset.   This toolset is 
released with GUS, but it is not considered "standard" gus.    However, 
 it is a nice toolset which provides a web display of things like:  who 
is using the db, what queries are running, what are the constraints on 
the tables, etc.   So, it would be nice if we eventually made it DBD 
independent.

Besides that, GUS does not depend directly on DBD.

The first step to porting GUS to other DBMSs is to identify what are the 
DBMS dependent parts.   One example is that GUS uses schema spaces.   In 
other words, tables are named:  schema.table.   I know that postgres 
supports this, but when we last looked mysql did not.

I don't think there are alot of dependencies, but, to find them we would 
need to do some research.

Steve

Giuseppe Jurman wrote:

>>Thanks Elisabetta,
>>
>>An important question would be also why PostgreSQL and not MySQL, the
>>latter appears to be evolved well and have now a good support to
>>transactions via InnoDB, etc. I am very inclined to use Gmod and chado
>>por our project, but would like to have a final check on the potential
>>of GUS before starting things.
>>    
>>
>
>ITC-irst has started a working group for a full open source version of
>GUS, so to allow the substitution of the Oracle database management
>system for data tables and relations within GUS with an open source
>solution. In principle we are not oriented to the substitution
>of Oracle with another specific DMBS.
>
>It might be worthwhile to consider the possibility to turn DB
>independent the whole object-related part of GUS and then choosing the
>suitable DB-dedicated driver depending on the user's system. The first
>(heavy) step towards this option requires to check the existing code
>looking for the Oracle-specific SQL, and then designing an ad-hoc
>strategy to transform into either a DBI (better) or into a DBD (here
>the choice of the DBMS becomes a constraint).
>
>An important issue, for us, is how to align the DBD portions of the
>code along the next releases of GUS. In this view, we see the need of
>a DBI-DBD separation really relevant.
>
>We would like to perform the Oracle-PostgreSQL conversion in the most
>automated way possible. Before, the Oracle proprietary SQL code has to
>be somehow moved to the upper Perl Object Layer level, or to a new
>Perl Object Layer.
>
>Comments welcomed
>
>
>Giuseppe Jurman
>Cersare Furlanello
>
>  
>

[Gusdev-gusdev] Re: [Fwd: Porting GUS to a Open SourceDB ?]

[Alberto M. R. <da...@fi...>]

Dear All,

Thanks for keeping me in the loop of this. I will forward this msg to my
colleagues (the experts in databases) to make a decision together.

I have some questions on databases for genomes: a) what do you think of
GMOD and b) if there any level of comparison with GUS ? I am looking for
the best choice, but seems to be not so easy... How long it could take
to make GUS database independent or to port it to an open source source
database ?

Thanks and best regards, Alberto


On Mon, 2004-02-09 at 16:17, Steve Fischer wrote:
> Giuseppe-
>=20
> GUS uses Perl DBI and Java JDBC to interact with the database.
>=20
> I just did a quick grep of the Perl code base.   There is one place=20
> where we use DBD.  It is in our DBAdmin toolset.   This toolset is=20
> released with GUS, but it is not considered "standard" gus.    However,=
=20
>  it is a nice toolset which provides a web display of things like:  who=
=20
> is using the db, what queries are running, what are the constraints on=20
> the tables, etc.   So, it would be nice if we eventually made it DBD=20
> independent.
>=20
> Besides that, GUS does not depend directly on DBD.
>=20
> The first step to porting GUS to other DBMSs is to identify what are th=
e=20
> DBMS dependent parts.   One example is that GUS uses schema spaces.   I=
n=20
> other words, tables are named:  schema.table.   I know that postgres=20
> supports this, but when we last looked mysql did not.
>=20
> I don't think there are alot of dependencies, but, to find them we woul=
d=20
> need to do some research.
>=20
> Steve
>=20
> Giuseppe Jurman wrote:
>=20
> >>Thanks Elisabetta,
> >>
> >>An important question would be also why PostgreSQL and not MySQL, the
> >>latter appears to be evolved well and have now a good support to
> >>transactions via InnoDB, etc. I am very inclined to use Gmod and chad=
o
> >>por our project, but would like to have a final check on the potentia=
l
> >>of GUS before starting things.
> >>   =20
> >>
> >
> >ITC-irst has started a working group for a full open source version of
> >GUS, so to allow the substitution of the Oracle database management
> >system for data tables and relations within GUS with an open source
> >solution. In principle we are not oriented to the substitution
> >of Oracle with another specific DMBS.
> >
> >It might be worthwhile to consider the possibility to turn DB
> >independent the whole object-related part of GUS and then choosing the
> >suitable DB-dedicated driver depending on the user's system. The first
> >(heavy) step towards this option requires to check the existing code
> >looking for the Oracle-specific SQL, and then designing an ad-hoc
> >strategy to transform into either a DBI (better) or into a DBD (here
> >the choice of the DBMS becomes a constraint).
> >
> >An important issue, for us, is how to align the DBD portions of the
> >code along the next releases of GUS. In this view, we see the need of
> >a DBI-DBD separation really relevant.
> >
> >We would like to perform the Oracle-PostgreSQL conversion in the most
> >automated way possible. Before, the Oracle proprietary SQL code has to
> >be somehow moved to the upper Perl Object Layer level, or to a new
> >Perl Object Layer.
> >
> >Comments welcomed
> >
> >
> >Giuseppe Jurman
> >Cersare Furlanello
> >
> > =20
> >
--=20
Alberto M. R. D=C3=A1vila <da...@fi...>
Fiocruz

[Gusdev-gusdev] Re: [Fwd: Porting GUS to a Open SourceDB ?]

[Giuseppe J. <ju...@it...>]

> Thanks Elisabetta,
> 
> An important question would be also why PostgreSQL and not MySQL, the
> latter appears to be evolved well and have now a good support to
> transactions via InnoDB, etc. I am very inclined to use Gmod and chado
> por our project, but would like to have a final check on the potential
> of GUS before starting things.

ITC-irst has started a working group for a full open source version of
GUS, so to allow the substitution of the Oracle database management
system for data tables and relations within GUS with an open source
solution. In principle we are not oriented to the substitution
of Oracle with another specific DMBS.

It might be worthwhile to consider the possibility to turn DB
independent the whole object-related part of GUS and then choosing the
suitable DB-dedicated driver depending on the user's system. The first
(heavy) step towards this option requires to check the existing code
looking for the Oracle-specific SQL, and then designing an ad-hoc
strategy to transform into either a DBI (better) or into a DBD (here
the choice of the DBMS becomes a constraint).

An important issue, for us, is how to align the DBD portions of the
code along the next releases of GUS. In this view, we see the need of
a DBI-DBD separation really relevant.

We would like to perform the Oracle-PostgreSQL conversion in the most
automated way possible. Before, the Oracle proprietary SQL code has to
be somehow moved to the upper Perl Object Layer level, or to a new
Perl Object Layer.

Comments welcomed


Giuseppe Jurman
Cersare Furlanello

[Gusdev-gusdev] Re: [Fwd: Porting GUS to a Open SourceDB ?]

[Steve F. <sfi...@pc...>]

Alberto-

It has been a while since we did a comparison of GUS v. chado.

Here are some things to consider, on the design level, without=20
discussing what is and what is not covered by the schema:
   - GUS has been in production for 5 years
   - GUS uses explicit foreign keys and explicit tables to model all its=20
concepts.   this strong typing makes querying and loading data more=20
manageable
   - GUS uses one-level subclassing.  For example, GeneFeature and=20
RNAFeature are explicit concepts, and both are subclasses of Feature
   - GUS comes with an application framework which includes:
         - perl and java object representation
         - a "Plugin API" that uses the GUS objects and makes it easy to=20
add data (and track it) robustly
         - a bunch of plugins that load data
         - a Web Development Kit which assists in making a website that=20
queries GUS, and provides sophisticated query tools like composing=20
Boolean queries and user query history (see www.plasmodb.org)

steve

Alberto M. R. D=C3=A1vila wrote:

>Dear All,
>
>Thanks for keeping me in the loop of this. I will forward this msg to my
>colleagues (the experts in databases) to make a decision together.
>
>I have some questions on databases for genomes: a) what do you think of
>GMOD and b) if there any level of comparison with GUS ? I am looking for
>the best choice, but seems to be not so easy... How long it could take
>to make GUS database independent or to port it to an open source source
>database ?
>
>Thanks and best regards, Alberto
>
>
>On Mon, 2004-02-09 at 16:17, Steve Fischer wrote:
> =20
>
>>Giuseppe-
>>
>>GUS uses Perl DBI and Java JDBC to interact with the database.
>>
>>I just did a quick grep of the Perl code base.   There is one place=20
>>where we use DBD.  It is in our DBAdmin toolset.   This toolset is=20
>>released with GUS, but it is not considered "standard" gus.    However,=
=20
>> it is a nice toolset which provides a web display of things like:  who=
=20
>>is using the db, what queries are running, what are the constraints on=20
>>the tables, etc.   So, it would be nice if we eventually made it DBD=20
>>independent.
>>
>>Besides that, GUS does not depend directly on DBD.
>>
>>The first step to porting GUS to other DBMSs is to identify what are th=
e=20
>>DBMS dependent parts.   One example is that GUS uses schema spaces.   I=
n=20
>>other words, tables are named:  schema.table.   I know that postgres=20
>>supports this, but when we last looked mysql did not.
>>
>>I don't think there are alot of dependencies, but, to find them we woul=
d=20
>>need to do some research.
>>
>>Steve
>>
>>Giuseppe Jurman wrote:
>>
>>   =20
>>
>>>>Thanks Elisabetta,
>>>>
>>>>An important question would be also why PostgreSQL and not MySQL, the
>>>>latter appears to be evolved well and have now a good support to
>>>>transactions via InnoDB, etc. I am very inclined to use Gmod and chad=
o
>>>>por our project, but would like to have a final check on the potentia=
l
>>>>of GUS before starting things.
>>>>  =20
>>>>
>>>>       =20
>>>>
>>>ITC-irst has started a working group for a full open source version of
>>>GUS, so to allow the substitution of the Oracle database management
>>>system for data tables and relations within GUS with an open source
>>>solution. In principle we are not oriented to the substitution
>>>of Oracle with another specific DMBS.
>>>
>>>It might be worthwhile to consider the possibility to turn DB
>>>independent the whole object-related part of GUS and then choosing the
>>>suitable DB-dedicated driver depending on the user's system. The first
>>>(heavy) step towards this option requires to check the existing code
>>>looking for the Oracle-specific SQL, and then designing an ad-hoc
>>>strategy to transform into either a DBI (better) or into a DBD (here
>>>the choice of the DBMS becomes a constraint).
>>>
>>>An important issue, for us, is how to align the DBD portions of the
>>>code along the next releases of GUS. In this view, we see the need of
>>>a DBI-DBD separation really relevant.
>>>
>>>We would like to perform the Oracle-PostgreSQL conversion in the most
>>>automated way possible. Before, the Oracle proprietary SQL code has to
>>>be somehow moved to the upper Perl Object Layer level, or to a new
>>>Perl Object Layer.
>>>
>>>Comments welcomed
>>>
>>>
>>>Giuseppe Jurman
>>>Cersare Furlanello
>>>
>>>=20
>>>
>>>     =20
>>>

[Gusdev-gusdev] Re: [Fwd: Porting GUS to a Open SourceDB ?]

[Laurie K. <lk...@mo...>]

Steve Fischer wrote:

> The first step to porting GUS to other DBMSs is to identify what are 
> the DBMS dependent parts.   One example is that GUS uses schema 
> spaces.   In other words, tables are named:  schema.table.   I know 
> that postgres supports this, but when we last looked mysql did not.
>
That's right.  It does support queries between databases but there is no 
foreign key support across
databases.  Having used Oracle for many years I believe that Postgres is 
much more similar to it than
mysql is.

Laurie

-- 
Laurie Kramer
Department of Molecular Biology
Princeton University
lk...@mo...
609.258.5657

[Gusdev-gusdev] Porting GUS to a Open SourceDB ?

[Alberto D. <da...@io...>]

Hi, I searched this list for any msg on PostgreSQL and MySQL and it
returned nothing... I wonder to know if there is any plans to port GUS
to the above mentioned databases or even if there is someone doing that
? 

Also, any info/tips on the advantages on having it ported to MySQL vs
PostgreSQL would be greatly appreciated.

Thanks, Alberto

Re: [Gusdev-gusdev] GBParser - problems with the perl modules

[Thomas O. <th...@gm...>]

Hi Steve,

that's it! 

Thanks a lot,
Thomas

> thomas-
> 
> i found the problem.  it is the last line of your file:
> 
>     40921 cctcttccac ttcgtttcat tcttccaaca cctgcagccc caaatccatt
> tctaccgtct
>     40981 acaagagttg gaggtctttc tcataatcat ctattcattc cccatcaacc
> gtttactact
>     41041 cttgtttcga ccgattctag atattctgca ccgaaccctc tttctcatcg
> acttccaaac
>     41101 gagatttgcc gagttcatat gaattcaaat cctttccatt tttagtttta
> ttactctacc
>     41161 aaataattaa acagactttt cctatcgggt cccctaattt tctttcattt
> ttcaggcatc
>     41221 tcggttgttt ttttcaaagt attttgacct aattttccat gttgaaatta
> ataaaatatt
>     41281 tattaaatga acacaaacac agatgttgga attgtcttct tctggtcaag
> tactggatat
>     41341 actctctttt tttgataatg ctgaattga
> //
> 
> 
> the '//' is confusing the parser into thinking that there is another
> entry.
> 
> to workaround this bug delete that line from your file.
> 
> steve
> 
> Thomas Otto wrote:
> 
> >Hi Steve,
> >
> >I send you a sequence...
> >
> >Maybe I have an idea why I have so much problems. Is it possible, that
> the
> >Oracle is kind of delaying? I just retried to insert the first test
> sequences,
> >and today it worked!!??!!
> >The one I send you doesn't work - same error. So what could it be? The
> only
> >logic thing, would be the DB... (I am using Red Hat and Oracle 9.2 -
> there
> >are not certificaded together - I am just working on a testsystem, later
> on we
> >will put it on a 'real' server...)
> >
> >So, could this be?
> >
> >This would explain also other problems I had...
> >
> >- Thomas
> >
> >
> >  
> >
> >>thomas-
> >>
> >>i think the error message is important, because it causes the plugin to 
> >>abort.
> >>
> >>can you send a file?
> >>
> >>steve
> >>
> >>Thomas Otto wrote:
> >>
> >>    
> >>
> >>>Steve-
> >>>I just picked one of the 'trypanosoma cruzi'... maybe just give me one
> >>>      
> >>>
> >>that
> >>    
> >>
> >>>should work.
> >>>
> >>>I tried also other entries... 
> >>>One thing is, that I can only try it with some entries, where I have
> the
> >>>taxon in the DB. I couldn't install it totaly, because the ga wanted
> more
> >>>      
> >>>
> >>memory
> >>    
> >>
> >>>than my swap of 1GB could give him... 
> >>>
> >>>Actually I do not know, what the error means:
> >>>Can't call method "getAccession" on an undefined value at
> >>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
> >>>218, <GEN0> line 61.
> >>>maybe it is not so important, because the data seem to be in the
> >>>      
> >>>
> >>database...
> >>    
> >>
> >>>Thomas
> >>>
> >>> 
> >>>
> >>>      
> >>>
> >>>>debbie-
> >>>>
> >>>>we need to help thomas succeed in his use of the GBParser.
> >>>>
> >>>>do you have any ideas?   would it make sense to get his input file
> from 
> >>>>him and try to run it here?
> >>>>
> >>>>looking at the code, the problem seems that he is trying to get the 
> >>>>first ACCESSION field from his file, but it is not found
> >>>>
> >>>> ## Check NAEntry for update
> >>>> my $naentry = GUS::Model::DoTS::NAEntry->new({'source_id' => 
> >>>>$e->{'ACCESSION'}->[0]->getAccession(),
> >>>>                          });
> >>>>
> >>>>
> >>>>thomas-  how big is the file you are trying to parse?  if its not too 
> >>>>big, why don't you send it.
> >>>>
> >>>>
> >>>>steve
> >>>>
> >>>>
> >>>>Thomas Otto wrote:
> >>>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>Steve-
> >>>>>
> >>>>>I just downloaded the version anothertime with cvs and did an
> install.
> >>>>>
> >>>>>here the call and the log:
> >>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1
> >>>>>--file=/seq/tcruzi.fcgi --commit 2>&1| tee sonstiges/GBParser.log
> >>>>>Reading properties from
> /home/oracle/gus_home/config/GUS-PluginMgr.prop
> >>>>>Reading properties from /home/oracle/.gus.properties
> >>>>>Tue Feb  3 15:24:34 2004        COMMIT  commit on
> >>>>>Maximum number of  objects set to 50000
> >>>>>Tue Feb  3 15:24:34 2004        RELEASE 1
> >>>>>
> >>>>>Tue Feb  3 15:24:34 2004        FILE    /seq/tcruzi.fcgi
> >>>>>
> >>>>>VLD     CBIL::Bio::GenBank::Locus       1
> >>>>>VLD     CBIL::Bio::GenBank::Definition  1
> >>>>>VLD     CBIL::Bio::GenBank::Accession   1
> >>>>>VLD     CBIL::Bio::GenBank::Version     1
> >>>>>VLD     CBIL::Bio::GenBank::Keywords    1
> >>>>>VLD     CBIL::Bio::GenBank::Source      1
> >>>>>VLD     CBIL::Bio::GenBank::Reference   1
> >>>>>VLD     CBIL::Bio::GenBank::Reference   1
> >>>>>RUN     1..2961
> >>>>>VLD     CBIL::Bio::GenBank::Features    1
> >>>>>VLD     CBIL::Bio::GenBank::Origin      1
> >>>>>Tue Feb  3 15:24:35 2004        STATUS  N=1 ACC=AC116948        
> >>>>>TOTAL_OBJECTS=16
> >>>>>Tue Feb  3 15:24:35 2004        Genbank entries inserted= 0; 
> updated=
> >>>>>          
> >>>>>
> >>0;
> >>    
> >>
> >>>>>total #(inserted::updated::deleted)=16::::
> >>>>>
> >>>>>Tue Feb  3 15:24:35 2004        FAILURES        Unable to process 1
> >>>>>     
> >>>>>
> >>>>>          
> >>>>>
> >>>>entries.
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>See gbparserFailures/
> >>>>>Tue Feb  3 15:24:35 2004        RESULT  Genbank entries inserted= 0; 
> >>>>>updated= 0;  failed= 1
> >>>>>
> >>>>>The errorfile
> >>>>>cat gbparserFailures/errors
> >>>>>------------------ entry number 2 -----------------
> >>>>>Can't call method "getAccession" on an undefined value at
> >>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
> >>>>>218, <GEN0> line 84.
> >>>>>
> >>>>>
> >>>>>Cheers,
> >>>>>Thomas
> >>>>>
> >>>>>
> >>>>>
> >>>>>     
> >>>>>
> >>>>>          
> >>>>>
> >>>>>>thomas-
> >>>>>>
> >>>>>>please send me your version of the GBParser.pm and the complete
> log...
> >>>>>>            
> >>>>>>
> >> 
> >>    
> >>
> >>>>>>       
> >>>>>>
> >>>>>>that might help me figure out what is wrong.
> >>>>>>
> >>>>>>steve
> >>>>>>
> >>>>>>Thomas Otto wrote:
> >>>>>>
> >>>>>>  
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>>>>Steve,
> >>>>>>>
> >>>>>>>true, I had to install the taxon stuff. The datas are inserted in
> the
> >>>>>>>NAseqenceimp table
> >>>>>>>
> >>>>>>>But now I get an error- (this is not the first call!!!)
> >>>>>>>Tue Feb  3 11:21:25 2004        Genbank entries inserted= 0; 
> >>>>>>>              
> >>>>>>>
> >>updated=
> >>    
> >>
> >>>>>>>         
> >>>>>>>
> >>>>>>>              
> >>>>>>>
> >>>>0;
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>>total #(inserted::updated::deleted)=16::::
> >>>>>>>
> >>>>>>>Tue Feb  3 11:21:25 2004        FAILURES        Unable to process 1
> >>>>>>>    
> >>>>>>>
> >>>>>>>         
> >>>>>>>
> >>>>>>>              
> >>>>>>>
> >>>>>>entries.
> >>>>>>  
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>>>>See gbparserFailures/
> >>>>>>>Tue Feb  3 11:21:25 2004        RESULT  Genbank entries inserted=
> 0; 
> >>>>>>>updated= 0;  failed= 1
> >>>>>>>[oracle@localhost oracle]$ less gbparserFailures/errors
> >>>>>>>...
> >>>>>>>Can't call method "getAccession" on an undefined value at
> >>>>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
> >>>>>>>              
> >>>>>>>
> >>218,
> >>    
> >>
> >>>>>>>    
> >>>>>>>
> >>>>>>>         
> >>>>>>>
> >>>>>>>              
> >>>>>>>
> >>>>>><GEN0> line 84.
> >>>>>>  
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>>>>Is this important?
> >>>>>>>
> >>>>>>>-Thomas
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>    
> >>>>>>>
> >>>>>>>         
> >>>>>>>
> >>>>>>>              
> >>>>>>>
> >>>>>>>>thomas-
> >>>>>>>>
> >>>>>>>>do you know how to check the oracle system tables to see which
> >>>>>>>>                
> >>>>>>>>
> >>foreign
> >>    
> >>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>key is causing the "integrity constraint?"
> >>>>>>>>
> >>>>>>>>if not, i can send you a query to run.
> >>>>>>>>
> >>>>>>>>debbie and I looked it up, and it is the taxon_id that is failing.
>  
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>this is because the genbank parser requires you to fill in the
> taxon
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>tables (because the genbank records refer to taxon).
> >>>>>>>>
> >>>>>>>>take a look at fidel and sucheta's user guide on 
> >>>>>>>>http://www.gusdb.org/documentation.html.   i believe they discuss
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>this.
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>>>steve
> >>>>>>>>
> >>>>>>>>Thomas Otto wrote:
> >>>>>>>>
> >>>>>>>> 
> >>>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>>Hi Deborah,
> >>>>>>>>>
> >>>>>>>>>you are right, the values are testvalues. But there are also in
> the
> >>>>>>>>>sres.ExternalDatabaseRelease... is the gbRel so important? - I
> >>>>>>>>>                  
> >>>>>>>>>
> >>didn't
> >>    
> >>
> >>>>>>>>>        
> >>>>>>>>>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>>>see
> >>>>>>  
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>>>>>>   
> >>>>>>>>>
> >>>>>>>>>        
> >>>>>>>>>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>>>>>that it is
> >>>>>>>> 
> >>>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>>as a foreign key...
> >>>>>>>>>
> >>>>>>>>>Here the entrance of the sres.externaldatabaserelease:
> >>>>>>>>>135 |  1 |  15-JAN-04 |  10 |  tcrzidb.org |   |   |   |   |  The
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>genom
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>>>>   
> >>>>>>>>>
> >>>>>>>>>        
> >>>>>>>>>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>>>>>of
> >>>>>>>> 
> >>>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>>the tcruzi virus |  /seq/tcruzi.fcgi |   |   |   |  29-JAN-04 | 
> 1
> >>>>>>>>>                  
> >>>>>>>>>
> >>| 
> >>    
> >>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>1
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>>>>        
> >>>>>>>>>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>>>|
> >>>>>>  
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>>>>>>   
> >>>>>>>>>
> >>>>>>>>>        
> >>>>>>>>>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>>>>>1 |
> >>>>>>>> 
> >>>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>>1 |  1 |  0 |  6 |  3 |  2 |  1
> >>>>>>>>>and the modul call:
> >>>>>>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=10
> >>>>>>>>>--file=/seq/tcruzi.fcgi --start=1 --commit
> >>>>>>>>>
> >>>>>>>>>It gives the same error...
> >>>>>>>>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >>>>>>>>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD
> >>>>>>>>>                  
> >>>>>>>>>
> >>ERROR:
> >>    
> >>
> >>>>>>>>>   
> >>>>>>>>>
> >>>>>>>>>        
> >>>>>>>>>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>>>>>OCIStmtExecute) ...
> >>>>>>>> 
> >>>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>>Which part of the programm should manipulate the table
> >>>>>>>>>        
> >>>>>>>>>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>>>DOTS.NASEQUENCEIMP
> >>>>>>  
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>>>>>>   
> >>>>>>>>>
> >>>>>>>>>        
> >>>>>>>>>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>>>>>?
> >>>>>>>> 
> >>>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>>Thomas
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>   
> >>>>>>>>>
> >>>>>>>>>        
> >>>>>>>>>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>>>>>>>Hi Thomas,
> >>>>>>>>>>
> >>>>>>>>>>Apparently Steve is looking into this but I notice that
> >>>>>>>>>>external_database_release_id (--db_rel_id) is 135 and the
> genbank
> >>>>>>>>>>     
> >>>>>>>>>>
> >>>>>>>>>>          
> >>>>>>>>>>
> >>>>>>>>>>               
> >>>>>>>>>>
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>>>>>>>release
> >>>>>>>> 
> >>>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>>>(--gbRel) is 1.05. Those look suspicious as 135 is a somewhat
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>recent
> >>    
> >>
> >>>>>>>>>>release of GenBank although it could also be a valid
> >>>>>>>>>>external_database_release_id in your ExternalDatabaseRelease
> table
> >>>>>>>>>>          
> >>>>>>>>>>
> >>>>>>>>>>               
> >>>>>>>>>>
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>>>>>while
> >>>>>>  
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>>>>>>>1.05 doesn't look like a gb release number at all. I wonder if
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>your 
> >>    
> >>
> >>>>>>>>>>failure is due to a foreign key constraint referencing 
> >>>>>>>>>>ExternalDatabaseRelease because you actually don't have a PK in
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>that
> >>    
> >>
> >>>>>>>>>>     
> >>>>>>>>>>
> >>>>>>>>>>          
> >>>>>>>>>>
> >>>>>>>>>>               
> >>>>>>>>>>
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>>>>>>>table
> >>>>>>>> 
> >>>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>>>of 135. Easy to check. 
> >>>>>>>>>>
> >>>>>>>>>>                                 Debbie
> >>>>>>>>>>
> >>>>>>>>>>                                          
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>On Fri, 30 Jan 
> >>>>>>>>>>2004, Steve
> >>>>>>>>>>Fischer wrote:
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>     
> >>>>>>>>>>
> >>>>>>>>>>          
> >>>>>>>>>>
> >>>>>>>>>>               
> >>>>>>>>>>
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>>>>>>>>>>thomas-
> >>>>>>>>>>>
> >>>>>>>>>>>i don't have time right now to look into this (i am home and
> need
> >>>>>>>>>>>                 
> >>>>>>>>>>>
> >>>>>>>>>>>                      
> >>>>>>>>>>>
> >>>>to 
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>>>>>>take my daughter to skating lesson).  i will as soon as i can.
> >>>>>>>>>>>
> >>>>>>>>>>>steve
> >>>>>>>>>>>
> >>>>>>>>>>>Thomas Otto wrote:
> >>>>>>>>>>>
> >>>>>>>>>>>  
> >>>>>>>>>>>
> >>>>>>>>>>>       
> >>>>>>>>>>>
> >>>>>>>>>>>            
> >>>>>>>>>>>
> >>>>>>>>>>>                 
> >>>>>>>>>>>
> >>>>>>>>>>>                      
> >>>>>>>>>>>
> >>>>>>>>>>>>Hello -
> >>>>>>>>>>>>
> >>>>>>>>>>>>I am still fighting with the perl moduls.
> >>>>>>>>>>>>
> >>>>>>>>>>>>I.e. the GBParser to upload Genbank datasets gives following
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>>>error:
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>>>>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
> >>>>>>>>>>>>--file=/seq/tcruzi_3.fcgi --commit
> >>>>>>>>>>>>
> >>>>>>>>>>>>------------------ entry number 2 -----------------
> >>>>>>>>>>>>
> >>>>>>>>>>>>SQL ERROR!! involving
> >>>>>>>>>>>>
> >>>>>>>>>>>>INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> >>>>>>>>>>>>sequence_type_id, user_read, other_write, modification_date,
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>>>subcla
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>>>>>>>ss_view, row_group_id, user_write, other_read, group_write,
> >>>>>>>>>>>>external_database_release_id, source_id, g_count, c_count,
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>>>taxon_id,
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>>>>>>>    
> >>>>>>>>>>>>
> >>>>>>>>>>>>         
> >>>>>>>>>>>>
> >>>>>>>>>>>>              
> >>>>>>>>>>>>
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>>>>>>>>>nam
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>     
> >>>>>>>>>>
> >>>>>>>>>>          
> >>>>>>>>>>
> >>>>>>>>>>               
> >>>>>>>>>>
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>>>>>>>>>>>e, secondary_identifier, description, row_user_id, a_count,
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>>>t_count,
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>>>>>>>    
> >>>>>>>>>>>>
> >>>>>>>>>>>>         
> >>>>>>>>>>>>
> >>>>>>>>>>>>              
> >>>>>>>>>>>>
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>>>>>>>>>length,
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>     
> >>>>>>>>>>
> >>>>>>>>>>          
> >>>>>>>>>>
> >>>>>>>>>>               
> >>>>>>>>>>
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>>>>>>>>>>>row_project_id, row_alg_invocation_id, sequence_version
> >>>>>>>>>>>>, na_sequence_id )
> >>>>>>>>>>>>VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '',
> '',
> >>>>>>>>>>>>              
> >>>>>>>>>>>>
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>>>>>?,
> >>>>>>  
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>>>>>>>>>    
> >>>>>>>>>>>>
> >>>>>>>>>>>>         
> >>>>>>>>>>>>
> >>>>>>>>>>>>              
> >>>>>>>>>>>>
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>>>>>>>>>?,
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>     
> >>>>>>>>>>
> >>>>>>>>>>          
> >>>>>>>>>>
> >>>>>>>>>>               
> >>>>>>>>>>
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>>>>>>>>>>>?, ?, ?, '', '', ?, ?, ?, ?, ? )  
> >>>>>>>>>>>>
> >>>>>>>>>>>>Values:
> >>>>>>>>>>>>    
> >>>>>>>>>>>>
> >>>>>>>>>>>>         
> >>>>>>>>>>>>
> >>>>>>>>>>>>              
> >>>>>>>>>>>>
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
>
>>>>>>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
> >>>>>>            
> >>>>>>
> >>>>>>>         
> >>>>>>>
> >>>>>>>              
> >>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>>   
> >>>>>>>>>
> >>>>>>>>>        
> >>>>>>>>>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>>>>>>>     
> >>>>>>>>>>
> >>>>>>>>>>          
> >>>>>>>>>>
> >>>>>>>>>>               
> >>>>>>>>>>
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>>>>>>>>>>>ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1,
> 1,
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>>>0,
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>>>>>>>ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502,
> GI:4
> >>>>>>>>>>>>1056860, Oryctolagus cuniculus transgenic isolate COF12 clone
> 31
> >>>>>>>>>>>>    
> >>>>>>>>>>>>
> >>>>>>>>>>>>         
> >>>>>>>>>>>>
> >>>>>>>>>>>>              
> >>>>>>>>>>>>
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>>>>>>>>>Trypanosoma
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>     
> >>>>>>>>>>
> >>>>>>>>>>          
> >>>>>>>>>>
> >>>>>>>>>>               
> >>>>>>>>>>
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>>>>>>>>>>>cruzi Berenice putative chimeric protein gene, partial
> >>>>>>>>>>>>cds., 1, 177, 1, 28, 1, 1 at
> >>>>>>>>>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>185
> >>    
> >>
> >>>>>>>>>>>> 
> >>>>>>>>>>>>
> >>>>>>>>>>>>    
> >>>>>>>>>>>>
> >>>>>>>>>>>>         
> >>>>>>>>>>>>
> >>>>>>>>>>>>              
> >>>>>>>>>>>>
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
>
>>>>>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a}
> >>>>>>            
> >>>>>>
> >>>>>>>         
> >>>>>>>
> >>>>>>>              
> >>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>>   
> >>>>>>>>>
> >>>>>>>>>        
> >>>>>>>>>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>>>>>SQL ERROR!! involving\x{a} \x{a}    INSE
> >>>>>>>> 
> >>>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>>>     
> >>>>>>>>>>
> >>>>>>>>>>          
> >>>>>>>>>>
> >>>>>>>>>>               
> >>>>>>>>>>
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>>>>>>>>>>>RT INTO DoTS.ExternalNASequ...') called at
> >>>>>>>>>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>148
> >>    
> >>
> >>>>>>>>>>>> 
> >>>>>>>>>>>>
> >>>>>>>>>>>>    
> >>>>>>>>>>>>
> >>>>>>>>>>>>         
> >>>>>>>>>>>>
> >>>>>>>>>>>>              
> >>>>>>>>>>>>
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
>
>>>>>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
> >>>>>>            
> >>>>>>
> >>>>>>>         
> >>>>>>>
> >>>>>>>              
> >>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>>   
> >>>>>>>>>
> >>>>>>>>>        
> >>>>>>>>>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>>>>>>>     
> >>>>>>>>>>
> >>>>>>>>>>          
> >>>>>>>>>>
> >>>>>>>>>>               
> >>>>>>>>>>
> >>>>>>>>>>                    
> >>>>>>>>>>
> >>>>>>>>>>>>)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>>>DoTS.ExternalNASequence
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>>>>>>>              
> >>>>>>>>>>>>
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
> >>>>>>(
> >>>>>>  
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>>>>>>>>>sequence, group_r...') called at /home/oracle/gus_home/lib/pe
> >>>>>>>>>>>>rl/GUS/ObjRelP/DbiRow.pm line 674
> >>>>>>>>>>>> 
> >>>>>>>>>>>>
> >>>>>>>>>>>>    
> >>>>>>>>>>>>
> >>>>>>>>>>>>         
> >>>>>>>>>>>>
> >>>>>>>>>>>>              
> >>>>>>>>>>>>
> >>>>>>>>>>>>                   
> >>>>>>>>>>>>
> >>>>>>>>>>>>                        
> >>>>>>>>>>>>
>
>>>>>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)')
> >>>>>>            
> >>>>>>
> >>>>>>>         
> >>>>>>>
> >>>>>>>              
> >>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>
> >>>>>>>>                
> >>>>>>>>
> >>>>>>>>>   
> >>>>>>>>>
> >>>>>>>>>        
> >>>>>>>>>
> >>>>>>>>>             
> >>>>>>>>>
> >>>>>>>>>                  
> >>>>>>>>>
> >>>>>>>>called at /
> >>>>>>>> 
> >>>>>>>>
> >>>>>>>>      
> >>>>>>>>
> >>>>>>>>           
> >>>>>>>>                
> >>>>>>>>
> 
> 
> 
> -------------------------------------------------------
> The SF.Net email is sponsored by EclipseCon 2004
> Premiere Conference on Open Tools Development and Integration
> See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> http://www.eclipsecon.org/osdn
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> 

Re: [Gusdev-gusdev] InsertNewExternalSequences / insert of DNA sequences

[Thomas O. <th...@gm...>]

Hello,

just saw, that I asked this once - and found the solution - here an exemple:
ga GUS::Common::Plugin::InsertNewExternalSequences
--external_database_release_id=333 --sequencefile=/seq/Tcruziklein.fasta
--table_name=DoTS::ExternalNASequence --regex_source_id="gi\|(\w+)\|(.*)" -regex_secondary_id="gb\|(\w+)"
--regex_name="\| (.+)$" --writeFile=/seq/insertCruzi.log --commit

Important is the --regex_source_id=">gi\|(\w+)\|" to get the ID of the
sequence... --regex_source_id=">name\|(\w+)" will work too.

I hope, it might help,
Thomas

> Hey everybody,
> 
> I wanted to know, if the bug in the InsertNewExternalSequences.pm is
> fixed,
> or I did an error in the usage...
> Maybe just give me a workaround to insert my DNA sequences in the DB with
> a
> perl modul.
> 
> Thanks,
> 
> Thomas
> 
> 
> 
> -------------------------------------------------------
> The SF.Net email is sponsored by EclipseCon 2004
> Premiere Conference on Open Tools Development and Integration
> See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> http://www.eclipsecon.org/osdn
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> 

Re: [Gusdev-gusdev] GBParser - problems with the perl modules

[Steve F. <sfi...@pc...>]

thomas-

i found the problem.  it is the last line of your file:

    40921 cctcttccac ttcgtttcat tcttccaaca cctgcagccc caaatccatt tctaccgtct
    40981 acaagagttg gaggtctttc tcataatcat ctattcattc cccatcaacc gtttactact
    41041 cttgtttcga ccgattctag atattctgca ccgaaccctc tttctcatcg acttccaaac
    41101 gagatttgcc gagttcatat gaattcaaat cctttccatt tttagtttta ttactctacc
    41161 aaataattaa acagactttt cctatcgggt cccctaattt tctttcattt ttcaggcatc
    41221 tcggttgttt ttttcaaagt attttgacct aattttccat gttgaaatta ataaaatatt
    41281 tattaaatga acacaaacac agatgttgga attgtcttct tctggtcaag tactggatat
    41341 actctctttt tttgataatg ctgaattga
//


the '//' is confusing the parser into thinking that there is another entry.

to workaround this bug delete that line from your file.

steve

Thomas Otto wrote:

>Hi Steve,
>
>I send you a sequence...
>
>Maybe I have an idea why I have so much problems. Is it possible, that the
>Oracle is kind of delaying? I just retried to insert the first test sequences,
>and today it worked!!??!!
>The one I send you doesn't work - same error. So what could it be? The only
>logic thing, would be the DB... (I am using Red Hat and Oracle 9.2 - there
>are not certificaded together - I am just working on a testsystem, later on we
>will put it on a 'real' server...)
>
>So, could this be?
>
>This would explain also other problems I had...
>
>- Thomas
>
>
>  
>
>>thomas-
>>
>>i think the error message is important, because it causes the plugin to 
>>abort.
>>
>>can you send a file?
>>
>>steve
>>
>>Thomas Otto wrote:
>>
>>    
>>
>>>Steve-
>>>I just picked one of the 'trypanosoma cruzi'... maybe just give me one
>>>      
>>>
>>that
>>    
>>
>>>should work.
>>>
>>>I tried also other entries... 
>>>One thing is, that I can only try it with some entries, where I have the
>>>taxon in the DB. I couldn't install it totaly, because the ga wanted more
>>>      
>>>
>>memory
>>    
>>
>>>than my swap of 1GB could give him... 
>>>
>>>Actually I do not know, what the error means:
>>>Can't call method "getAccession" on an undefined value at
>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
>>>218, <GEN0> line 61.
>>>maybe it is not so important, because the data seem to be in the
>>>      
>>>
>>database...
>>    
>>
>>>Thomas
>>>
>>> 
>>>
>>>      
>>>
>>>>debbie-
>>>>
>>>>we need to help thomas succeed in his use of the GBParser.
>>>>
>>>>do you have any ideas?   would it make sense to get his input file from 
>>>>him and try to run it here?
>>>>
>>>>looking at the code, the problem seems that he is trying to get the 
>>>>first ACCESSION field from his file, but it is not found
>>>>
>>>> ## Check NAEntry for update
>>>> my $naentry = GUS::Model::DoTS::NAEntry->new({'source_id' => 
>>>>$e->{'ACCESSION'}->[0]->getAccession(),
>>>>                          });
>>>>
>>>>
>>>>thomas-  how big is the file you are trying to parse?  if its not too 
>>>>big, why don't you send it.
>>>>
>>>>
>>>>steve
>>>>
>>>>
>>>>Thomas Otto wrote:
>>>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>Steve-
>>>>>
>>>>>I just downloaded the version anothertime with cvs and did an install.
>>>>>
>>>>>here the call and the log:
>>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1
>>>>>--file=/seq/tcruzi.fcgi --commit 2>&1| tee sonstiges/GBParser.log
>>>>>Reading properties from /home/oracle/gus_home/config/GUS-PluginMgr.prop
>>>>>Reading properties from /home/oracle/.gus.properties
>>>>>Tue Feb  3 15:24:34 2004        COMMIT  commit on
>>>>>Maximum number of  objects set to 50000
>>>>>Tue Feb  3 15:24:34 2004        RELEASE 1
>>>>>
>>>>>Tue Feb  3 15:24:34 2004        FILE    /seq/tcruzi.fcgi
>>>>>
>>>>>VLD     CBIL::Bio::GenBank::Locus       1
>>>>>VLD     CBIL::Bio::GenBank::Definition  1
>>>>>VLD     CBIL::Bio::GenBank::Accession   1
>>>>>VLD     CBIL::Bio::GenBank::Version     1
>>>>>VLD     CBIL::Bio::GenBank::Keywords    1
>>>>>VLD     CBIL::Bio::GenBank::Source      1
>>>>>VLD     CBIL::Bio::GenBank::Reference   1
>>>>>VLD     CBIL::Bio::GenBank::Reference   1
>>>>>RUN     1..2961
>>>>>VLD     CBIL::Bio::GenBank::Features    1
>>>>>VLD     CBIL::Bio::GenBank::Origin      1
>>>>>Tue Feb  3 15:24:35 2004        STATUS  N=1 ACC=AC116948        
>>>>>TOTAL_OBJECTS=16
>>>>>Tue Feb  3 15:24:35 2004        Genbank entries inserted= 0;  updated=
>>>>>          
>>>>>
>>0;
>>    
>>
>>>>>total #(inserted::updated::deleted)=16::::
>>>>>
>>>>>Tue Feb  3 15:24:35 2004        FAILURES        Unable to process 1
>>>>>     
>>>>>
>>>>>          
>>>>>
>>>>entries.
>>>>   
>>>>
>>>>        
>>>>
>>>>>See gbparserFailures/
>>>>>Tue Feb  3 15:24:35 2004        RESULT  Genbank entries inserted= 0; 
>>>>>updated= 0;  failed= 1
>>>>>
>>>>>The errorfile
>>>>>cat gbparserFailures/errors
>>>>>------------------ entry number 2 -----------------
>>>>>Can't call method "getAccession" on an undefined value at
>>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
>>>>>218, <GEN0> line 84.
>>>>>
>>>>>
>>>>>Cheers,
>>>>>Thomas
>>>>>
>>>>>
>>>>>
>>>>>     
>>>>>
>>>>>          
>>>>>
>>>>>>thomas-
>>>>>>
>>>>>>please send me your version of the GBParser.pm and the complete log...
>>>>>>            
>>>>>>
>> 
>>    
>>
>>>>>>       
>>>>>>
>>>>>>that might help me figure out what is wrong.
>>>>>>
>>>>>>steve
>>>>>>
>>>>>>Thomas Otto wrote:
>>>>>>
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>>>Steve,
>>>>>>>
>>>>>>>true, I had to install the taxon stuff. The datas are inserted in the
>>>>>>>NAseqenceimp table
>>>>>>>
>>>>>>>But now I get an error- (this is not the first call!!!)
>>>>>>>Tue Feb  3 11:21:25 2004        Genbank entries inserted= 0; 
>>>>>>>              
>>>>>>>
>>updated=
>>    
>>
>>>>>>>         
>>>>>>>
>>>>>>>              
>>>>>>>
>>>>0;
>>>>   
>>>>
>>>>        
>>>>
>>>>>>>total #(inserted::updated::deleted)=16::::
>>>>>>>
>>>>>>>Tue Feb  3 11:21:25 2004        FAILURES        Unable to process 1
>>>>>>>    
>>>>>>>
>>>>>>>         
>>>>>>>
>>>>>>>              
>>>>>>>
>>>>>>entries.
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>>>See gbparserFailures/
>>>>>>>Tue Feb  3 11:21:25 2004        RESULT  Genbank entries inserted= 0; 
>>>>>>>updated= 0;  failed= 1
>>>>>>>[oracle@localhost oracle]$ less gbparserFailures/errors
>>>>>>>...
>>>>>>>Can't call method "getAccession" on an undefined value at
>>>>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
>>>>>>>              
>>>>>>>
>>218,
>>    
>>
>>>>>>>    
>>>>>>>
>>>>>>>         
>>>>>>>
>>>>>>>              
>>>>>>>
>>>>>><GEN0> line 84.
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>>>Is this important?
>>>>>>>
>>>>>>>-Thomas
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>    
>>>>>>>
>>>>>>>         
>>>>>>>
>>>>>>>              
>>>>>>>
>>>>>>>>thomas-
>>>>>>>>
>>>>>>>>do you know how to check the oracle system tables to see which
>>>>>>>>                
>>>>>>>>
>>foreign
>>    
>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>key is causing the "integrity constraint?"
>>>>>>>>
>>>>>>>>if not, i can send you a query to run.
>>>>>>>>
>>>>>>>>debbie and I looked it up, and it is the taxon_id that is failing.  
>>>>>>>>                
>>>>>>>>
>>>>>>>>this is because the genbank parser requires you to fill in the taxon
>>>>>>>>                
>>>>>>>>
>>>>>>>>tables (because the genbank records refer to taxon).
>>>>>>>>
>>>>>>>>take a look at fidel and sucheta's user guide on 
>>>>>>>>http://www.gusdb.org/documentation.html.   i believe they discuss
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>this.
>>>>   
>>>>
>>>>        
>>>>
>>>>>>>>steve
>>>>>>>>
>>>>>>>>Thomas Otto wrote:
>>>>>>>>
>>>>>>>> 
>>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>>>>>>Hi Deborah,
>>>>>>>>>
>>>>>>>>>you are right, the values are testvalues. But there are also in the
>>>>>>>>>sres.ExternalDatabaseRelease... is the gbRel so important? - I
>>>>>>>>>                  
>>>>>>>>>
>>didn't
>>    
>>
>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>see
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>>>>>   
>>>>>>>>>
>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>>>that it is
>>>>>>>> 
>>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>>>>>>as a foreign key...
>>>>>>>>>
>>>>>>>>>Here the entrance of the sres.externaldatabaserelease:
>>>>>>>>>135 |  1 |  15-JAN-04 |  10 |  tcrzidb.org |   |   |   |   |  The
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>genom
>>>>   
>>>>
>>>>        
>>>>
>>>>>>>>>   
>>>>>>>>>
>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>>>of
>>>>>>>> 
>>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>>>>>>the tcruzi virus |  /seq/tcruzi.fcgi |   |   |   |  29-JAN-04 |  1
>>>>>>>>>                  
>>>>>>>>>
>>| 
>>    
>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>1
>>>>   
>>>>
>>>>        
>>>>
>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>|
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>>>>>   
>>>>>>>>>
>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>>>1 |
>>>>>>>> 
>>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>>>>>>1 |  1 |  0 |  6 |  3 |  2 |  1
>>>>>>>>>and the modul call:
>>>>>>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=10
>>>>>>>>>--file=/seq/tcruzi.fcgi --start=1 --commit
>>>>>>>>>
>>>>>>>>>It gives the same error...
>>>>>>>>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
>>>>>>>>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD
>>>>>>>>>                  
>>>>>>>>>
>>ERROR:
>>    
>>
>>>>>>>>>   
>>>>>>>>>
>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>>>OCIStmtExecute) ...
>>>>>>>> 
>>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>>>>>>Which part of the programm should manipulate the table
>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>DOTS.NASEQUENCEIMP
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>>>>>   
>>>>>>>>>
>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>>>?
>>>>>>>> 
>>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>>>>>>Thomas
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>   
>>>>>>>>>
>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>>>>>Hi Thomas,
>>>>>>>>>>
>>>>>>>>>>Apparently Steve is looking into this but I notice that
>>>>>>>>>>external_database_release_id (--db_rel_id) is 135 and the genbank
>>>>>>>>>>     
>>>>>>>>>>
>>>>>>>>>>          
>>>>>>>>>>
>>>>>>>>>>               
>>>>>>>>>>
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>release
>>>>>>>> 
>>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>(--gbRel) is 1.05. Those look suspicious as 135 is a somewhat
>>>>>>>>>>                    
>>>>>>>>>>
>>recent
>>    
>>
>>>>>>>>>>release of GenBank although it could also be a valid
>>>>>>>>>>external_database_release_id in your ExternalDatabaseRelease table
>>>>>>>>>>          
>>>>>>>>>>
>>>>>>>>>>               
>>>>>>>>>>
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>while
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>>>>>>1.05 doesn't look like a gb release number at all. I wonder if
>>>>>>>>>>                    
>>>>>>>>>>
>>your 
>>    
>>
>>>>>>>>>>failure is due to a foreign key constraint referencing 
>>>>>>>>>>ExternalDatabaseRelease because you actually don't have a PK in
>>>>>>>>>>                    
>>>>>>>>>>
>>that
>>    
>>
>>>>>>>>>>     
>>>>>>>>>>
>>>>>>>>>>          
>>>>>>>>>>
>>>>>>>>>>               
>>>>>>>>>>
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>table
>>>>>>>> 
>>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>of 135. Easy to check. 
>>>>>>>>>>
>>>>>>>>>>                                 Debbie
>>>>>>>>>>
>>>>>>>>>>                                          
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>On Fri, 30 Jan 
>>>>>>>>>>2004, Steve
>>>>>>>>>>Fischer wrote:
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>     
>>>>>>>>>>
>>>>>>>>>>          
>>>>>>>>>>
>>>>>>>>>>               
>>>>>>>>>>
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>>>>thomas-
>>>>>>>>>>>
>>>>>>>>>>>i don't have time right now to look into this (i am home and need
>>>>>>>>>>>                 
>>>>>>>>>>>
>>>>>>>>>>>                      
>>>>>>>>>>>
>>>>to 
>>>>   
>>>>
>>>>        
>>>>
>>>>>>>>>>>take my daughter to skating lesson).  i will as soon as i can.
>>>>>>>>>>>
>>>>>>>>>>>steve
>>>>>>>>>>>
>>>>>>>>>>>Thomas Otto wrote:
>>>>>>>>>>>
>>>>>>>>>>>  
>>>>>>>>>>>
>>>>>>>>>>>       
>>>>>>>>>>>
>>>>>>>>>>>            
>>>>>>>>>>>
>>>>>>>>>>>                 
>>>>>>>>>>>
>>>>>>>>>>>                      
>>>>>>>>>>>
>>>>>>>>>>>>Hello -
>>>>>>>>>>>>
>>>>>>>>>>>>I am still fighting with the perl moduls.
>>>>>>>>>>>>
>>>>>>>>>>>>I.e. the GBParser to upload Genbank datasets gives following
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>error:
>>>>   
>>>>
>>>>        
>>>>
>>>>>>>>>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
>>>>>>>>>>>>--file=/seq/tcruzi_3.fcgi --commit
>>>>>>>>>>>>
>>>>>>>>>>>>------------------ entry number 2 -----------------
>>>>>>>>>>>>
>>>>>>>>>>>>SQL ERROR!! involving
>>>>>>>>>>>>
>>>>>>>>>>>>INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
>>>>>>>>>>>>sequence_type_id, user_read, other_write, modification_date,
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>subcla
>>>>   
>>>>
>>>>        
>>>>
>>>>>>>>>>>>ss_view, row_group_id, user_write, other_read, group_write,
>>>>>>>>>>>>external_database_release_id, source_id, g_count, c_count,
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>taxon_id,
>>>>   
>>>>
>>>>        
>>>>
>>>>>>>>>>>>    
>>>>>>>>>>>>
>>>>>>>>>>>>         
>>>>>>>>>>>>
>>>>>>>>>>>>              
>>>>>>>>>>>>
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>>>>>nam
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>     
>>>>>>>>>>
>>>>>>>>>>          
>>>>>>>>>>
>>>>>>>>>>               
>>>>>>>>>>
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>>>>>e, secondary_identifier, description, row_user_id, a_count,
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>t_count,
>>>>   
>>>>
>>>>        
>>>>
>>>>>>>>>>>>    
>>>>>>>>>>>>
>>>>>>>>>>>>         
>>>>>>>>>>>>
>>>>>>>>>>>>              
>>>>>>>>>>>>
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>>>>>length,
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>     
>>>>>>>>>>
>>>>>>>>>>          
>>>>>>>>>>
>>>>>>>>>>               
>>>>>>>>>>
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>>>>>row_project_id, row_alg_invocation_id, sequence_version
>>>>>>>>>>>>, na_sequence_id )
>>>>>>>>>>>>VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '',
>>>>>>>>>>>>              
>>>>>>>>>>>>
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>?,
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>>>>>>>>    
>>>>>>>>>>>>
>>>>>>>>>>>>         
>>>>>>>>>>>>
>>>>>>>>>>>>              
>>>>>>>>>>>>
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>>>>>?,
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>     
>>>>>>>>>>
>>>>>>>>>>          
>>>>>>>>>>
>>>>>>>>>>               
>>>>>>>>>>
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>>>>>?, ?, ?, '', '', ?, ?, ?, ?, ? )  
>>>>>>>>>>>>
>>>>>>>>>>>>Values:
>>>>>>>>>>>>    
>>>>>>>>>>>>
>>>>>>>>>>>>         
>>>>>>>>>>>>
>>>>>>>>>>>>              
>>>>>>>>>>>>
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
>>>>>>            
>>>>>>
>>>>>>>         
>>>>>>>
>>>>>>>              
>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>>>>>>   
>>>>>>>>>
>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>>>>>     
>>>>>>>>>>
>>>>>>>>>>          
>>>>>>>>>>
>>>>>>>>>>               
>>>>>>>>>>
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>>>>>ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1,
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>0,
>>>>   
>>>>
>>>>        
>>>>
>>>>>>>>>>>>ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
>>>>>>>>>>>>1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31
>>>>>>>>>>>>    
>>>>>>>>>>>>
>>>>>>>>>>>>         
>>>>>>>>>>>>
>>>>>>>>>>>>              
>>>>>>>>>>>>
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>>>>>Trypanosoma
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>     
>>>>>>>>>>
>>>>>>>>>>          
>>>>>>>>>>
>>>>>>>>>>               
>>>>>>>>>>
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>>>>>cruzi Berenice putative chimeric protein gene, partial
>>>>>>>>>>>>cds., 1, 177, 1, 28, 1, 1 at
>>>>>>>>>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>185
>>    
>>
>>>>>>>>>>>> 
>>>>>>>>>>>>
>>>>>>>>>>>>    
>>>>>>>>>>>>
>>>>>>>>>>>>         
>>>>>>>>>>>>
>>>>>>>>>>>>              
>>>>>>>>>>>>
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a}
>>>>>>            
>>>>>>
>>>>>>>         
>>>>>>>
>>>>>>>              
>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>>>>>>   
>>>>>>>>>
>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>>>SQL ERROR!! involving\x{a} \x{a}    INSE
>>>>>>>> 
>>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>     
>>>>>>>>>>
>>>>>>>>>>          
>>>>>>>>>>
>>>>>>>>>>               
>>>>>>>>>>
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>>>>>RT INTO DoTS.ExternalNASequ...') called at
>>>>>>>>>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>148
>>    
>>
>>>>>>>>>>>> 
>>>>>>>>>>>>
>>>>>>>>>>>>    
>>>>>>>>>>>>
>>>>>>>>>>>>         
>>>>>>>>>>>>
>>>>>>>>>>>>              
>>>>>>>>>>>>
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
>>>>>>            
>>>>>>
>>>>>>>         
>>>>>>>
>>>>>>>              
>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>>>>>>   
>>>>>>>>>
>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>>>>>     
>>>>>>>>>>
>>>>>>>>>>          
>>>>>>>>>>
>>>>>>>>>>               
>>>>>>>>>>
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>>>>>)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>DoTS.ExternalNASequence
>>>>   
>>>>
>>>>        
>>>>
>>>>>>>>>>>>              
>>>>>>>>>>>>
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>(
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>>>>>>>>sequence, group_r...') called at /home/oracle/gus_home/lib/pe
>>>>>>>>>>>>rl/GUS/ObjRelP/DbiRow.pm line 674
>>>>>>>>>>>> 
>>>>>>>>>>>>
>>>>>>>>>>>>    
>>>>>>>>>>>>
>>>>>>>>>>>>         
>>>>>>>>>>>>
>>>>>>>>>>>>              
>>>>>>>>>>>>
>>>>>>>>>>>>                   
>>>>>>>>>>>>
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)')
>>>>>>            
>>>>>>
>>>>>>>         
>>>>>>>
>>>>>>>              
>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>
>>>>>>>>                
>>>>>>>>
>>>>>>>>>   
>>>>>>>>>
>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>>>called at /
>>>>>>>> 
>>>>>>>>
>>>>>>>>      
>>>>>>>>
>>>>>>>>           
>>>>>>>>                
>>>>>>>>

Re: [Gusdev-gusdev] GBParser - problems with the perl modules

[Steve F. <sfi...@pc...>]

thomas-

i tested your file.   i found the problem.  it is the last line of the file:

    40921 cctcttccac ttcgtttcat tcttccaaca cctgcagccc caaatccatt tctaccgtct
    40981 acaagagttg gaggtctttc tcataatcat ctattcattc cccatcaacc gtttactact
    41041 cttgtttcga ccgattctag atattctgca ccgaaccctc tttctcatcg acttccaaac
    41101 gagatttgcc gagttcatat gaattcaaat cctttccatt tttagtttta ttactctacc
    41161 aaataattaa acagactttt cctatcgggt cccctaattt tctttcattt ttcaggcatc
    41221 tcggttgttt ttttcaaagt attttgacct aattttccat gttgaaatta ataaaatatt
    41281 tattaaatga acacaaacac agatgttgga attgtcttct tctggtcaag tactggatat
    41341 actctctttt tttgataatg ctgaattga
//

the '//' is confusing the parser into thinking that there is another 
record.   to workaround this bug, delete that line.

steve

Thomas Otto wrote:

Re: [Gusdev-gusdev] GBParser - problems with the perl modules

[Thomas O. <th...@gm...>]

Steve-

I just downloaded the version anothertime with cvs and did an install.

here the call and the log:
 ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1
--file=/seq/tcruzi.fcgi --commit 2>&1| tee sonstiges/GBParser.log
Reading properties from /home/oracle/gus_home/config/GUS-PluginMgr.prop
Reading properties from /home/oracle/.gus.properties
Tue Feb  3 15:24:34 2004        COMMIT  commit on
Maximum number of  objects set to 50000
Tue Feb  3 15:24:34 2004        RELEASE 1
 
Tue Feb  3 15:24:34 2004        FILE    /seq/tcruzi.fcgi
 
VLD     CBIL::Bio::GenBank::Locus       1
VLD     CBIL::Bio::GenBank::Definition  1
VLD     CBIL::Bio::GenBank::Accession   1
VLD     CBIL::Bio::GenBank::Version     1
VLD     CBIL::Bio::GenBank::Keywords    1
VLD     CBIL::Bio::GenBank::Source      1
VLD     CBIL::Bio::GenBank::Reference   1
VLD     CBIL::Bio::GenBank::Reference   1
RUN     1..2961
VLD     CBIL::Bio::GenBank::Features    1
VLD     CBIL::Bio::GenBank::Origin      1
Tue Feb  3 15:24:35 2004        STATUS  N=1 ACC=AC116948        
TOTAL_OBJECTS=16
Tue Feb  3 15:24:35 2004        Genbank entries inserted= 0;  updated= 0;
total #(inserted::updated::deleted)=16::::
 
Tue Feb  3 15:24:35 2004        FAILURES        Unable to process 1 entries.
See gbparserFailures/
Tue Feb  3 15:24:35 2004        RESULT  Genbank entries inserted= 0; 
updated= 0;  failed= 1

The errorfile
 cat gbparserFailures/errors
 ------------------ entry number 2 -----------------
Can't call method "getAccession" on an undefined value at
/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
218, <GEN0> line 84.


Cheers,
Thomas

> thomas-
> 
> please send me your version of the GBParser.pm and the complete log...   
> that might help me figure out what is wrong.
> 
> steve
> 
> Thomas Otto wrote:
> 
> >Steve,
> >
> >true, I had to install the taxon stuff. The datas are inserted in the
> >NAseqenceimp table
> >
> >But now I get an error- (this is not the first call!!!)
> >Tue Feb  3 11:21:25 2004        Genbank entries inserted= 0;  updated= 0;
> >total #(inserted::updated::deleted)=16::::
> >
> >Tue Feb  3 11:21:25 2004        FAILURES        Unable to process 1
> entries.
> >See gbparserFailures/
> >Tue Feb  3 11:21:25 2004        RESULT  Genbank entries inserted= 0; 
> >updated= 0;  failed= 1
> >[oracle@localhost oracle]$ less gbparserFailures/errors
> >...
> >Can't call method "getAccession" on an undefined value at
> >/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 218,
> <GEN0> line 84.
> >
> >Is this important?
> >
> >-Thomas
> >
> >
> >  
> >
> >>thomas-
> >>
> >>do you know how to check the oracle system tables to see which foreign 
> >>key is causing the "integrity constraint?"
> >>
> >>if not, i can send you a query to run.
> >>
> >>debbie and I looked it up, and it is the taxon_id that is failing.   
> >>this is because the genbank parser requires you to fill in the taxon 
> >>tables (because the genbank records refer to taxon).
> >>
> >>take a look at fidel and sucheta's user guide on 
> >>http://www.gusdb.org/documentation.html.   i believe they discuss this.
> >>
> >>steve
> >>
> >>Thomas Otto wrote:
> >>
> >>    
> >>
> >>>Hi Deborah,
> >>>
> >>>you are right, the values are testvalues. But there are also in the
> >>>sres.ExternalDatabaseRelease... is the gbRel so important? - I didn't
> see
> >>>      
> >>>
> >>that it is
> >>    
> >>
> >>>as a foreign key...
> >>>
> >>>Here the entrance of the sres.externaldatabaserelease:
> >>>135 |  1 |  15-JAN-04 |  10 |  tcrzidb.org |   |   |   |   |  The genom
> >>>      
> >>>
> >>of
> >>    
> >>
> >>>the tcruzi virus |  /seq/tcruzi.fcgi |   |   |   |  29-JAN-04 |  1 |  1
> |
> >>>      
> >>>
> >> 1 |
> >>    
> >>
> >>>1 |  1 |  0 |  6 |  3 |  2 |  1
> >>>and the modul call:
> >>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=10
> >>>--file=/seq/tcruzi.fcgi --start=1 --commit
> >>>
> >>>It gives the same error...
> >>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR:
> >>>      
> >>>
> >>OCIStmtExecute) ...
> >>    
> >>
> >>>Which part of the programm should manipulate the table
> DOTS.NASEQUENCEIMP
> >>>      
> >>>
> >>?
> >>    
> >>
> >>>Thomas
> >>>
> >>> 
> >>>
> >>>      
> >>>
> >>>>Hi Thomas,
> >>>>
> >>>>Apparently Steve is looking into this but I notice that
> >>>>external_database_release_id (--db_rel_id) is 135 and the genbank
> >>>>        
> >>>>
> >>release
> >>    
> >>
> >>>>(--gbRel) is 1.05. Those look suspicious as 135 is a somewhat recent
> >>>>release of GenBank although it could also be a valid
> >>>>external_database_release_id in your ExternalDatabaseRelease table
> while
> >>>>1.05 doesn't look like a gb release number at all. I wonder if your 
> >>>>failure is due to a foreign key constraint referencing 
> >>>>ExternalDatabaseRelease because you actually don't have a PK in that
> >>>>        
> >>>>
> >>table
> >>    
> >>
> >>>>of 135. Easy to check. 
> >>>>
> >>>>                                    Debbie
> >>>>
> >>>>                                             
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>On Fri, 30 Jan 
> >>>>2004, Steve
> >>>>Fischer wrote:
> >>>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>thomas-
> >>>>>
> >>>>>i don't have time right now to look into this (i am home and need to 
> >>>>>take my daughter to skating lesson).  i will as soon as i can.
> >>>>>
> >>>>>steve
> >>>>>
> >>>>>Thomas Otto wrote:
> >>>>>
> >>>>>     
> >>>>>
> >>>>>          
> >>>>>
> >>>>>>Hello -
> >>>>>>
> >>>>>>I am still fighting with the perl moduls.
> >>>>>>
> >>>>>>I.e. the GBParser to upload Genbank datasets gives following error:
> >>>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
> >>>>>>--file=/seq/tcruzi_3.fcgi --commit
> >>>>>>
> >>>>>>------------------ entry number 2 -----------------
> >>>>>>
> >>>>>>SQL ERROR!! involving
> >>>>>>
> >>>>>>  INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> >>>>>>sequence_type_id, user_read, other_write, modification_date, subcla
> >>>>>>ss_view, row_group_id, user_write, other_read, group_write,
> >>>>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>nam
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>length,
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>row_project_id, row_alg_invocation_id, sequence_version
> >>>>>>, na_sequence_id )
> >>>>>>  VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '',
> ?,
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>?,
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>?, ?, ?, '', '', ?, ?, ?, ?, ? )  
> >>>>>>
> >>>>>>Values:
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
> >>>>>>ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
> >>>>>>1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>Trypanosoma
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>cruzi Berenice putative chimeric protein gene, partial
> >>>>>>cds., 1, 177, 1, 28, 1, 1 at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a}
> >>>      
> >>>
> >>SQL ERROR!! involving\x{a} \x{a}    INSE
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>RT INTO DoTS.ExternalNASequ...') called at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO DoTS.ExternalNASequence
> (
> >>>>>>sequence, group_r...') called at /home/oracle/gus_home/lib/pe
> >>>>>>rl/GUS/ObjRelP/DbiRow.pm line 674
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)')
> >>>      
> >>>
> >>called at /
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)')
> >>>      
> >>>
> >>called at /home/oracle/gus_home/lib/per
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>l/GUS/Model/GusRow.pm line 1677
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)')
> >>>      
> >>>
> >>called at /home/oracle/gus_home/lib/perl/
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>GUS/Common/Plugin/GBParser.pm line 284
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>=HASH(0x8ec41bc)') called at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
> 185
> >>>>>>      eval {...} called at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
> 184
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)')
> >>>      
> >>>
> >>called at /home/oracle
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
> >>>>>>      eval {...} called at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> >>>>>>            
> >>>>>>
> >>427
> >>    
> >>
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>ser') called at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> >>>>>>            
> >>>>>>
> >>283
> >>    
> >>
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>) called at
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>line 192
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)')
> >>>      
> >>>
> >>called at /
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>home/oracle/gus_home/bin/ga line 11
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>on the prompt, following error is to see:
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>********GEtting loc below30
> >>>>>>
> >>>>>>VLD     CBIL::Bio::GenBank::Locus       1
> >>>>>>VLD     CBIL::Bio::GenBank::Definition  1
> >>>>>>VLD     CBIL::Bio::GenBank::Accession   1
> >>>>>>VLD     CBIL::Bio::GenBank::Version     1
> >>>>>>VLD     CBIL::Bio::GenBank::Keywords    1
> >>>>>>VLD     CBIL::Bio::GenBank::Source      1
> >>>>>>VLD     CBIL::Bio::GenBank::Reference   1
> >>>>>>VLD     CBIL::Bio::GenBank::Reference   1
> >>>>>>RUN     1..177
> >>>>>>RUN     1..46
> >>>>>>RUN     <30..>177
> >>>>>>RUN     30..>177
> >>>>>>VLD     CBIL::Bio::GenBank::Features    1
> >>>>>>VLD     CBIL::Bio::GenBank::Origin      1
> >>>>>>Fri Jan 30 15:41:11 2004        STATUS  N=2 ACC=AY488502        
> >>>>>>TOTAL_OBJECTS=16
> >>>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>>>GUS::Model::DoTS::Source        ::      mol_type        ::     
> >>>>>>            
> >>>>>>
> >>genomic
> >>    
> >>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>DNA
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>>>GUS::Model::DoTS::Source        ::      transgenic      ::
> >>>>>>
> >>>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>>>GUS::Model::DoTS::Source        ::      mol_type        ::     
> >>>>>>            
> >>>>>>
> >>genomic
> >>    
> >>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>DNA
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >>>>>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
> >>>>>>: OCIStmtExecute) [for Statement "
> >>>>>>  INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> >>>>>>sequence_type_id, user_read, other_write, modification_date, subcla
> >>>>>>ss_view, row_group_id, user_write, other_read, group_write,
> >>>>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>nam
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>length,
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>row_project_id, row_alg_invocation_id, sequence_version
> >>>>>>, na_sequence_id )
> >>>>>>  VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '',
> ?,
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>?,
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
> >>>>>>0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502',
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>:p15='GI:41056860',
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
> >>>>>>2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
> >>>>>>Trypanosoma cruzi Berenice putative chimeric protein gene, partia
> >>>>>>l cds.', :p6='ExternalNASequence',
> >>>>>>:p3='1',
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
>
>>>cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa',
> >>>      
> >>>
> >>:p7='1', :p17='1', :p22=1, :p9=1, :
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>p11=135] at
> /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>line
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>145, <GEN0> line 112.
> >>>>>>Fri Jan 30 15:41:12 2004        Genbank entries inserted= 0; 
> updated=
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>0;
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>total #(inserted::updated::deleted)=16::::
> >>>>>>
> >>>>>>Fri Jan 30 15:41:12 2004        FAILURES        Unable to process 2
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>entries.
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>See gbparserFailures/
> >>>>>>Fri Jan 30 15:41:12 2004        RESULT  Genbank entries inserted= 0;
> >>>>>>updated= 0;  failed= 2
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>I see the problem, that the table DOTS.NASEQUENCEIMP is not set by
> the
> >>>>>>perlprogramm. I thought about setting the variables manually, but
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>doesn't
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>make
> >>>>>>sence.
> >>>>>>
> >>>>>>To inserte the values ot the the ExternalDatabaseRelease tables, I
> >>>>>>orientited myself on the
> >>>>>>installguide_UGA.html .
> >>>>>>The registration of the perl class InsertNewExtDbRelease gave
> >>>>>>            
> >>>>>>
> >>following
> >>    
> >>
> >>>>>>error:
> >>>>>>
> >>>>>>ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
> >>>>>>Reading properties from
> >>>>>>            
> >>>>>>
> >>/home/oracle/gus_home/config/GUS-PluginMgr.prop
> >>    
> >>
> >>>>>>Reading properties from /home/oracle/.gus.properties
> >>>>>>Warning: Use of "require" without parens is ambiguous at (eval 3)
> line
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>1.
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval
> >>>>>>            
> >>>>>>
> >>3)
> >>    
> >>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>line
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>1.
> >>>>>>Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed
> >>>>>>            
> >>>>>>
> >>while
> >>    
> >>
> >>>>>>"strict subs" in use at (eval 3) line 1.
> >>>>>>
> >>>>>>
> >>>>>>--------------------------- STACK TRACE -------------------------
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword
> >>>      
> >>>
> >>"pm" not allowed while "strict subs" in use at
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>(eval...') called at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>>>>>line 248
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>called at
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>line 664
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>>      
> >>>
> >>>>called at
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> >>>>>>            
> >>>>>>
> >>456
> >>    
> >>
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>called at
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>line 283
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>called at
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>line
> >>>>>>192
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)')
> >>>      
> >>>
> >>called at
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>/home/oracle/gus_home/bin/ga line 11
> >>>>>>
> >>>>>>I hope, that someone can help me.
> >>>>>>
> >>>>>>I wish a nice weekend and good luck with the grand -
> >>>>>>Thomas
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>-------------------------------------------------------
> >>>>>>The SF.Net email is sponsored by EclipseCon 2004
> >>>>>>Premiere Conference on Open Tools Development and Integration
> >>>>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >>>>>>http://www.eclipsecon.org/osdn
> >>>>>>_______________________________________________
> >>>>>>Gusdev-gusdev mailing list
> >>>>>>Gus...@li...
> >>>>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >>>>>>
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>>-------------------------------------------------------
> >>>>>The SF.Net email is sponsored by EclipseCon 2004
> >>>>>Premiere Conference on Open Tools Development and Integration
> >>>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >>>>>http://www.eclipsecon.org/osdn
> >>>>>_______________________________________________
> >>>>>Gusdev-gusdev mailing list
> >>>>>Gus...@li...
> >>>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >>>>>
> >>>>>     
> >>>>>
> >>>>>          
> >>>>>
> >>>
> >>>-------------------------------------------------------
> >>>The SF.Net email is sponsored by EclipseCon 2004
> >>>Premiere Conference on Open Tools Development and Integration
> >>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >>>http://www.eclipsecon.org/osdn
> >>>_______________________________________________
> >>>Gusdev-gusdev mailing list
> >>>Gus...@li...
> >>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >>> 
> >>>
> >>>      
> >>>
> 

Re: [Gusdev-gusdev] GBParser - problems with the perl modules

[Steve F. <sfi...@pc...>]

thomas-

please send me your version of the GBParser.pm and the complete log...   
that might help me figure out what is wrong.

steve

Thomas Otto wrote:

>Steve,
>
>true, I had to install the taxon stuff. The datas are inserted in the
>NAseqenceimp table
>
>But now I get an error- (this is not the first call!!!)
>Tue Feb  3 11:21:25 2004        Genbank entries inserted= 0;  updated= 0;
>total #(inserted::updated::deleted)=16::::
>
>Tue Feb  3 11:21:25 2004        FAILURES        Unable to process 1 entries.
>See gbparserFailures/
>Tue Feb  3 11:21:25 2004        RESULT  Genbank entries inserted= 0; 
>updated= 0;  failed= 1
>[oracle@localhost oracle]$ less gbparserFailures/errors
>...
>Can't call method "getAccession" on an undefined value at
>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 218, <GEN0> line 84.
>
>Is this important?
>
>-Thomas
>
>
>  
>
>>thomas-
>>
>>do you know how to check the oracle system tables to see which foreign 
>>key is causing the "integrity constraint?"
>>
>>if not, i can send you a query to run.
>>
>>debbie and I looked it up, and it is the taxon_id that is failing.   
>>this is because the genbank parser requires you to fill in the taxon 
>>tables (because the genbank records refer to taxon).
>>
>>take a look at fidel and sucheta's user guide on 
>>http://www.gusdb.org/documentation.html.   i believe they discuss this.
>>
>>steve
>>
>>Thomas Otto wrote:
>>
>>    
>>
>>>Hi Deborah,
>>>
>>>you are right, the values are testvalues. But there are also in the
>>>sres.ExternalDatabaseRelease... is the gbRel so important? - I didn't see
>>>      
>>>
>>that it is
>>    
>>
>>>as a foreign key...
>>>
>>>Here the entrance of the sres.externaldatabaserelease:
>>>135 |  1 |  15-JAN-04 |  10 |  tcrzidb.org |   |   |   |   |  The genom
>>>      
>>>
>>of
>>    
>>
>>>the tcruzi virus |  /seq/tcruzi.fcgi |   |   |   |  29-JAN-04 |  1 |  1 |
>>>      
>>>
>> 1 |
>>    
>>
>>>1 |  1 |  0 |  6 |  3 |  2 |  1
>>>and the modul call:
>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=10
>>>--file=/seq/tcruzi.fcgi --start=1 --commit
>>>
>>>It gives the same error...
>>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
>>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR:
>>>      
>>>
>>OCIStmtExecute) ...
>>    
>>
>>>Which part of the programm should manipulate the table DOTS.NASEQUENCEIMP
>>>      
>>>
>>?
>>    
>>
>>>Thomas
>>>
>>> 
>>>
>>>      
>>>
>>>>Hi Thomas,
>>>>
>>>>Apparently Steve is looking into this but I notice that
>>>>external_database_release_id (--db_rel_id) is 135 and the genbank
>>>>        
>>>>
>>release
>>    
>>
>>>>(--gbRel) is 1.05. Those look suspicious as 135 is a somewhat recent
>>>>release of GenBank although it could also be a valid
>>>>external_database_release_id in your ExternalDatabaseRelease table while
>>>>1.05 doesn't look like a gb release number at all. I wonder if your 
>>>>failure is due to a foreign key constraint referencing 
>>>>ExternalDatabaseRelease because you actually don't have a PK in that
>>>>        
>>>>
>>table
>>    
>>
>>>>of 135. Easy to check. 
>>>>
>>>>                                    Debbie
>>>>
>>>>                                             
>>>>
>>>>
>>>>
>>>>
>>>>On Fri, 30 Jan 
>>>>2004, Steve
>>>>Fischer wrote:
>>>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>thomas-
>>>>>
>>>>>i don't have time right now to look into this (i am home and need to 
>>>>>take my daughter to skating lesson).  i will as soon as i can.
>>>>>
>>>>>steve
>>>>>
>>>>>Thomas Otto wrote:
>>>>>
>>>>>     
>>>>>
>>>>>          
>>>>>
>>>>>>Hello -
>>>>>>
>>>>>>I am still fighting with the perl moduls.
>>>>>>
>>>>>>I.e. the GBParser to upload Genbank datasets gives following error:
>>>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
>>>>>>--file=/seq/tcruzi_3.fcgi --commit
>>>>>>
>>>>>>------------------ entry number 2 -----------------
>>>>>>
>>>>>>SQL ERROR!! involving
>>>>>>
>>>>>>  INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
>>>>>>sequence_type_id, user_read, other_write, modification_date, subcla
>>>>>>ss_view, row_group_id, user_write, other_read, group_write,
>>>>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>nam
>>>>   
>>>>
>>>>        
>>>>
>>>>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>length,
>>>>   
>>>>
>>>>        
>>>>
>>>>>>row_project_id, row_alg_invocation_id, sequence_version
>>>>>>, na_sequence_id )
>>>>>>  VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>?,
>>>>   
>>>>
>>>>        
>>>>
>>>>>>?, ?, ?, '', '', ?, ?, ?, ?, ? )  
>>>>>>
>>>>>>Values:
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
>>>      
>>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
>>>>>>ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
>>>>>>1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>Trypanosoma
>>>>   
>>>>
>>>>        
>>>>
>>>>>>cruzi Berenice putative chimeric protein gene, partial
>>>>>>cds., 1, 177, 1, 28, 1, 1 at
>>>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a}
>>>      
>>>
>>SQL ERROR!! involving\x{a} \x{a}    INSE
>>    
>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>RT INTO DoTS.ExternalNASequ...') called at
>>>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
>>>      
>>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO DoTS.ExternalNASequence (
>>>>>>sequence, group_r...') called at /home/oracle/gus_home/lib/pe
>>>>>>rl/GUS/ObjRelP/DbiRow.pm line 674
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)')
>>>      
>>>
>>called at /
>>    
>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)')
>>>      
>>>
>>called at /home/oracle/gus_home/lib/per
>>    
>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>l/GUS/Model/GusRow.pm line 1677
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)')
>>>      
>>>
>>called at /home/oracle/gus_home/lib/perl/
>>    
>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>GUS/Common/Plugin/GBParser.pm line 284
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
>>>      
>>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>=HASH(0x8ec41bc)') called at
>>>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
>>>>>>      eval {...} called at
>>>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)')
>>>      
>>>
>>called at /home/oracle
>>    
>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
>>>>>>      eval {...} called at
>>>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
>>>>>>            
>>>>>>
>>427
>>    
>>
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
>>>      
>>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>ser') called at
>>>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
>>>>>>            
>>>>>>
>>283
>>    
>>
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
>>>      
>>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>) called at
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>>>   
>>>>
>>>>        
>>>>
>>>>>>line 192
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)')
>>>      
>>>
>>called at /
>>    
>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>home/oracle/gus_home/bin/ga line 11
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>>on the prompt, following error is to see:
>>>>>>
>>>>>>
>>>>>>
>>>>>>********GEtting loc below30
>>>>>>
>>>>>>VLD     CBIL::Bio::GenBank::Locus       1
>>>>>>VLD     CBIL::Bio::GenBank::Definition  1
>>>>>>VLD     CBIL::Bio::GenBank::Accession   1
>>>>>>VLD     CBIL::Bio::GenBank::Version     1
>>>>>>VLD     CBIL::Bio::GenBank::Keywords    1
>>>>>>VLD     CBIL::Bio::GenBank::Source      1
>>>>>>VLD     CBIL::Bio::GenBank::Reference   1
>>>>>>VLD     CBIL::Bio::GenBank::Reference   1
>>>>>>RUN     1..177
>>>>>>RUN     1..46
>>>>>>RUN     <30..>177
>>>>>>RUN     30..>177
>>>>>>VLD     CBIL::Bio::GenBank::Features    1
>>>>>>VLD     CBIL::Bio::GenBank::Origin      1
>>>>>>Fri Jan 30 15:41:11 2004        STATUS  N=2 ACC=AY488502        
>>>>>>TOTAL_OBJECTS=16
>>>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
>>>>>>GUS::Model::DoTS::Source        ::      mol_type        ::     
>>>>>>            
>>>>>>
>>genomic
>>    
>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>DNA
>>>>   
>>>>
>>>>        
>>>>
>>>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
>>>>>>GUS::Model::DoTS::Source        ::      transgenic      ::
>>>>>>
>>>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
>>>>>>GUS::Model::DoTS::Source        ::      mol_type        ::     
>>>>>>            
>>>>>>
>>genomic
>>    
>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>DNA
>>>>   
>>>>
>>>>        
>>>>
>>>>>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
>>>>>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
>>>>>>: OCIStmtExecute) [for Statement "
>>>>>>  INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
>>>>>>sequence_type_id, user_read, other_write, modification_date, subcla
>>>>>>ss_view, row_group_id, user_write, other_read, group_write,
>>>>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>nam
>>>>   
>>>>
>>>>        
>>>>
>>>>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>length,
>>>>   
>>>>
>>>>        
>>>>
>>>>>>row_project_id, row_alg_invocation_id, sequence_version
>>>>>>, na_sequence_id )
>>>>>>  VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>?,
>>>>   
>>>>
>>>>        
>>>>
>>>>>>?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
>>>>>>0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502',
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>:p15='GI:41056860',
>>>>   
>>>>
>>>>        
>>>>
>>>>>>:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
>>>>>>2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
>>>>>>Trypanosoma cruzi Berenice putative chimeric protein gene, partia
>>>>>>l cds.', :p6='ExternalNASequence',
>>>>>>:p3='1',
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
>>>      
>>>
>>>>   
>>>>
>>>>        
>>>>
>>>cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa',
>>>      
>>>
>>:p7='1', :p17='1', :p22=1, :p9=1, :
>>    
>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>p11=135] at /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>line
>>>>   
>>>>
>>>>        
>>>>
>>>>>>145, <GEN0> line 112.
>>>>>>Fri Jan 30 15:41:12 2004        Genbank entries inserted= 0;  updated=
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>0;
>>>>   
>>>>
>>>>        
>>>>
>>>>>>total #(inserted::updated::deleted)=16::::
>>>>>>
>>>>>>Fri Jan 30 15:41:12 2004        FAILURES        Unable to process 2
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>entries.
>>>>   
>>>>
>>>>        
>>>>
>>>>>>See gbparserFailures/
>>>>>>Fri Jan 30 15:41:12 2004        RESULT  Genbank entries inserted= 0;
>>>>>>updated= 0;  failed= 2
>>>>>>
>>>>>>
>>>>>>
>>>>>>I see the problem, that the table DOTS.NASEQUENCEIMP is not set by the
>>>>>>perlprogramm. I thought about setting the variables manually, but
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>doesn't
>>>>   
>>>>
>>>>        
>>>>
>>>>>>make
>>>>>>sence.
>>>>>>
>>>>>>To inserte the values ot the the ExternalDatabaseRelease tables, I
>>>>>>orientited myself on the
>>>>>>installguide_UGA.html .
>>>>>>The registration of the perl class InsertNewExtDbRelease gave
>>>>>>            
>>>>>>
>>following
>>    
>>
>>>>>>error:
>>>>>>
>>>>>>ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
>>>>>>Reading properties from
>>>>>>            
>>>>>>
>>/home/oracle/gus_home/config/GUS-PluginMgr.prop
>>    
>>
>>>>>>Reading properties from /home/oracle/.gus.properties
>>>>>>Warning: Use of "require" without parens is ambiguous at (eval 3) line
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>1.
>>>>   
>>>>
>>>>        
>>>>
>>>>>>ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval
>>>>>>            
>>>>>>
>>3)
>>    
>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>line
>>>>   
>>>>
>>>>        
>>>>
>>>>>>1.
>>>>>>Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed
>>>>>>            
>>>>>>
>>while
>>    
>>
>>>>>>"strict subs" in use at (eval 3) line 1.
>>>>>>
>>>>>>
>>>>>>--------------------------- STACK TRACE -------------------------
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword
>>>      
>>>
>>"pm" not allowed while "strict subs" in use at
>>    
>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>(eval...') called at
>>>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>>>>>line 248
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>>>      
>>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>called at
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>>>   
>>>>
>>>>        
>>>>
>>>>>>line 664
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>>>      
>>>
>>>>called at
>>>>   
>>>>
>>>>        
>>>>
>>>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
>>>>>>            
>>>>>>
>>456
>>    
>>
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>>>      
>>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>called at
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>>>   
>>>>
>>>>        
>>>>
>>>>>>line 283
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>>>      
>>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>called at
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>>>   
>>>>
>>>>        
>>>>
>>>>>>line
>>>>>>192
>>>>>>    
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)')
>>>      
>>>
>>called at
>>    
>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>>/home/oracle/gus_home/bin/ga line 11
>>>>>>
>>>>>>I hope, that someone can help me.
>>>>>>
>>>>>>I wish a nice weekend and good luck with the grand -
>>>>>>Thomas
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>>-------------------------------------------------------
>>>>>>The SF.Net email is sponsored by EclipseCon 2004
>>>>>>Premiere Conference on Open Tools Development and Integration
>>>>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>>>>>>http://www.eclipsecon.org/osdn
>>>>>>_______________________________________________
>>>>>>Gusdev-gusdev mailing list
>>>>>>Gus...@li...
>>>>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>>>>
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>-------------------------------------------------------
>>>>>The SF.Net email is sponsored by EclipseCon 2004
>>>>>Premiere Conference on Open Tools Development and Integration
>>>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>>>>>http://www.eclipsecon.org/osdn
>>>>>_______________________________________________
>>>>>Gusdev-gusdev mailing list
>>>>>Gus...@li...
>>>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>>>
>>>>>     
>>>>>
>>>>>          
>>>>>
>>>
>>>-------------------------------------------------------
>>>The SF.Net email is sponsored by EclipseCon 2004
>>>Premiere Conference on Open Tools Development and Integration
>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>>>http://www.eclipsecon.org/osdn
>>>_______________________________________________
>>>Gusdev-gusdev mailing list
>>>Gus...@li...
>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>> 
>>>
>>>      
>>>

Re: [Gusdev-gusdev] GBParser - problems with the perl modules

[Thomas O. <th...@gm...>]

Steve,

true, I had to install the taxon stuff. The datas are inserted in the
NAseqenceimp table

But now I get an error- (this is not the first call!!!)
Tue Feb  3 11:21:25 2004        Genbank entries inserted= 0;  updated= 0;
total #(inserted::updated::deleted)=16::::

Tue Feb  3 11:21:25 2004        FAILURES        Unable to process 1 entries.
See gbparserFailures/
Tue Feb  3 11:21:25 2004        RESULT  Genbank entries inserted= 0; 
updated= 0;  failed= 1
[oracle@localhost oracle]$ less gbparserFailures/errors
...
Can't call method "getAccession" on an undefined value at
/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 218, <GEN0> line 84.

Is this important?

-Thomas


> thomas-
> 
> do you know how to check the oracle system tables to see which foreign 
> key is causing the "integrity constraint?"
> 
> if not, i can send you a query to run.
> 
> debbie and I looked it up, and it is the taxon_id that is failing.   
> this is because the genbank parser requires you to fill in the taxon 
> tables (because the genbank records refer to taxon).
> 
> take a look at fidel and sucheta's user guide on 
> http://www.gusdb.org/documentation.html.   i believe they discuss this.
> 
> steve
> 
> Thomas Otto wrote:
> 
> >Hi Deborah,
> >
> >you are right, the values are testvalues. But there are also in the
> >sres.ExternalDatabaseRelease... is the gbRel so important? - I didn't see
> that it is
> >as a foreign key...
> >
> >Here the entrance of the sres.externaldatabaserelease:
> >135 |  1 |  15-JAN-04 |  10 |  tcrzidb.org |   |   |   |   |  The genom
> of
> >the tcruzi virus |  /seq/tcruzi.fcgi |   |   |   |  29-JAN-04 |  1 |  1 |
>  1 |
> > 1 |  1 |  0 |  6 |  3 |  2 |  1
> >and the modul call:
> >ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=10
> >--file=/seq/tcruzi.fcgi --start=1 --commit
> >
> >It gives the same error...
> >DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR:
> OCIStmtExecute) ...
> >
> >Which part of the programm should manipulate the table DOTS.NASEQUENCEIMP
> ?
> >
> >
> >Thomas
> >
> >  
> >
> >>Hi Thomas,
> >>
> >>Apparently Steve is looking into this but I notice that
> >>external_database_release_id (--db_rel_id) is 135 and the genbank
> release
> >>(--gbRel) is 1.05. Those look suspicious as 135 is a somewhat recent
> >>release of GenBank although it could also be a valid
> >>external_database_release_id in your ExternalDatabaseRelease table while
> >>1.05 doesn't look like a gb release number at all. I wonder if your 
> >>failure is due to a foreign key constraint referencing 
> >>ExternalDatabaseRelease because you actually don't have a PK in that
> table
> >>
> >>of 135. Easy to check. 
> >>
> >>                                     Debbie
> >>
> >>                                              
> >>
> >>
> >>
> >>
> >>On Fri, 30 Jan 
> >>2004, Steve
> >>Fischer wrote:
> >>
> >>    
> >>
> >>>thomas-
> >>>
> >>>i don't have time right now to look into this (i am home and need to 
> >>>take my daughter to skating lesson).  i will as soon as i can.
> >>>
> >>>steve
> >>>
> >>>Thomas Otto wrote:
> >>>
> >>>      
> >>>
> >>>>Hello -
> >>>>
> >>>>I am still fighting with the perl moduls.
> >>>>
> >>>>I.e. the GBParser to upload Genbank datasets gives following error:
> >>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
> >>>>--file=/seq/tcruzi_3.fcgi --commit
> >>>>
> >>>>------------------ entry number 2 -----------------
> >>>>
> >>>>SQL ERROR!! involving
> >>>>
> >>>>   INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> >>>>sequence_type_id, user_read, other_write, modification_date, subcla
> >>>>ss_view, row_group_id, user_write, other_read, group_write,
> >>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
> >>>>        
> >>>>
> >>nam
> >>    
> >>
> >>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
> >>>>        
> >>>>
> >>length,
> >>    
> >>
> >>>>row_project_id, row_alg_invocation_id, sequence_version
> >>>>, na_sequence_id )
> >>>>   VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
> >>>>        
> >>>>
> >>?,
> >>    
> >>
> >>>>?, ?, ?, '', '', ?, ?, ?, ?, ? )  
> >>>>
> >>>>Values:
> >>>>        
> >>>>
>
>>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
> >>    
> >>
> >>>>ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
> >>>>ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
> >>>>1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31
> >>>>        
> >>>>
> >>Trypanosoma
> >>    
> >>
> >>>>cruzi Berenice putative chimeric protein gene, partial
> >>>>cds., 1, 177, 1, 28, 1, 1 at
> >>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a}
> SQL ERROR!! involving\x{a} \x{a}    INSE
> >>    
> >>
> >>>>RT INTO DoTS.ExternalNASequ...') called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
> >>    
> >>
> >>>>)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO DoTS.ExternalNASequence (
> >>>>sequence, group_r...') called at /home/oracle/gus_home/lib/pe
> >>>>rl/GUS/ObjRelP/DbiRow.pm line 674
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)')
> called at /
> >>    
> >>
> >>>>home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)')
> called at /home/oracle/gus_home/lib/per
> >>    
> >>
> >>>>l/GUS/Model/GusRow.pm line 1677
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)')
> called at /home/oracle/gus_home/lib/perl/
> >>    
> >>
> >>>>GUS/Common/Plugin/GBParser.pm line 284
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
> >>    
> >>
> >>>>=HASH(0x8ec41bc)') called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
> >>>>       eval {...} called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)')
> called at /home/oracle
> >>    
> >>
> >>>>/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
> >>>>       eval {...} called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> 427
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
> >>    
> >>
> >>>>ser') called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> 283
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
> >>    
> >>
> >>>>) called at
> >>>>        
> >>>>
> >>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>    
> >>
> >>>>line 192
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)')
> called at /
> >>    
> >>
> >>>>home/oracle/gus_home/bin/ga line 11
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>on the prompt, following error is to see:
> >>>>
> >>>>
> >>>>
> >>>>********GEtting loc below30
> >>>>
> >>>>VLD     CBIL::Bio::GenBank::Locus       1
> >>>>VLD     CBIL::Bio::GenBank::Definition  1
> >>>>VLD     CBIL::Bio::GenBank::Accession   1
> >>>>VLD     CBIL::Bio::GenBank::Version     1
> >>>>VLD     CBIL::Bio::GenBank::Keywords    1
> >>>>VLD     CBIL::Bio::GenBank::Source      1
> >>>>VLD     CBIL::Bio::GenBank::Reference   1
> >>>>VLD     CBIL::Bio::GenBank::Reference   1
> >>>>RUN     1..177
> >>>>RUN     1..46
> >>>>RUN     <30..>177
> >>>>RUN     30..>177
> >>>>VLD     CBIL::Bio::GenBank::Features    1
> >>>>VLD     CBIL::Bio::GenBank::Origin      1
> >>>>Fri Jan 30 15:41:11 2004        STATUS  N=2 ACC=AY488502        
> >>>>TOTAL_OBJECTS=16
> >>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>GUS::Model::DoTS::Source        ::      mol_type        ::     
> genomic
> >>>>        
> >>>>
> >>DNA
> >>    
> >>
> >>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>GUS::Model::DoTS::Source        ::      transgenic      ::
> >>>>
> >>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>GUS::Model::DoTS::Source        ::      mol_type        ::     
> genomic
> >>>>        
> >>>>
> >>DNA
> >>    
> >>
> >>>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >>>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
> >>>>: OCIStmtExecute) [for Statement "
> >>>>   INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> >>>>sequence_type_id, user_read, other_write, modification_date, subcla
> >>>>ss_view, row_group_id, user_write, other_read, group_write,
> >>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
> >>>>        
> >>>>
> >>nam
> >>    
> >>
> >>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
> >>>>        
> >>>>
> >>length,
> >>    
> >>
> >>>>row_project_id, row_alg_invocation_id, sequence_version
> >>>>, na_sequence_id )
> >>>>   VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
> >>>>        
> >>>>
> >>?,
> >>    
> >>
> >>>>?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
> >>>>0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502',
> >>>>        
> >>>>
> >>:p15='GI:41056860',
> >>    
> >>
> >>>>:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
> >>>>2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
> >>>>Trypanosoma cruzi Berenice putative chimeric protein gene, partia
> >>>>l cds.', :p6='ExternalNASequence',
> >>>>:p3='1',
> >>>>        
> >>>>
>
>>:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
> >>    
> >>
>
>>cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa',
> :p7='1', :p17='1', :p22=1, :p9=1, :
> >>    
> >>
> >>>>p11=135] at /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
> >>>>        
> >>>>
> >>line
> >>    
> >>
> >>>>145, <GEN0> line 112.
> >>>>Fri Jan 30 15:41:12 2004        Genbank entries inserted= 0;  updated=
> >>>>        
> >>>>
> >>0;
> >>    
> >>
> >>>>total #(inserted::updated::deleted)=16::::
> >>>>
> >>>>Fri Jan 30 15:41:12 2004        FAILURES        Unable to process 2
> >>>>        
> >>>>
> >>entries.
> >>    
> >>
> >>>>See gbparserFailures/
> >>>>Fri Jan 30 15:41:12 2004        RESULT  Genbank entries inserted= 0;
> >>>>updated= 0;  failed= 2
> >>>>
> >>>>
> >>>>
> >>>>I see the problem, that the table DOTS.NASEQUENCEIMP is not set by the
> >>>>perlprogramm. I thought about setting the variables manually, but
> >>>>        
> >>>>
> >>doesn't
> >>    
> >>
> >>>>make
> >>>>sence.
> >>>>
> >>>>To inserte the values ot the the ExternalDatabaseRelease tables, I
> >>>>orientited myself on the
> >>>>installguide_UGA.html .
> >>>>The registration of the perl class InsertNewExtDbRelease gave
> following
> >>>>error:
> >>>>
> >>>>ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
> >>>>Reading properties from
> /home/oracle/gus_home/config/GUS-PluginMgr.prop
> >>>>Reading properties from /home/oracle/.gus.properties
> >>>>Warning: Use of "require" without parens is ambiguous at (eval 3) line
> >>>>        
> >>>>
> >>1.
> >>    
> >>
> >>>>ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval
> 3)
> >>>>        
> >>>>
> >>line
> >>    
> >>
> >>>>1.
> >>>>Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed
> while
> >>>>"strict subs" in use at (eval 3) line 1.
> >>>>
> >>>>
> >>>>--------------------------- STACK TRACE -------------------------
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword
> "pm" not allowed while "strict subs" in use at
> >>    
> >>
> >>>>(eval...') called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>>>line 248
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>    
> >>
> >>>>called at
> >>>>        
> >>>>
> >>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>    
> >>
> >>>>line 664
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>called at
> >>    
> >>
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> 456
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>    
> >>
> >>>>called at
> >>>>        
> >>>>
> >>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>    
> >>
> >>>>line 283
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>    
> >>
> >>>>called at
> >>>>        
> >>>>
> >>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>    
> >>
> >>>>line
> >>>>192
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)')
> called at
> >>    
> >>
> >>>>/home/oracle/gus_home/bin/ga line 11
> >>>>
> >>>>I hope, that someone can help me.
> >>>>
> >>>>I wish a nice weekend and good luck with the grand -
> >>>>Thomas
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>-------------------------------------------------------
> >>>>The SF.Net email is sponsored by EclipseCon 2004
> >>>>Premiere Conference on Open Tools Development and Integration
> >>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >>>>http://www.eclipsecon.org/osdn
> >>>>_______________________________________________
> >>>>Gusdev-gusdev mailing list
> >>>>Gus...@li...
> >>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >>>> 
> >>>>
> >>>>        
> >>>>
> >>>
> >>>-------------------------------------------------------
> >>>The SF.Net email is sponsored by EclipseCon 2004
> >>>Premiere Conference on Open Tools Development and Integration
> >>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >>>http://www.eclipsecon.org/osdn
> >>>_______________________________________________
> >>>Gusdev-gusdev mailing list
> >>>Gus...@li...
> >>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >>>
> >>>      
> >>>
> >
> >
> >
> >-------------------------------------------------------
> >The SF.Net email is sponsored by EclipseCon 2004
> >Premiere Conference on Open Tools Development and Integration
> >See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >http://www.eclipsecon.org/osdn
> >_______________________________________________
> >Gusdev-gusdev mailing list
> >Gus...@li...
> >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >  
> >
> 

Re: [Gusdev-gusdev] Error with WDK (fwd)

[Steve F. <st...@pc...>]

michael-

how about sending your servlet-config file.

also, i think i see an error in your url:

http://tcruzidb-gusdev.ctegd.uga.edu/servlets/?page=query&showForm=1&query=locuslinkID

you are missing a 'servlet' before the '?'

steve



MICHAEL LUCHTAN wrote:

>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>
>---------- Forwarded message ----------
>Date: Thu, 29 Jan 2004 16:44:31 -0500 (EST)
>From: MICHAEL LUCHTAN <lu...@at...>
>To: gus...@li...
>Subject: Error with WDK
>
>Hello All-
>Since the list has been quite for a couple of days, I will go ahead and
>ask a question with regard to the (unsupported) WDK.
>This is my first go 'round with tomcat-apache-mod_jk, but I believe that I
>have it set up correctly.  I will give you my set-up:
>Apache 1.3
>Tomcat 4
>workers.properties:
>
>	worker.list=wrkr
>	worker.wrkr.port=8009
>	worker.wrkr.host=tcruzidb-gusdev.ctegd.uga.edu
>
>server.xml(attached)
>
>$CATALINA_HOME/webapps/tcruzidb-gusdev/WEB-INF/web.xml (attached)
>
>relevant tcruzidb-gusdev.conf for apache:
>	JkMount /*.jsp wrkr
>	JkMount /servlets/* wrkr
>
>relevant httpd.conf:
>	JkWorkersFile "/usr/local/tomcat/conf/jk/workers.properties"
>	JkLogFile "/usr/local/tomcat/logs/mod_jk.log"
>	JkLogLevel debug
>	JkLogStampFormat "[%a %b %d %H:%M:%S %Y]"
>
>servlet.log:
>
>	[Jan 29, 2004 2:59:07 PM] <ConnectionPool:MSG> An instance of
>	oracle.jdbc.driver.OracleDriver has already been registered.
>	[Jan 29, 2004 2:59:07 PM] <ConnectionPool:MSG> Opened JDBC connection 0 to
>	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
>	[Jan 29, 2004 2:59:07 PM] <ConnectionPool:MSG> Opened JDBC connection 1 to
>	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
>	[Jan 29, 2004 2:59:07 PM] <ConnectionPool:MSG> Opened JDBC connection 2 to
>	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
>	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 3 to
>	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
>	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 4 to
>	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
>	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 5 to
>	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
>	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 6 to
>	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
>	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 7 to
>	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
>	[Jan 29, 2004 2:59:19 PM] <ProcessPool-seqAlignment-0:MSG> Init
>	[Jan 29, 2004 2:59:20 PM] <ProcessPool-seqAlignment-1:MSG> Init
>	[Jan 29, 2004 2:59:20 PM] <ProcessPool-seqAlignment-2:MSG> Init
>	[Jan 29, 2004 2:59:20 PM] <ProcessPool-seqAlignment:MSG> initialized 3
>	processes
>	[Jan 29, 2004 2:59:21 PM] <ProcessPool-Motifs(G)-0:MSG> Init
>	[Jan 29, 2004 2:59:22 PM] <ProcessPool-Motifs(G)-1:MSG> Init
>	[Jan 29, 2004 2:59:22 PM] <ProcessPool-Motifs(G)-2:MSG> Init
>	[Jan 29, 2004 2:59:22 PM] <ProcessPool-Motifs(G):MSG> initialized 3
>	processes
>	[Jan 29, 2004 2:59:23 PM] <ProcessPool-NRDB(G)-0:MSG> Init
>	[Jan 29, 2004 2:59:23 PM] <ProcessPool-NRDB(G)-1:MSG> Init
>	[Jan 29, 2004 2:59:24 PM] <ProcessPool-NRDB(G)-2:MSG> Init
>	[Jan 29, 2004 2:59:24 PM] <ProcessPool-NRDB(G):MSG> initialized 3
>	processes
>	[Jan 29, 2004 2:59:25 PM] <ProcessPool-BLAT search-0:MSG> Init
>	[Jan 29, 2004 2:59:25 PM] <ProcessPool-BLAT search-1:MSG> Init
>	[Jan 29, 2004 2:59:25 PM] <ProcessPool-BLAT search:MSG> initialized 2
>	processes
>	[Jan 29, 2004 2:59:27 PM] <ProcessPool-Assembly(G)-0:MSG> Init
>	[Jan 29, 2004 2:59:27 PM] <ProcessPool-Assembly(G)-1:MSG> Init
>	[Jan 29, 2004 2:59:28 PM] <ProcessPool-Assembly(G)-2:MSG> Init
>	[Jan 29, 2004 2:59:29 PM] <ProcessPool-Assembly(G)-3:MSG> Init
>	[Jan 29, 2004 2:59:29 PM] <ProcessPool-Assembly(G)-4:MSG> Init
>	[Jan 29, 2004 2:59:29 PM] <ProcessPool-Assembly(G):MSG> initialized 5
>	processes
>	[Jan 29, 2004 2:59:30 PM] <ProcessPool-Features(G)-0:MSG> Init
>	[Jan 29, 2004 2:59:31 PM] <ProcessPool-Features(G)-1:MSG> Init
>	[Jan 29, 2004 2:59:31 PM] <ProcessPool-Features(G)-2:MSG> Init
>	[Jan 29, 2004 2:59:32 PM] <ProcessPool-Features(G)-3:MSG> Init
>	[Jan 29, 2004 2:59:32 PM] <ProcessPool-Features(G)-4:MSG> Init
>	[Jan 29, 2004 2:59:32 PM] <ProcessPool-Features(G):MSG>
>	initialized 5 processes
>	[Jan 29, 2004 2:59:34 PM] <ObjectFile:ERROR> No value provided for
>	mandatory property gene.DefaultTaxonId
>	[Jan 29, 2004 2:59:35 PM] <ObjectFile:ERROR> Could not determine class for
>	dummyF
>	[Jan 29, 2004 2:59:36 PM] <ProcessPool-sequence-0:MSG> Init
>	[Jan 29, 2004 2:59:37 PM] <ProcessPool-sequence-1:MSG> Init
>	[Jan 29, 2004 2:59:37 PM] <ProcessPool-sequence:MSG> initialized 2
>	processes
>	[Jan 29, 2004 2:59:38 PM] <SiteServlet:MSG> init() completed
>	[Jan 29, 2004 2:59:38 PM] <SiteServlet:MSG> debug = true
>
>
>
>I did an install of the WDK, just using the dotsgenes pages, but when I
>try to follow a link for a server, for example for the URL:
>http://tcruzidb-gusdev.ctegd.uga.edu/servlets/?page=query&showForm=1&query=locuslinkID
>I get the following message:
>
>Apache Tomcat/4.0.6 - HTTP Status 404 - /servlets/
>
>type Status report
>
>message /servlets/
>
>description The requested resource (/servlets/) is not available.
>
>
>What confuses me a little is that the URL does not request an obvious
>servlet.  When looking at tomcat examples, the URL will reflect the name
>of the servlet, and one can easily find the corresponding class file.
>The contents of the servlets directory:
> servlets]# ls -l
>total 600
>-rwxr-xr-x    1 tomcat   tomcat     433964 Jan 29 14:33 gus-servlet.jar
>drwxr-xr-x    2 tomcat   tomcat       4096 Jan 29 14:33 scripts
>-rwxr-xr-x    1 tomcat   tomcat     161084 Jan 29 14:33 servlet-config
>-rwxr-xr-x    1 tomcat   tomcat       3378 Jan 29 14:59 servlet.log
>and the scripts:
> servlets]# ls scripts/ -l
>total 36
>-rwxr-xr-x    1 tomcat   tomcat        199 Jan 29 14:33 README
>-rwxr-xr-x    1 tomcat   tomcat       1375 Jan 29 14:33 assemblyCAP2.pl
>-rwxr-xr-x    1 tomcat   tomcat       1142 Jan 29 14:33 assemblyGraphic.pl
>-rwxr-xr-x    1 tomcat   tomcat       4463 Jan 29 14:33 blatLink.pl
>-rwxr-xr-x    1 tomcat   tomcat       1632 Jan 29 14:33 naSeq.pl
>-rwxr-xr-x    1 tomcat   tomcat       1166 Jan 29 14:33 proteinGraphic.pl
>-rwxr-xr-x    1 tomcat   tomcat       1159 Jan 29 14:33 rnaMotifs.pl
>-rwxr-xr-x    1 tomcat   tomcat       1096 Jan 29 14:33 rnaProtSim.pl
>
>
>I know that this e-mail is all over the place, but I'm not sure where the
>problem lies and wanted to make sure that everyone had any necessary
>information.
>Can anyone give me some tips?
>
>
>
>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>  
>
>------------------------------------------------------------------------
>
><!-- Example Server Configuration File -->
><!-- Note that component elements are nested corresponding to their
>     parent-child relationships with each other -->
>
><!-- A "Server" is a singleton element that represents the entire JVM,
>     which may contain one or more "Service" instances.  The Server
>     listens for a shutdown command on the indicated port.
>
>     Note:  A "Server" is not itself a "Container", so you may not
>     define subcomponents such as "Valves" or "Loggers" at this level.
> -->
>
><Server port="8005" shutdown="SHUTDOWN" debug="0">
>
>
>  <!-- A "Service" is a collection of one or more "Connectors" that share
>       a single "Container" (and therefore the web applications visible
>       within that Container).  Normally, that Container is an "Engine",
>       but this is not required.
>
>       Note:  A "Service" is not itself a "Container", so you may not
>       define subcomponents such as "Valves" or "Loggers" at this level.
>   -->
>
>  <!-- Define the Tomcat Stand-Alone Service -->
>  <Service name="Tomcat-Standalone">
>
>    <!-- A "Connector" represents an endpoint by which requests are received
>         and responses are returned.  Each Connector passes requests on to the
>         associated "Container" (normally an Engine) for processing.
>
>         By default, a non-SSL HTTP/1.1 Connector is established on port 8080.
>         You can also enable an SSL HTTP/1.1 Connector on port 8443 by
>         following the instructions below and uncommenting the second Connector
>         entry.  SSL support requires the following steps (see the SSL Config
>         HOWTO in the Tomcat 4.0 documentation bundle for more detailed
>         instructions):
>         * Download and install JSSE 1.0.2 or later, and put the JAR files
>           into "$JAVA_HOME/jre/lib/ext".
>         * Execute:
>             %JAVA_HOME%\bin\keytool -genkey -alias tomcat -keyalg RSA (Windows)
>             $JAVA_HOME/bin/keytool -genkey -alias tomcat -keyalg RSA  (Unix)
>           with a password value of "changeit" for both the certificate and
>           the keystore itself.
>
>         By default, DNS lookups are enabled when a web application calls
>         request.getRemoteHost().  This can have an adverse impact on
>         performance, so you can disable it by setting the
>         "enableLookups" attribute to "false".  When DNS lookups are disabled,
>         request.getRemoteHost() will return the String version of the
>         IP address of the remote client.
>    -->
>
>    <!-- Define a non-SSL HTTP/1.1 Connector on port 8080 -->
>    <Connector className="org.apache.catalina.connector.http.HttpConnector"
>               port="8080" minProcessors="5" maxProcessors="75"
>               enableLookups="true" redirectPort="8443"
>               acceptCount="10" debug="0" connectionTimeout="60000"/>
>    <!-- Note : To disable connection timeouts, set connectionTimeout value 
>     to -1 -->
>
>    <!-- Define a non-SSL Coyote HTTP/1.1 Connector on port 8081 -->
>    <!--
>    <Connector className="org.apache.coyote.tomcat4.CoyoteConnector"
>               port="8081" minProcessors="5" maxProcessors="75"
>               enableLookups="true" redirectPort="8443"
>               acceptCount="10" debug="0" connectionTimeout="20000"/>
>    -->
>
>    <!-- Define an SSL HTTP/1.1 Connector on port 8443 -->
>    <!--
>    <Connector className="org.apache.catalina.connector.http.HttpConnector"
>               port="8443" minProcessors="5" maxProcessors="75"
>               enableLookups="true"
>	       acceptCount="10" debug="0" scheme="https" secure="true">
>      <Factory className="org.apache.catalina.net.SSLServerSocketFactory"
>               clientAuth="false" protocol="TLS"/>
>    </Connector>
>    -->
>
>    <!-- Define an AJP 1.3 Connector on port 8009 -->
>    <Connector className="org.apache.ajp.tomcat4.Ajp13Connector"
>               port="8009" minProcessors="5" maxProcessors="75"
>               acceptCount="10" debug="0"/>
>
>    <!-- Define a Proxied HTTP/1.1 Connector on port 8081 -->
>    <!-- See proxy documentation for more information about using this. -->
>    <!--
>    <Connector className="org.apache.catalina.connector.http.HttpConnector"
>               port="8082" minProcessors="5" maxProcessors="75"
>               enableLookups="true"
>               acceptCount="10" debug="0" connectionTimeout="60000"
>               proxyPort="80"/>
>    -->
>
>    <!-- Define a non-SSL HTTP/1.0 Test Connector on port 8082 -->
>    <!--
>    <Connector className="org.apache.catalina.connector.http10.HttpConnector"
>               port="8083" minProcessors="5" maxProcessors="75"
>               enableLookups="true" redirectPort="8443"
>               acceptCount="10" debug="0"/>
>    -->
>
>    <!-- An Engine represents the entry point (within Catalina) that processes
>         every request.  The Engine implementation for Tomcat stand alone
>         analyzes the HTTP headers included with the request, and passes them
>         on to the appropriate Host (virtual host). -->
>
>    <!-- Define the top level container in our container hierarchy -->
>    <Engine name="Standalone" defaultHost="localhost" debug="0">
>
>      <!-- The request dumper valve dumps useful debugging information about
>           the request headers and cookies that were received, and the response
>           headers and cookies that were sent, for all requests received by
>           this instance of Tomcat.  If you care only about requests to a
>           particular virtual host, or a particular application, nest this
>           element inside the corresponding <Host> or <Context> entry instead.
>
>           For a similar mechanism that is portable to all Servlet 2.3
>           containers, check out the "RequestDumperFilter" Filter in the
>           example application (the source for this filter may be found in
>           "$CATALINA_HOME/webapps/examples/WEB-INF/classes/filters").
>
>           Request dumping is disabled by default.  Uncomment the following
>           element to enable it. -->
>      <!--
>      <Valve className="org.apache.catalina.valves.RequestDumperValve"/>
>      -->
>
>      <!-- Global logger unless overridden at lower levels -->
>      <Logger className="org.apache.catalina.logger.FileLogger"
>              prefix="catalina_log." suffix=".txt"
>              timestamp="true"/>
>
>      <!-- Because this Realm is here, an instance will be shared globally -->
>
>      <Realm className="org.apache.catalina.realm.MemoryRealm" />
>
>      <!-- Replace the above Realm with one of the following to get a Realm
>           stored in a database and accessed via JDBC -->
>
>      <!--
>      <Realm  className="org.apache.catalina.realm.JDBCRealm" debug="99"
>             driverName="org.gjt.mm.mysql.Driver"
>          connectionURL="jdbc:mysql://localhost/authority?user=test;password=test"
>              userTable="users" userNameCol="user_name" userCredCol="user_pass"
>          userRoleTable="user_roles" roleNameCol="role_name" />
>      -->
>
>      <!--
>      <Realm  className="org.apache.catalina.realm.JDBCRealm" debug="99"
>             driverName="oracle.jdbc.driver.OracleDriver"
>          connectionURL="jdbc:oracle:thin:@ntserver:1521:ORCL?user=scott;password=tiger"
>              userTable="users" userNameCol="user_name" userCredCol="user_pass"
>          userRoleTable="user_roles" roleNameCol="role_name" />
>      -->
>
>      <!--
>      <Realm  className="org.apache.catalina.realm.JDBCRealm" debug="99"
>             driverName="sun.jdbc.odbc.JdbcOdbcDriver"
>          connectionURL="jdbc:odbc:CATALINA"
>              userTable="users" userNameCol="user_name" userCredCol="user_pass"
>          userRoleTable="user_roles" roleNameCol="role_name" />
>      -->
>
>      <!-- Define the default virtual host -->
>      <Host name="localhost" debug="0" appBase="webapps" unpackWARs="true">
>
>        <!-- Normally, users must authenticate themselves to each web app
>             individually.  Uncomment the following entry if you would like
>             a user to be authenticated the first time they encounter a
>             resource protected by a security constraint, and then have that
>             user identity maintained across *all* web applications contained
>             in this virtual host. -->
>        <!--
>        <Valve className="org.apache.catalina.authenticator.SingleSignOn"
>                   debug="0"/>
>        -->
>
>        <!-- Access log processes all requests for this virtual host.  By
>             default, log files are created in the "logs" directory relative to
>             $CATALINA_HOME.  If you wish, you can specify a different
>             directory with the "directory" attribute.  Specify either a relative
>             (to $CATALINA_HOME) or absolute path to the desired directory.
>        -->
>        <Valve className="org.apache.catalina.valves.AccessLogValve"
>                 directory="logs"  prefix="localhost_access_log." suffix=".txt"
>                 pattern="common"/>
>
>        <!-- Logger shared by all Contexts related to this virtual host.  By
>             default (when using FileLogger), log files are created in the "logs"
>             directory relative to $CATALINA_HOME.  If you wish, you can specify
>             a different directory with the "directory" attribute.  Specify either a
>             relative (to $CATALINA_HOME) or absolute path to the desired
>             directory.-->
>        <Logger className="org.apache.catalina.logger.FileLogger"
>                 directory="logs"  prefix="localhost_log." suffix=".txt"
>	        timestamp="true"/>
>
>        <!-- Define properties for each web application.  This is only needed
>             if you want to set non-default properties, or have web application
>             document roots in places other than the virtual host's appBase
>             directory.  -->
>
>        <!-- Tomcat Root Context -->
>        <!--
>          <Context path="" docBase="ROOT" debug="0"/>
>        -->
>
>        <!-- Tomcat Manager Context -->
>        <Context path="/manager" docBase="manager" 
>         debug="0" privileged="true"/>
>
>        <!-- Tomcat Examples Context -->
>        <Context path="/examples" docBase="examples" debug="0"
>                 reloadable="true" crossContext="true">
>          <Logger className="org.apache.catalina.logger.FileLogger"
>                     prefix="localhost_examples_log." suffix=".txt"
>        	  timestamp="true"/>
>          <Ejb   name="ejb/EmplRecord" type="Entity"
>                 home="com.wombat.empl.EmployeeRecordHome"
>               remote="com.wombat.empl.EmployeeRecord"/>
>          <!-- PersistentManager: Uncomment the section below to test Persistent 
>		       Sessions.
>                         
>               saveOnRestart: If true, all active sessions will be saved
>                 to the Store when Catalina is shutdown, regardless of
>                 other settings. All Sessions found in the Store will be 
>                 loaded on startup. Sessions past their expiration are
>                 ignored in both cases.
>               maxActiveSessions: If 0 or greater, having too many active 
>                 sessions will result in some being swapped out. minIdleSwap
>                 limits this. -1 means unlimited sessions are allowed.
>                 0 means sessions will almost always be swapped out after
>                 use - this will be noticeably slow for your users.
>               minIdleSwap: Sessions must be idle for at least this long
>                 (in seconds) before they will be swapped out due to 
>               maxActiveSessions. This avoids thrashing when the site is 
>                 highly active. -1 or 0 means there is no minimum - sessions
>                 can be swapped out at any time.
>               maxIdleSwap: Sessions will be swapped out if idle for this
>                 long (in seconds). If minIdleSwap is higher, then it will
>                 override this. This isn't exact: it is checked periodically.
>                 -1 means sessions won't be swapped out for this reason,
>                 although they may be swapped out for maxActiveSessions.
>                 If set to >= 0, guarantees that all sessions found in the
>                 Store will be loaded on startup.
>               maxIdleBackup: Sessions will be backed up (saved to the Store,
>                 but left in active memory) if idle for this long (in seconds), 
>                 and all sessions found in the Store will be loaded on startup.
>                 If set to -1 sessions will not be backed up, 0 means they
>                 should be backed up shortly after being used.
>
>               To clear sessions from the Store, set maxActiveSessions, maxIdleSwap,
>               and minIdleBackup all to -1, saveOnRestart to false, then restart 
>               Catalina.
>          -->
>		  <!--
>          <Manager className="org.apache.catalina.session.PersistentManager"
>              debug="0"
>              saveOnRestart="true"
>              maxActiveSessions="-1"
>              minIdleSwap="-1"
>              maxIdleSwap="-1"
>              maxIdleBackup="-1">
>                <Store className="org.apache.catalina.session.FileStore"/>
>          </Manager>
>		  -->
>          <Environment name="maxExemptions" type="java.lang.Integer"
>                      value="15"/>
>          <Parameter name="context.param.name" value="context.param.value"
>                     override="false"/>
>          <Resource name="jdbc/EmployeeAppDb" auth="SERVLET"
>                    type="javax.sql.DataSource"/>
>          <ResourceParams name="jdbc/EmployeeAppDb">
>            <parameter><name>user</name><value>sa</value></parameter>
>            <parameter><name>password</name><value></value></parameter>
>            <parameter><name>driverClassName</name>
>              <value>org.hsql.jdbcDriver</value></parameter>
>            <parameter><name>driverName</name>
>              <value>jdbc:HypersonicSQL:database</value></parameter>
>          </ResourceParams>
>          <Resource name="mail/Session" auth="Container"
>                    type="javax.mail.Session"/>
>          <ResourceParams name="mail/Session">
>            <parameter>
>              <name>mail.smtp.host</name>
>              <value>localhost</value>
>            </parameter>
>          </ResourceParams>
>        </Context>
>
>      </Host>
>
>    </Engine>
>
>  </Service>
>
>  <!-- The MOD_WEBAPP connector is used to connect Apache 1.3 with Tomcat 4.0
>       as its servlet container. Please read the README.txt file coming with
>       the WebApp Module distribution on how to build it.
>       (Or check out the "jakarta-tomcat-connectors/webapp" CVS repository)
>
>       To configure the Apache side, you must ensure that you have the
>       "ServerName" and "Port" directives defined in "httpd.conf".  Then,
>       lines like these to the bottom of your "httpd.conf" file:
>
>         LoadModule webapp_module libexec/mod_webapp.so
>         WebAppConnection warpConnection warp localhost:8008
>         WebAppDeploy examples warpConnection /examples/
>
>       The next time you restart Apache (after restarting Tomcat, if needed)
>       the connection will be established, and all applications you make
>       visible via "WebAppDeploy" directives can be accessed through Apache.
>  -->
>
>  <!-- Define an Apache-Connector Service -->
>  <Service name="Tomcat-Apache">
>
>    <Connector className="org.apache.catalina.connector.warp.WarpConnector"
>     port="8008" minProcessors="5" maxProcessors="75"
>     enableLookups="true" appBase="webapps"
>     acceptCount="10" debug="0"/>
>
>    <!-- Replace "localhost" with what your Apache "ServerName" is set to -->
>    <Engine className="org.apache.catalina.connector.warp.WarpEngine"
>     name="Apache" debug="0">
>
>      <!-- Global logger unless overridden at lower levels -->
>      <Logger className="org.apache.catalina.logger.FileLogger"
>              prefix="apache_log." suffix=".txt"
>              timestamp="true"/>
>
>      <!-- Because this Realm is here, an instance will be shared globally -->
>      <Realm className="org.apache.catalina.realm.MemoryRealm" />
>
>    </Engine>
>
><ApacheConfig />
>
>  </Service>
>
></Server>
>  
>
>------------------------------------------------------------------------
>
><?xml version="1.0" encoding="ISO-8859-1"?>
>
><!-- A sample "web.xml" file for Tomcat; this file should be copied to   -->
><!-- $CATALINA_HOME/webapps/$servletName/WEB-INF/web.xml                 -->
><!-- (where $CATALINA_HOME is the directory in which Tomcat is installed -->
><!-- and $servletName is the name of your servlet in Tomcat.)  It should -->
><!-- then be edited to reflect the correct configuration for the servlet -->
><!-- that you are installing.                                            -->
>
><!DOCTYPE web-app
>    PUBLIC "-//Sun Microsystems, Inc.//DTD Web Application 2.3//EN"
>    "http://java.sun.com/dtd/web-app_2_3.dtd">
>
><web-app>
>
>    <display-name>tcruzidb-gusdev</display-name>
>    <description>
>    The development servlet/web site for Dotsgenes.
>    </description>
>
>
>    <filter>
>        <filter-name>multipartFilter</filter-name>
>        <filter-class>com.oreilly.servlet.MultipartFilter</filter-class>
>        <init-param>
>          <param-name>uploadDir</param-name>
>          <param-value>/tmp/tcruzidb-gusdev</param-value>
>        </init-param>
>    </filter>
>
>    <filter-mapping>
>        <filter-name>multipartFilter</filter-name>
>        <url-pattern>/*</url-pattern>
>    </filter-mapping>
>    <!-- Definition for the single servlet in our system -->
>
>    <servlet>
>      <servlet-name>tcruzidb-gusdev</servlet-name>
>        <description>The main (and only) Java servlet for the Dotsgenes-dev web site.</description>
>        <servlet-class>cbil.gus.servlet.SiteServlet</servlet-class>
>
>	<!-- The URL where cbil.gus.servlet.SiteServlet can find itself -->
>        <init-param>
>           <param-name>siteServletURL</param-name>
>           <param-value>http://tcruzidb-gusdev.ctegd.uga.edu/servlets</param-value>
>        </init-param>
>
>	<!-- The location of the servlet configuration file for the SiteServlet     -->
>	<!-- (it should be in the directory specfied for $installDir in the servlet -->
>	<!-- install script.)                                                       -->
>        <init-param>
>           <param-name>configFile</param-name>
>           <param-value>/var/www/tcruzidb-gusdev/servlets/servlet-config</param-value>
>        </init-param>
>
>	<!-- Location of the servlet log file -->
>        <init-param>
>           <param-name>logFile</param-name>
>           <param-value>/var/www/tcruzidb-gusdev/servlets/servlet.log</param-value>
>        </init-param>
>
>	<!-- Whether to enable verbose logging/debugging messages -->
>        <init-param>
>           <param-name>debug</param-name>
>           <param-value>true</param-value>
>        </init-param>
>
>	<!-- Whether to load this servlet when Tomcat starts -->
>        <load-on-startup>1</load-on-startup>
>
>    </servlet>
>
>    <!-- Set the default session timeout to 2 hours; this value can be modified for individual -->
>    <!-- sessions in the servlet itself.                                                       -->
>
>    <session-config>
>        <session-timeout>120</session-timeout>
>    </session-config>
>
></web-app>
>  
>

[Gusdev-gusdev] queries to find constraints

[Steve F. <st...@pc...>]

Thomas and others-

See below for queries to find out the details of a constraint in 
oracle.  Use this if you get messages from oracle describing an 
integrity constraint error and you want to know what foreign key was 
involved.

steve

-------- Original Message --------
Subject: 	Constraint Query
Date: 	Mon, 2 Feb 2004 18:25:55 -0500
From: 	Michael Saffitz <msa...@pc...>
To: 	Steve Fischer <st...@pc...>



Steve,

This is from Table.pm (sub getConstraintsSql), which is part of GUS--> 
gushome/lib/perl/GUS/DBAdmin

constraints on table $owner.$name

select *  from all_constraints c where c.owner = upper('$owner') and 
c.table_name = upper('$name')

for a given $owner.$name table.

foreign key constraints on table $owner.$name:

select ac1.* from all_constraints ac1, all_constraints ac2 where 
ac1.constraint_type = 'R' and ac1.r_constraint_name = 
ac2.constraint_name and ac1.r_owner = ac2.owner and ac2.owner = 
upper('${owner}') and ac2.table_name = upper('${name}')

--Mike

Re: [Gusdev-gusdev] GBParser - problems with the perl modules

[Thomas O. <th...@gm...>]

Steve -


> do you know how to check the oracle system tables to see which foreign 
> key is causing the "integrity constraint?"
> 
> if not, i can send you a query to run.

Yes, would be nice...

> 
> debbie and I looked it up, and it is the taxon_id that is failing.   
> this is because the genbank parser requires you to fill in the taxon 
> tables (because the genbank records refer to taxon).

Okay, I didn't install all the taxon entries totaly, because the perl modul
allocated so much memories, that the machine slowed down a lot. But the Taxon
tag from the genbank file is set: /db_xref="taxon:5693"  in table
sres.taxon:
5669 |  48611 |  5641 |  subfamily |  2 |  2 |  15-JAN-04 |  1 |  1 |  1 | 
1 |  1 |  0 |  1 |  1 |  1 |  5

Anyhow,  I will have a look in the documentation and install the rest of the
taxon...

Thanks,

Thomas

> 
> take a look at fidel and sucheta's user guide on 
> http://www.gusdb.org/documentation.html.   i believe they discuss this.
> 
> steve
> 
> Thomas Otto wrote:
> 
> >Hi Deborah,
> >
> >you are right, the values are testvalues. But there are also in the
> >sres.ExternalDatabaseRelease... is the gbRel so important? - I didn't see
> that it is
> >as a foreign key...
> >
> >Here the entrance of the sres.externaldatabaserelease:
> >135 |  1 |  15-JAN-04 |  10 |  tcrzidb.org |   |   |   |   |  The genom
> of
> >the tcruzi virus |  /seq/tcruzi.fcgi |   |   |   |  29-JAN-04 |  1 |  1 |
>  1 |
> > 1 |  1 |  0 |  6 |  3 |  2 |  1
> >and the modul call:
> >ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=10
> >--file=/seq/tcruzi.fcgi --start=1 --commit
> >
> >It gives the same error...
> >DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR:
> OCIStmtExecute) ...
> >
> >Which part of the programm should manipulate the table DOTS.NASEQUENCEIMP
> ?
> >
> >
> >Thomas
> >
> >  
> >
> >>Hi Thomas,
> >>
> >>Apparently Steve is looking into this but I notice that
> >>external_database_release_id (--db_rel_id) is 135 and the genbank
> release
> >>(--gbRel) is 1.05. Those look suspicious as 135 is a somewhat recent
> >>release of GenBank although it could also be a valid
> >>external_database_release_id in your ExternalDatabaseRelease table while
> >>1.05 doesn't look like a gb release number at all. I wonder if your 
> >>failure is due to a foreign key constraint referencing 
> >>ExternalDatabaseRelease because you actually don't have a PK in that
> table
> >>
> >>of 135. Easy to check. 
> >>
> >>                                     Debbie
> >>
> >>                                              
> >>
> >>
> >>
> >>
> >>On Fri, 30 Jan 
> >>2004, Steve
> >>Fischer wrote:
> >>
> >>    
> >>
> >>>thomas-
> >>>
> >>>i don't have time right now to look into this (i am home and need to 
> >>>take my daughter to skating lesson).  i will as soon as i can.
> >>>
> >>>steve
> >>>
> >>>Thomas Otto wrote:
> >>>
> >>>      
> >>>
> >>>>Hello -
> >>>>
> >>>>I am still fighting with the perl moduls.
> >>>>
> >>>>I.e. the GBParser to upload Genbank datasets gives following error:
> >>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
> >>>>--file=/seq/tcruzi_3.fcgi --commit
> >>>>
> >>>>------------------ entry number 2 -----------------
> >>>>
> >>>>SQL ERROR!! involving
> >>>>
> >>>>   INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> >>>>sequence_type_id, user_read, other_write, modification_date, subcla
> >>>>ss_view, row_group_id, user_write, other_read, group_write,
> >>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
> >>>>        
> >>>>
> >>nam
> >>    
> >>
> >>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
> >>>>        
> >>>>
> >>length,
> >>    
> >>
> >>>>row_project_id, row_alg_invocation_id, sequence_version
> >>>>, na_sequence_id )
> >>>>   VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
> >>>>        
> >>>>
> >>?,
> >>    
> >>
> >>>>?, ?, ?, '', '', ?, ?, ?, ?, ? )  
> >>>>
> >>>>Values:
> >>>>        
> >>>>
>
>>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
> >>    
> >>
> >>>>ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
> >>>>ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
> >>>>1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31
> >>>>        
> >>>>
> >>Trypanosoma
> >>    
> >>
> >>>>cruzi Berenice putative chimeric protein gene, partial
> >>>>cds., 1, 177, 1, 28, 1, 1 at
> >>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a}
> SQL ERROR!! involving\x{a} \x{a}    INSE
> >>    
> >>
> >>>>RT INTO DoTS.ExternalNASequ...') called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
> >>    
> >>
> >>>>)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO DoTS.ExternalNASequence (
> >>>>sequence, group_r...') called at /home/oracle/gus_home/lib/pe
> >>>>rl/GUS/ObjRelP/DbiRow.pm line 674
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)')
> called at /
> >>    
> >>
> >>>>home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)')
> called at /home/oracle/gus_home/lib/per
> >>    
> >>
> >>>>l/GUS/Model/GusRow.pm line 1677
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)')
> called at /home/oracle/gus_home/lib/perl/
> >>    
> >>
> >>>>GUS/Common/Plugin/GBParser.pm line 284
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
> >>    
> >>
> >>>>=HASH(0x8ec41bc)') called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
> >>>>       eval {...} called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)')
> called at /home/oracle
> >>    
> >>
> >>>>/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
> >>>>       eval {...} called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> 427
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
> >>    
> >>
> >>>>ser') called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> 283
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
> >>    
> >>
> >>>>) called at
> >>>>        
> >>>>
> >>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>    
> >>
> >>>>line 192
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)')
> called at /
> >>    
> >>
> >>>>home/oracle/gus_home/bin/ga line 11
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>on the prompt, following error is to see:
> >>>>
> >>>>
> >>>>
> >>>>********GEtting loc below30
> >>>>
> >>>>VLD     CBIL::Bio::GenBank::Locus       1
> >>>>VLD     CBIL::Bio::GenBank::Definition  1
> >>>>VLD     CBIL::Bio::GenBank::Accession   1
> >>>>VLD     CBIL::Bio::GenBank::Version     1
> >>>>VLD     CBIL::Bio::GenBank::Keywords    1
> >>>>VLD     CBIL::Bio::GenBank::Source      1
> >>>>VLD     CBIL::Bio::GenBank::Reference   1
> >>>>VLD     CBIL::Bio::GenBank::Reference   1
> >>>>RUN     1..177
> >>>>RUN     1..46
> >>>>RUN     <30..>177
> >>>>RUN     30..>177
> >>>>VLD     CBIL::Bio::GenBank::Features    1
> >>>>VLD     CBIL::Bio::GenBank::Origin      1
> >>>>Fri Jan 30 15:41:11 2004        STATUS  N=2 ACC=AY488502        
> >>>>TOTAL_OBJECTS=16
> >>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>GUS::Model::DoTS::Source        ::      mol_type        ::     
> genomic
> >>>>        
> >>>>
> >>DNA
> >>    
> >>
> >>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>GUS::Model::DoTS::Source        ::      transgenic      ::
> >>>>
> >>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>GUS::Model::DoTS::Source        ::      mol_type        ::     
> genomic
> >>>>        
> >>>>
> >>DNA
> >>    
> >>
> >>>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >>>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
> >>>>: OCIStmtExecute) [for Statement "
> >>>>   INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> >>>>sequence_type_id, user_read, other_write, modification_date, subcla
> >>>>ss_view, row_group_id, user_write, other_read, group_write,
> >>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
> >>>>        
> >>>>
> >>nam
> >>    
> >>
> >>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
> >>>>        
> >>>>
> >>length,
> >>    
> >>
> >>>>row_project_id, row_alg_invocation_id, sequence_version
> >>>>, na_sequence_id )
> >>>>   VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
> >>>>        
> >>>>
> >>?,
> >>    
> >>
> >>>>?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
> >>>>0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502',
> >>>>        
> >>>>
> >>:p15='GI:41056860',
> >>    
> >>
> >>>>:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
> >>>>2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
> >>>>Trypanosoma cruzi Berenice putative chimeric protein gene, partia
> >>>>l cds.', :p6='ExternalNASequence',
> >>>>:p3='1',
> >>>>        
> >>>>
>
>>:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
> >>    
> >>
>
>>cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa',
> :p7='1', :p17='1', :p22=1, :p9=1, :
> >>    
> >>
> >>>>p11=135] at /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
> >>>>        
> >>>>
> >>line
> >>    
> >>
> >>>>145, <GEN0> line 112.
> >>>>Fri Jan 30 15:41:12 2004        Genbank entries inserted= 0;  updated=
> >>>>        
> >>>>
> >>0;
> >>    
> >>
> >>>>total #(inserted::updated::deleted)=16::::
> >>>>
> >>>>Fri Jan 30 15:41:12 2004        FAILURES        Unable to process 2
> >>>>        
> >>>>
> >>entries.
> >>    
> >>
> >>>>See gbparserFailures/
> >>>>Fri Jan 30 15:41:12 2004        RESULT  Genbank entries inserted= 0;
> >>>>updated= 0;  failed= 2
> >>>>
> >>>>
> >>>>
> >>>>I see the problem, that the table DOTS.NASEQUENCEIMP is not set by the
> >>>>perlprogramm. I thought about setting the variables manually, but
> >>>>        
> >>>>
> >>doesn't
> >>    
> >>
> >>>>make
> >>>>sence.
> >>>>
> >>>>To inserte the values ot the the ExternalDatabaseRelease tables, I
> >>>>orientited myself on the
> >>>>installguide_UGA.html .
> >>>>The registration of the perl class InsertNewExtDbRelease gave
> following
> >>>>error:
> >>>>
> >>>>ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
> >>>>Reading properties from
> /home/oracle/gus_home/config/GUS-PluginMgr.prop
> >>>>Reading properties from /home/oracle/.gus.properties
> >>>>Warning: Use of "require" without parens is ambiguous at (eval 3) line
> >>>>        
> >>>>
> >>1.
> >>    
> >>
> >>>>ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval
> 3)
> >>>>        
> >>>>
> >>line
> >>    
> >>
> >>>>1.
> >>>>Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed
> while
> >>>>"strict subs" in use at (eval 3) line 1.
> >>>>
> >>>>
> >>>>--------------------------- STACK TRACE -------------------------
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword
> "pm" not allowed while "strict subs" in use at
> >>    
> >>
> >>>>(eval...') called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>>>line 248
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>    
> >>
> >>>>called at
> >>>>        
> >>>>
> >>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>    
> >>
> >>>>line 664
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>called at
> >>    
> >>
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> 456
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>    
> >>
> >>>>called at
> >>>>        
> >>>>
> >>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>    
> >>
> >>>>line 283
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>    
> >>
> >>>>called at
> >>>>        
> >>>>
> >>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>    
> >>
> >>>>line
> >>>>192
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)')
> called at
> >>    
> >>
> >>>>/home/oracle/gus_home/bin/ga line 11
> >>>>
> >>>>I hope, that someone can help me.
> >>>>
> >>>>I wish a nice weekend and good luck with the grand -
> >>>>Thomas
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>-------------------------------------------------------
> >>>>The SF.Net email is sponsored by EclipseCon 2004
> >>>>Premiere Conference on Open Tools Development and Integration
> >>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >>>>http://www.eclipsecon.org/osdn
> >>>>_______________________________________________
> >>>>Gusdev-gusdev mailing list
> >>>>Gus...@li...
> >>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >>>> 
> >>>>
> >>>>        
> >>>>
> >>>
> >>>-------------------------------------------------------
> >>>The SF.Net email is sponsored by EclipseCon 2004
> >>>Premiere Conference on Open Tools Development and Integration
> >>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >>>http://www.eclipsecon.org/osdn
> >>>_______________________________________________
> >>>Gusdev-gusdev mailing list
> >>>Gus...@li...
> >>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >>>
> >>>      
> >>>
> >
> >
> >
> >-------------------------------------------------------
> >The SF.Net email is sponsored by EclipseCon 2004
> >Premiere Conference on Open Tools Development and Integration
> >See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >http://www.eclipsecon.org/osdn
> >_______________________________________________
> >Gusdev-gusdev mailing list
> >Gus...@li...
> >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >  
> >
> 

Re: [Gusdev-gusdev] GBParser - problems with the perl modules

[Steve F. <sfi...@pc...>]

thomas-

do you know how to check the oracle system tables to see which foreign 
key is causing the "integrity constraint?"

if not, i can send you a query to run.

debbie and I looked it up, and it is the taxon_id that is failing.   
this is because the genbank parser requires you to fill in the taxon 
tables (because the genbank records refer to taxon).

take a look at fidel and sucheta's user guide on 
http://www.gusdb.org/documentation.html.   i believe they discuss this.

steve

Thomas Otto wrote:

>Hi Deborah,
>
>you are right, the values are testvalues. But there are also in the
>sres.ExternalDatabaseRelease... is the gbRel so important? - I didn't see that it is
>as a foreign key...
>
>Here the entrance of the sres.externaldatabaserelease:
>135 |  1 |  15-JAN-04 |  10 |  tcrzidb.org |   |   |   |   |  The genom of
>the tcruzi virus |  /seq/tcruzi.fcgi |   |   |   |  29-JAN-04 |  1 |  1 |  1 |
> 1 |  1 |  0 |  6 |  3 |  2 |  1
>and the modul call:
>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=10
>--file=/seq/tcruzi.fcgi --start=1 --commit
>
>It gives the same error...
>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR: OCIStmtExecute) ...
>
>Which part of the programm should manipulate the table DOTS.NASEQUENCEIMP ?
>
>
>Thomas
>
>  
>
>>Hi Thomas,
>>
>>Apparently Steve is looking into this but I notice that
>>external_database_release_id (--db_rel_id) is 135 and the genbank release
>>(--gbRel) is 1.05. Those look suspicious as 135 is a somewhat recent
>>release of GenBank although it could also be a valid
>>external_database_release_id in your ExternalDatabaseRelease table while
>>1.05 doesn't look like a gb release number at all. I wonder if your 
>>failure is due to a foreign key constraint referencing 
>>ExternalDatabaseRelease because you actually don't have a PK in that table
>>
>>of 135. Easy to check. 
>>
>>                                     Debbie
>>
>>                                              
>>
>>
>>
>>
>>On Fri, 30 Jan 
>>2004, Steve
>>Fischer wrote:
>>
>>    
>>
>>>thomas-
>>>
>>>i don't have time right now to look into this (i am home and need to 
>>>take my daughter to skating lesson).  i will as soon as i can.
>>>
>>>steve
>>>
>>>Thomas Otto wrote:
>>>
>>>      
>>>
>>>>Hello -
>>>>
>>>>I am still fighting with the perl moduls.
>>>>
>>>>I.e. the GBParser to upload Genbank datasets gives following error:
>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
>>>>--file=/seq/tcruzi_3.fcgi --commit
>>>>
>>>>------------------ entry number 2 -----------------
>>>>
>>>>SQL ERROR!! involving
>>>>
>>>>   INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
>>>>sequence_type_id, user_read, other_write, modification_date, subcla
>>>>ss_view, row_group_id, user_write, other_read, group_write,
>>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
>>>>        
>>>>
>>nam
>>    
>>
>>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
>>>>        
>>>>
>>length,
>>    
>>
>>>>row_project_id, row_alg_invocation_id, sequence_version
>>>>, na_sequence_id )
>>>>   VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
>>>>        
>>>>
>>?,
>>    
>>
>>>>?, ?, ?, '', '', ?, ?, ?, ?, ? )  
>>>>
>>>>Values:
>>>>        
>>>>
>>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
>>    
>>
>>>>ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
>>>>ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
>>>>1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31
>>>>        
>>>>
>>Trypanosoma
>>    
>>
>>>>cruzi Berenice putative chimeric protein gene, partial
>>>>cds., 1, 177, 1, 28, 1, 1 at
>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
>>>>     
>>>>
>>>>        
>>>>
>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a} SQL ERROR!! involving\x{a} \x{a}    INSE
>>    
>>
>>>>RT INTO DoTS.ExternalNASequ...') called at
>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
>>>>     
>>>>
>>>>        
>>>>
>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
>>    
>>
>>>>)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO DoTS.ExternalNASequence (
>>>>sequence, group_r...') called at /home/oracle/gus_home/lib/pe
>>>>rl/GUS/ObjRelP/DbiRow.pm line 674
>>>>     
>>>>
>>>>        
>>>>
>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)') called at /
>>    
>>
>>>>home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
>>>>     
>>>>
>>>>        
>>>>
>>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/per
>>    
>>
>>>>l/GUS/Model/GusRow.pm line 1677
>>>>     
>>>>
>>>>        
>>>>
>>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/perl/
>>    
>>
>>>>GUS/Common/Plugin/GBParser.pm line 284
>>>>     
>>>>
>>>>        
>>>>
>>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
>>    
>>
>>>>=HASH(0x8ec41bc)') called at
>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
>>>>       eval {...} called at
>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
>>>>     
>>>>
>>>>        
>>>>
>>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)') called at /home/oracle
>>    
>>
>>>>/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
>>>>       eval {...} called at
>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 427
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
>>    
>>
>>>>ser') called at
>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 283
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
>>    
>>
>>>>) called at
>>>>        
>>>>
>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>    
>>
>>>>line 192
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at /
>>    
>>
>>>>home/oracle/gus_home/bin/ga line 11
>>>>
>>>>
>>>>
>>>>
>>>>on the prompt, following error is to see:
>>>>
>>>>
>>>>
>>>>********GEtting loc below30
>>>>
>>>>VLD     CBIL::Bio::GenBank::Locus       1
>>>>VLD     CBIL::Bio::GenBank::Definition  1
>>>>VLD     CBIL::Bio::GenBank::Accession   1
>>>>VLD     CBIL::Bio::GenBank::Version     1
>>>>VLD     CBIL::Bio::GenBank::Keywords    1
>>>>VLD     CBIL::Bio::GenBank::Source      1
>>>>VLD     CBIL::Bio::GenBank::Reference   1
>>>>VLD     CBIL::Bio::GenBank::Reference   1
>>>>RUN     1..177
>>>>RUN     1..46
>>>>RUN     <30..>177
>>>>RUN     30..>177
>>>>VLD     CBIL::Bio::GenBank::Features    1
>>>>VLD     CBIL::Bio::GenBank::Origin      1
>>>>Fri Jan 30 15:41:11 2004        STATUS  N=2 ACC=AY488502        
>>>>TOTAL_OBJECTS=16
>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
>>>>GUS::Model::DoTS::Source        ::      mol_type        ::      genomic
>>>>        
>>>>
>>DNA
>>    
>>
>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
>>>>GUS::Model::DoTS::Source        ::      transgenic      ::
>>>>
>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
>>>>GUS::Model::DoTS::Source        ::      mol_type        ::      genomic
>>>>        
>>>>
>>DNA
>>    
>>
>>>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
>>>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
>>>>: OCIStmtExecute) [for Statement "
>>>>   INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
>>>>sequence_type_id, user_read, other_write, modification_date, subcla
>>>>ss_view, row_group_id, user_write, other_read, group_write,
>>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
>>>>        
>>>>
>>nam
>>    
>>
>>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
>>>>        
>>>>
>>length,
>>    
>>
>>>>row_project_id, row_alg_invocation_id, sequence_version
>>>>, na_sequence_id )
>>>>   VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
>>>>        
>>>>
>>?,
>>    
>>
>>>>?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
>>>>0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502',
>>>>        
>>>>
>>:p15='GI:41056860',
>>    
>>
>>>>:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
>>>>2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
>>>>Trypanosoma cruzi Berenice putative chimeric protein gene, partia
>>>>l cds.', :p6='ExternalNASequence',
>>>>:p3='1',
>>>>        
>>>>
>>:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
>>    
>>
>>cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa', :p7='1', :p17='1', :p22=1, :p9=1, :
>>    
>>
>>>>p11=135] at /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
>>>>        
>>>>
>>line
>>    
>>
>>>>145, <GEN0> line 112.
>>>>Fri Jan 30 15:41:12 2004        Genbank entries inserted= 0;  updated=
>>>>        
>>>>
>>0;
>>    
>>
>>>>total #(inserted::updated::deleted)=16::::
>>>>
>>>>Fri Jan 30 15:41:12 2004        FAILURES        Unable to process 2
>>>>        
>>>>
>>entries.
>>    
>>
>>>>See gbparserFailures/
>>>>Fri Jan 30 15:41:12 2004        RESULT  Genbank entries inserted= 0;
>>>>updated= 0;  failed= 2
>>>>
>>>>
>>>>
>>>>I see the problem, that the table DOTS.NASEQUENCEIMP is not set by the
>>>>perlprogramm. I thought about setting the variables manually, but
>>>>        
>>>>
>>doesn't
>>    
>>
>>>>make
>>>>sence.
>>>>
>>>>To inserte the values ot the the ExternalDatabaseRelease tables, I
>>>>orientited myself on the
>>>>installguide_UGA.html .
>>>>The registration of the perl class InsertNewExtDbRelease gave following
>>>>error:
>>>>
>>>>ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
>>>>Reading properties from /home/oracle/gus_home/config/GUS-PluginMgr.prop
>>>>Reading properties from /home/oracle/.gus.properties
>>>>Warning: Use of "require" without parens is ambiguous at (eval 3) line
>>>>        
>>>>
>>1.
>>    
>>
>>>>ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval 3)
>>>>        
>>>>
>>line
>>    
>>
>>>>1.
>>>>Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed while
>>>>"strict subs" in use at (eval 3) line 1.
>>>>
>>>>
>>>>--------------------------- STACK TRACE -------------------------
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword "pm" not allowed while "strict subs" in use at
>>    
>>
>>>>(eval...') called at
>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>>>line 248
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>>    
>>
>>>>called at
>>>>        
>>>>
>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>    
>>
>>>>line 664
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>>called at
>>    
>>
>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 456
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>>    
>>
>>>>called at
>>>>        
>>>>
>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>    
>>
>>>>line 283
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>>    
>>
>>>>called at
>>>>        
>>>>
>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>    
>>
>>>>line
>>>>192
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at
>>    
>>
>>>>/home/oracle/gus_home/bin/ga line 11
>>>>
>>>>I hope, that someone can help me.
>>>>
>>>>I wish a nice weekend and good luck with the grand -
>>>>Thomas
>>>>
>>>>
>>>>
>>>>
>>>>-------------------------------------------------------
>>>>The SF.Net email is sponsored by EclipseCon 2004
>>>>Premiere Conference on Open Tools Development and Integration
>>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>>>>http://www.eclipsecon.org/osdn
>>>>_______________________________________________
>>>>Gusdev-gusdev mailing list
>>>>Gus...@li...
>>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>> 
>>>>
>>>>        
>>>>
>>>
>>>-------------------------------------------------------
>>>The SF.Net email is sponsored by EclipseCon 2004
>>>Premiere Conference on Open Tools Development and Integration
>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>>>http://www.eclipsecon.org/osdn
>>>_______________________________________________
>>>Gusdev-gusdev mailing list
>>>Gus...@li...
>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>
>>>      
>>>
>
>
>
>-------------------------------------------------------
>The SF.Net email is sponsored by EclipseCon 2004
>Premiere Conference on Open Tools Development and Integration
>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>http://www.eclipsecon.org/osdn
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

Re: [Gusdev-gusdev] GBParser - problems with the perl modules

[Thomas O. <th...@gm...>]

Hi Deborah,

you are right, the values are testvalues. But there are also in the
sres.ExternalDatabaseRelease... is the gbRel so important? - I didn't see that it is
as a foreign key...

Here the entrance of the sres.externaldatabaserelease:
135 |  1 |  15-JAN-04 |  10 |  tcrzidb.org |   |   |   |   |  The genom of
the tcruzi virus |  /seq/tcruzi.fcgi |   |   |   |  29-JAN-04 |  1 |  1 |  1 |
 1 |  1 |  0 |  6 |  3 |  2 |  1
and the modul call:
ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=10
--file=/seq/tcruzi.fcgi --start=1 --commit

It gives the same error...
DBD::Oracle::st execute failed: ORA-02291: integrity constraint
(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR: OCIStmtExecute) ...

Which part of the programm should manipulate the table DOTS.NASEQUENCEIMP ?


Thomas

> Hi Thomas,
> 
> Apparently Steve is looking into this but I notice that
> external_database_release_id (--db_rel_id) is 135 and the genbank release
> (--gbRel) is 1.05. Those look suspicious as 135 is a somewhat recent
> release of GenBank although it could also be a valid
> external_database_release_id in your ExternalDatabaseRelease table while
> 1.05 doesn't look like a gb release number at all. I wonder if your 
> failure is due to a foreign key constraint referencing 
> ExternalDatabaseRelease because you actually don't have a PK in that table
> 
> of 135. Easy to check. 
> 
>                                      Debbie
> 
>                                               
> 
> 
> 
> 
> On Fri, 30 Jan 
> 2004, Steve
> Fischer wrote:
> 
> > thomas-
> > 
> > i don't have time right now to look into this (i am home and need to 
> > take my daughter to skating lesson).  i will as soon as i can.
> > 
> > steve
> > 
> > Thomas Otto wrote:
> > 
> > >Hello -
> > >
> > >I am still fighting with the perl moduls.
> > >
> > >I.e. the GBParser to upload Genbank datasets gives following error:
> > >ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
> > >--file=/seq/tcruzi_3.fcgi --commit
> > >
> > > ------------------ entry number 2 -----------------
> > >
> > > SQL ERROR!! involving
> > > 
> > >    INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> > >sequence_type_id, user_read, other_write, modification_date, subcla
> > >ss_view, row_group_id, user_write, other_read, group_write,
> > >external_database_release_id, source_id, g_count, c_count, taxon_id,
> nam
> > >e, secondary_identifier, description, row_user_id, a_count, t_count,
> length,
> > >row_project_id, row_alg_invocation_id, sequence_version
> > >, na_sequence_id )
> > >    VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
> ?,
> > >?, ?, ?, '', '', ?, ?, ?, ?, ? )  
> > >
> > >Values:
> >
>
>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
> > >ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
> > >ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
> > >1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31
> Trypanosoma
> > >cruzi Berenice putative chimeric protein gene, partial
> > >cds., 1, 177, 1, 28, 1, 1 at
> > >/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
> > >      
> > >
> >
>
>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a} SQL ERROR!! involving\x{a} \x{a}    INSE
> > >RT INTO DoTS.ExternalNASequ...') called at
> > >/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
> > >      
> > >
> >
>
>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
> > >)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO DoTS.ExternalNASequence (
> > >sequence, group_r...') called at /home/oracle/gus_home/lib/pe
> > >rl/GUS/ObjRelP/DbiRow.pm line 674
> > >      
> > >
> >
>
>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)') called at /
> > >home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
> > >      
> > >
> >
>
>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/per
> > >l/GUS/Model/GusRow.pm line 1677
> > >      
> > >
> >
>
>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/perl/
> > >GUS/Common/Plugin/GBParser.pm line 284
> > >      
> > >
> >
>
>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
> > >=HASH(0x8ec41bc)') called at
> > >/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
> > >        eval {...} called at
> > >/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
> > >      
> > >
> >
>
>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)') called at /home/oracle
> > >/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
> > >        eval {...} called at
> > >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 427
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
> > >ser') called at
> > >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 283
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
> > >) called at
> /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> > >line 192
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at /
> > >home/oracle/gus_home/bin/ga line 11
> > >
> > >
> > >
> > >
> > >on the prompt, following error is to see:
> > >
> > >
> > >
> > >********GEtting loc below30
> > >
> > >VLD     CBIL::Bio::GenBank::Locus       1
> > >VLD     CBIL::Bio::GenBank::Definition  1
> > >VLD     CBIL::Bio::GenBank::Accession   1
> > >VLD     CBIL::Bio::GenBank::Version     1
> > >VLD     CBIL::Bio::GenBank::Keywords    1
> > >VLD     CBIL::Bio::GenBank::Source      1
> > >VLD     CBIL::Bio::GenBank::Reference   1
> > >VLD     CBIL::Bio::GenBank::Reference   1
> > >RUN     1..177
> > >RUN     1..46
> > >RUN     <30..>177
> > >RUN     30..>177
> > >VLD     CBIL::Bio::GenBank::Features    1
> > >VLD     CBIL::Bio::GenBank::Origin      1
> > >Fri Jan 30 15:41:11 2004        STATUS  N=2 ACC=AY488502        
> > >TOTAL_OBJECTS=16
> > >Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> > >GUS::Model::DoTS::Source        ::      mol_type        ::      genomic
> DNA
> > >
> > >Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> > >GUS::Model::DoTS::Source        ::      transgenic      ::
> > >
> > >Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> > >GUS::Model::DoTS::Source        ::      mol_type        ::      genomic
> DNA
> > >
> > >DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> > >(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
> > >: OCIStmtExecute) [for Statement "
> > >    INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> > >sequence_type_id, user_read, other_write, modification_date, subcla
> > >ss_view, row_group_id, user_write, other_read, group_write,
> > >external_database_release_id, source_id, g_count, c_count, taxon_id,
> nam
> > >e, secondary_identifier, description, row_user_id, a_count, t_count,
> length,
> > >row_project_id, row_alg_invocation_id, sequence_version
> > >, na_sequence_id )
> > >    VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
> ?,
> > >?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
> > >0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502',
> :p15='GI:41056860',
> > >:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
> > >2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
> > >Trypanosoma cruzi Berenice putative chimeric protein gene, partia
> > >l cds.', :p6='ExternalNASequence',
> > >:p3='1',
> >
>
>:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
> >
>
>cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa', :p7='1', :p17='1', :p22=1, :p9=1, :
> > >p11=135] at /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
> line
> > >145, <GEN0> line 112.
> > >Fri Jan 30 15:41:12 2004        Genbank entries inserted= 0;  updated=
> 0;
> > >total #(inserted::updated::deleted)=16::::
> > >
> > >Fri Jan 30 15:41:12 2004        FAILURES        Unable to process 2
> entries.
> > >See gbparserFailures/
> > >Fri Jan 30 15:41:12 2004        RESULT  Genbank entries inserted= 0;
> > >updated= 0;  failed= 2
> > >
> > >
> > >
> > >I see the problem, that the table DOTS.NASEQUENCEIMP is not set by the
> > >perlprogramm. I thought about setting the variables manually, but
> doesn't
> > >make
> > >sence.
> > >
> > >To inserte the values ot the the ExternalDatabaseRelease tables, I
> > >orientited myself on the
> > >installguide_UGA.html .
> > >The registration of the perl class InsertNewExtDbRelease gave following
> > >error:
> > >
> > >ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
> > >Reading properties from /home/oracle/gus_home/config/GUS-PluginMgr.prop
> > >Reading properties from /home/oracle/.gus.properties
> > >Warning: Use of "require" without parens is ambiguous at (eval 3) line
> 1.
> > > 
> > >ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval 3)
> line
> > >1.
> > >Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed while
> > >"strict subs" in use at (eval 3) line 1.
> > > 
> > > 
> > >--------------------------- STACK TRACE -------------------------
> > >      
> > >
> >
>
>GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword "pm" not allowed while "strict subs" in use at
> > >(eval...') called at
> > >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> > >line 248
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> > >called at
> /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> > >line 664
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> called at
> > >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 456
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> > >called at
> /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> > >line 283
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> > >called at
> /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> > >line
> > >192
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at
> > >/home/oracle/gus_home/bin/ga line 11
> > >
> > >I hope, that someone can help me.
> > >
> > >I wish a nice weekend and good luck with the grand -
> > >Thomas
> > >
> > >
> > >
> > >
> > >-------------------------------------------------------
> > >The SF.Net email is sponsored by EclipseCon 2004
> > >Premiere Conference on Open Tools Development and Integration
> > >See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> > >http://www.eclipsecon.org/osdn
> > >_______________________________________________
> > >Gusdev-gusdev mailing list
> > >Gus...@li...
> > >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> > >  
> > >
> > 
> > 
> > 
> > -------------------------------------------------------
> > The SF.Net email is sponsored by EclipseCon 2004
> > Premiere Conference on Open Tools Development and Integration
> > See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> > http://www.eclipsecon.org/osdn
> > _______________________________________________
> > Gusdev-gusdev mailing list
> > Gus...@li...
> > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> > 
> 

Re: [Gusdev-gusdev] GBParser - problems with the perl modules

[Deborah F. P. <pi...@pc...>]

Hi Thomas,

Apparently Steve is looking into this but I notice that
external_database_release_id (--db_rel_id) is 135 and the genbank release
(--gbRel) is 1.05. Those look suspicious as 135 is a somewhat recent
release of GenBank although it could also be a valid
external_database_release_id in your ExternalDatabaseRelease table while
1.05 doesn't look like a gb release number at all. I wonder if your 
failure is due to a foreign key constraint referencing 
ExternalDatabaseRelease because you actually don't have a PK in that table 
of 135. Easy to check. 

                                     Debbie

                                              




On Fri, 30 Jan 
2004, Steve
Fischer wrote:

> thomas-
> 
> i don't have time right now to look into this (i am home and need to 
> take my daughter to skating lesson).  i will as soon as i can.
> 
> steve
> 
> Thomas Otto wrote:
> 
> >Hello -
> >
> >I am still fighting with the perl moduls.
> >
> >I.e. the GBParser to upload Genbank datasets gives following error:
> >ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
> >--file=/seq/tcruzi_3.fcgi --commit
> >
> > ------------------ entry number 2 -----------------
> >
> > SQL ERROR!! involving
> > 
> >    INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> >sequence_type_id, user_read, other_write, modification_date, subcla
> >ss_view, row_group_id, user_write, other_read, group_write,
> >external_database_release_id, source_id, g_count, c_count, taxon_id, nam
> >e, secondary_identifier, description, row_user_id, a_count, t_count, length,
> >row_project_id, row_alg_invocation_id, sequence_version
> >, na_sequence_id )
> >    VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?, ?,
> >?, ?, ?, '', '', ?, ?, ?, ?, ? )  
> >
> >Values:
> >ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
> >ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
> >ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
> >1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31 Trypanosoma
> >cruzi Berenice putative chimeric protein gene, partial
> >cds., 1, 177, 1, 28, 1, 1 at
> >/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
> >      
> >
> >GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a} SQL ERROR!! involving\x{a} \x{a}    INSE
> >RT INTO DoTS.ExternalNASequ...') called at
> >/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
> >      
> >
> >GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
> >)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO DoTS.ExternalNASequence (
> >sequence, group_r...') called at /home/oracle/gus_home/lib/pe
> >rl/GUS/ObjRelP/DbiRow.pm line 674
> >      
> >
> >GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)') called at /
> >home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
> >      
> >
> >GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/per
> >l/GUS/Model/GusRow.pm line 1677
> >      
> >
> >GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/perl/
> >GUS/Common/Plugin/GBParser.pm line 284
> >      
> >
> >GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
> >=HASH(0x8ec41bc)') called at
> >/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
> >        eval {...} called at
> >/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
> >      
> >
> >GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)') called at /home/oracle
> >/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
> >        eval {...} called at
> >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 427
> >      
> >
> >GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
> >ser') called at
> >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 283
> >      
> >
> >GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
> >) called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >line 192
> >      
> >
> >GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at /
> >home/oracle/gus_home/bin/ga line 11
> >
> >
> >
> >
> >on the prompt, following error is to see:
> >
> >
> >
> >********GEtting loc below30
> >
> >VLD     CBIL::Bio::GenBank::Locus       1
> >VLD     CBIL::Bio::GenBank::Definition  1
> >VLD     CBIL::Bio::GenBank::Accession   1
> >VLD     CBIL::Bio::GenBank::Version     1
> >VLD     CBIL::Bio::GenBank::Keywords    1
> >VLD     CBIL::Bio::GenBank::Source      1
> >VLD     CBIL::Bio::GenBank::Reference   1
> >VLD     CBIL::Bio::GenBank::Reference   1
> >RUN     1..177
> >RUN     1..46
> >RUN     <30..>177
> >RUN     30..>177
> >VLD     CBIL::Bio::GenBank::Features    1
> >VLD     CBIL::Bio::GenBank::Origin      1
> >Fri Jan 30 15:41:11 2004        STATUS  N=2 ACC=AY488502        
> >TOTAL_OBJECTS=16
> >Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >GUS::Model::DoTS::Source        ::      mol_type        ::      genomic DNA
> >
> >Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >GUS::Model::DoTS::Source        ::      transgenic      ::
> >
> >Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >GUS::Model::DoTS::Source        ::      mol_type        ::      genomic DNA
> >
> >DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
> >: OCIStmtExecute) [for Statement "
> >    INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> >sequence_type_id, user_read, other_write, modification_date, subcla
> >ss_view, row_group_id, user_write, other_read, group_write,
> >external_database_release_id, source_id, g_count, c_count, taxon_id, nam
> >e, secondary_identifier, description, row_user_id, a_count, t_count, length,
> >row_project_id, row_alg_invocation_id, sequence_version
> >, na_sequence_id )
> >    VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?, ?,
> >?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
> >0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502', :p15='GI:41056860',
> >:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
> >2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
> >Trypanosoma cruzi Berenice putative chimeric protein gene, partia
> >l cds.', :p6='ExternalNASequence',
> >:p3='1',
> >:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
> >cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa', :p7='1', :p17='1', :p22=1, :p9=1, :
> >p11=135] at /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
> >145, <GEN0> line 112.
> >Fri Jan 30 15:41:12 2004        Genbank entries inserted= 0;  updated= 0;
> >total #(inserted::updated::deleted)=16::::
> >
> >Fri Jan 30 15:41:12 2004        FAILURES        Unable to process 2 entries.
> >See gbparserFailures/
> >Fri Jan 30 15:41:12 2004        RESULT  Genbank entries inserted= 0;
> >updated= 0;  failed= 2
> >
> >
> >
> >I see the problem, that the table DOTS.NASEQUENCEIMP is not set by the
> >perlprogramm. I thought about setting the variables manually, but doesn't
> >make
> >sence.
> >
> >To inserte the values ot the the ExternalDatabaseRelease tables, I
> >orientited myself on the
> >installguide_UGA.html .
> >The registration of the perl class InsertNewExtDbRelease gave following
> >error:
> >
> >ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
> >Reading properties from /home/oracle/gus_home/config/GUS-PluginMgr.prop
> >Reading properties from /home/oracle/.gus.properties
> >Warning: Use of "require" without parens is ambiguous at (eval 3) line 1.
> > 
> >ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval 3) line
> >1.
> >Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed while
> >"strict subs" in use at (eval 3) line 1.
> > 
> > 
> >--------------------------- STACK TRACE -------------------------
> >      
> >
> >GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword "pm" not allowed while "strict subs" in use at
> >(eval...') called at
> >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >line 248
> >      
> >
> >GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >line 664
> >      
> >
> >GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm') called at
> >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 456
> >      
> >
> >GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >line 283
> >      
> >
> >GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >line
> >192
> >      
> >
> >GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at
> >/home/oracle/gus_home/bin/ga line 11
> >
> >I hope, that someone can help me.
> >
> >I wish a nice weekend and good luck with the grand -
> >Thomas
> >
> >
> >
> >
> >-------------------------------------------------------
> >The SF.Net email is sponsored by EclipseCon 2004
> >Premiere Conference on Open Tools Development and Integration
> >See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >http://www.eclipsecon.org/osdn
> >_______________________________________________
> >Gusdev-gusdev mailing list
> >Gus...@li...
> >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >  
> >
> 
> 
> 
> -------------------------------------------------------
> The SF.Net email is sponsored by EclipseCon 2004
> Premiere Conference on Open Tools Development and Integration
> See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> http://www.eclipsecon.org/osdn
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> 

[Gusdev-gusdev] Error with WDK (fwd)

[MICHAEL L. <lu...@cs...>]

Michael Luchtan
http://www.cs.uga.edu/~luchtan


---------- Forwarded message ----------
Date: Thu, 29 Jan 2004 16:44:31 -0500 (EST)
From: MICHAEL LUCHTAN <lu...@at...>
To: gus...@li...
Subject: Error with WDK

Hello All-
Since the list has been quite for a couple of days, I will go ahead and
ask a question with regard to the (unsupported) WDK.
This is my first go 'round with tomcat-apache-mod_jk, but I believe that I
have it set up correctly.  I will give you my set-up:
Apache 1.3
Tomcat 4
workers.properties:

	worker.list=wrkr
	worker.wrkr.port=8009
	worker.wrkr.host=tcruzidb-gusdev.ctegd.uga.edu

server.xml(attached)

$CATALINA_HOME/webapps/tcruzidb-gusdev/WEB-INF/web.xml (attached)

relevant tcruzidb-gusdev.conf for apache:
	JkMount /*.jsp wrkr
	JkMount /servlets/* wrkr

relevant httpd.conf:
	JkWorkersFile "/usr/local/tomcat/conf/jk/workers.properties"
	JkLogFile "/usr/local/tomcat/logs/mod_jk.log"
	JkLogLevel debug
	JkLogStampFormat "[%a %b %d %H:%M:%S %Y]"

servlet.log:

	[Jan 29, 2004 2:59:07 PM] <ConnectionPool:MSG> An instance of
	oracle.jdbc.driver.OracleDriver has already been registered.
	[Jan 29, 2004 2:59:07 PM] <ConnectionPool:MSG> Opened JDBC connection 0 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:07 PM] <ConnectionPool:MSG> Opened JDBC connection 1 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:07 PM] <ConnectionPool:MSG> Opened JDBC connection 2 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 3 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 4 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 5 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 6 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:08 PM] <ConnectionPool:MSG> Opened JDBC connection 7 to
	jdbc:oracle:thin:@kiwi.rcr.uga.edu:1521:CTEGD
	[Jan 29, 2004 2:59:19 PM] <ProcessPool-seqAlignment-0:MSG> Init
	[Jan 29, 2004 2:59:20 PM] <ProcessPool-seqAlignment-1:MSG> Init
	[Jan 29, 2004 2:59:20 PM] <ProcessPool-seqAlignment-2:MSG> Init
	[Jan 29, 2004 2:59:20 PM] <ProcessPool-seqAlignment:MSG> initialized 3
	processes
	[Jan 29, 2004 2:59:21 PM] <ProcessPool-Motifs(G)-0:MSG> Init
	[Jan 29, 2004 2:59:22 PM] <ProcessPool-Motifs(G)-1:MSG> Init
	[Jan 29, 2004 2:59:22 PM] <ProcessPool-Motifs(G)-2:MSG> Init
	[Jan 29, 2004 2:59:22 PM] <ProcessPool-Motifs(G):MSG> initialized 3
	processes
	[Jan 29, 2004 2:59:23 PM] <ProcessPool-NRDB(G)-0:MSG> Init
	[Jan 29, 2004 2:59:23 PM] <ProcessPool-NRDB(G)-1:MSG> Init
	[Jan 29, 2004 2:59:24 PM] <ProcessPool-NRDB(G)-2:MSG> Init
	[Jan 29, 2004 2:59:24 PM] <ProcessPool-NRDB(G):MSG> initialized 3
	processes
	[Jan 29, 2004 2:59:25 PM] <ProcessPool-BLAT search-0:MSG> Init
	[Jan 29, 2004 2:59:25 PM] <ProcessPool-BLAT search-1:MSG> Init
	[Jan 29, 2004 2:59:25 PM] <ProcessPool-BLAT search:MSG> initialized 2
	processes
	[Jan 29, 2004 2:59:27 PM] <ProcessPool-Assembly(G)-0:MSG> Init
	[Jan 29, 2004 2:59:27 PM] <ProcessPool-Assembly(G)-1:MSG> Init
	[Jan 29, 2004 2:59:28 PM] <ProcessPool-Assembly(G)-2:MSG> Init
	[Jan 29, 2004 2:59:29 PM] <ProcessPool-Assembly(G)-3:MSG> Init
	[Jan 29, 2004 2:59:29 PM] <ProcessPool-Assembly(G)-4:MSG> Init
	[Jan 29, 2004 2:59:29 PM] <ProcessPool-Assembly(G):MSG> initialized 5
	processes
	[Jan 29, 2004 2:59:30 PM] <ProcessPool-Features(G)-0:MSG> Init
	[Jan 29, 2004 2:59:31 PM] <ProcessPool-Features(G)-1:MSG> Init
	[Jan 29, 2004 2:59:31 PM] <ProcessPool-Features(G)-2:MSG> Init
	[Jan 29, 2004 2:59:32 PM] <ProcessPool-Features(G)-3:MSG> Init
	[Jan 29, 2004 2:59:32 PM] <ProcessPool-Features(G)-4:MSG> Init
	[Jan 29, 2004 2:59:32 PM] <ProcessPool-Features(G):MSG>
	initialized 5 processes
	[Jan 29, 2004 2:59:34 PM] <ObjectFile:ERROR> No value provided for
	mandatory property gene.DefaultTaxonId
	[Jan 29, 2004 2:59:35 PM] <ObjectFile:ERROR> Could not determine class for
	dummyF
	[Jan 29, 2004 2:59:36 PM] <ProcessPool-sequence-0:MSG> Init
	[Jan 29, 2004 2:59:37 PM] <ProcessPool-sequence-1:MSG> Init
	[Jan 29, 2004 2:59:37 PM] <ProcessPool-sequence:MSG> initialized 2
	processes
	[Jan 29, 2004 2:59:38 PM] <SiteServlet:MSG> init() completed
	[Jan 29, 2004 2:59:38 PM] <SiteServlet:MSG> debug = true



I did an install of the WDK, just using the dotsgenes pages, but when I
try to follow a link for a server, for example for the URL:
http://tcruzidb-gusdev.ctegd.uga.edu/servlets/?page=query&showForm=1&query=locuslinkID
I get the following message:

Apache Tomcat/4.0.6 - HTTP Status 404 - /servlets/

type Status report

message /servlets/

description The requested resource (/servlets/) is not available.


What confuses me a little is that the URL does not request an obvious
servlet.  When looking at tomcat examples, the URL will reflect the name
of the servlet, and one can easily find the corresponding class file.
The contents of the servlets directory:
 servlets]# ls -l
total 600
-rwxr-xr-x    1 tomcat   tomcat     433964 Jan 29 14:33 gus-servlet.jar
drwxr-xr-x    2 tomcat   tomcat       4096 Jan 29 14:33 scripts
-rwxr-xr-x    1 tomcat   tomcat     161084 Jan 29 14:33 servlet-config
-rwxr-xr-x    1 tomcat   tomcat       3378 Jan 29 14:59 servlet.log
and the scripts:
 servlets]# ls scripts/ -l
total 36
-rwxr-xr-x    1 tomcat   tomcat        199 Jan 29 14:33 README
-rwxr-xr-x    1 tomcat   tomcat       1375 Jan 29 14:33 assemblyCAP2.pl
-rwxr-xr-x    1 tomcat   tomcat       1142 Jan 29 14:33 assemblyGraphic.pl
-rwxr-xr-x    1 tomcat   tomcat       4463 Jan 29 14:33 blatLink.pl
-rwxr-xr-x    1 tomcat   tomcat       1632 Jan 29 14:33 naSeq.pl
-rwxr-xr-x    1 tomcat   tomcat       1166 Jan 29 14:33 proteinGraphic.pl
-rwxr-xr-x    1 tomcat   tomcat       1159 Jan 29 14:33 rnaMotifs.pl
-rwxr-xr-x    1 tomcat   tomcat       1096 Jan 29 14:33 rnaProtSim.pl


I know that this e-mail is all over the place, but I'm not sure where the
problem lies and wanted to make sure that everyone had any necessary
information.
Can anyone give me some tips?



Michael Luchtan
http://www.cs.uga.edu/~luchtan

Re: [Gusdev-gusdev] GBParser - problems with the perl modules

[Steve F. <st...@pc...>]

thomas-

i don't have time right now to look into this (i am home and need to 
take my daughter to skating lesson).  i will as soon as i can.

steve

Thomas Otto wrote:

>Hello -
>
>I am still fighting with the perl moduls.
>
>I.e. the GBParser to upload Genbank datasets gives following error:
>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
>--file=/seq/tcruzi_3.fcgi --commit
>
> ------------------ entry number 2 -----------------
>
> SQL ERROR!! involving
> 
>    INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
>sequence_type_id, user_read, other_write, modification_date, subcla
>ss_view, row_group_id, user_write, other_read, group_write,
>external_database_release_id, source_id, g_count, c_count, taxon_id, nam
>e, secondary_identifier, description, row_user_id, a_count, t_count, length,
>row_project_id, row_alg_invocation_id, sequence_version
>, na_sequence_id )
>    VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?, ?,
>?, ?, ?, '', '', ?, ?, ?, ?, ? )  
>
>Values:
>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
>ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
>ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
>1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31 Trypanosoma
>cruzi Berenice putative chimeric protein gene, partial
>cds., 1, 177, 1, 28, 1, 1 at
>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
>      
>
>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a} SQL ERROR!! involving\x{a} \x{a}    INSE
>RT INTO DoTS.ExternalNASequ...') called at
>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
>      
>
>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
>)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO DoTS.ExternalNASequence (
>sequence, group_r...') called at /home/oracle/gus_home/lib/pe
>rl/GUS/ObjRelP/DbiRow.pm line 674
>      
>
>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)') called at /
>home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
>      
>
>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/per
>l/GUS/Model/GusRow.pm line 1677
>      
>
>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/perl/
>GUS/Common/Plugin/GBParser.pm line 284
>      
>
>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
>=HASH(0x8ec41bc)') called at
>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
>        eval {...} called at
>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
>      
>
>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)') called at /home/oracle
>/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
>        eval {...} called at
>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 427
>      
>
>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
>ser') called at
>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 283
>      
>
>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
>) called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>line 192
>      
>
>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at /
>home/oracle/gus_home/bin/ga line 11
>
>
>
>
>on the prompt, following error is to see:
>
>
>
>********GEtting loc below30
>
>VLD     CBIL::Bio::GenBank::Locus       1
>VLD     CBIL::Bio::GenBank::Definition  1
>VLD     CBIL::Bio::GenBank::Accession   1
>VLD     CBIL::Bio::GenBank::Version     1
>VLD     CBIL::Bio::GenBank::Keywords    1
>VLD     CBIL::Bio::GenBank::Source      1
>VLD     CBIL::Bio::GenBank::Reference   1
>VLD     CBIL::Bio::GenBank::Reference   1
>RUN     1..177
>RUN     1..46
>RUN     <30..>177
>RUN     30..>177
>VLD     CBIL::Bio::GenBank::Features    1
>VLD     CBIL::Bio::GenBank::Origin      1
>Fri Jan 30 15:41:11 2004        STATUS  N=2 ACC=AY488502        
>TOTAL_OBJECTS=16
>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
>GUS::Model::DoTS::Source        ::      mol_type        ::      genomic DNA
>
>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
>GUS::Model::DoTS::Source        ::      transgenic      ::
>
>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
>GUS::Model::DoTS::Source        ::      mol_type        ::      genomic DNA
>
>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
>: OCIStmtExecute) [for Statement "
>    INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
>sequence_type_id, user_read, other_write, modification_date, subcla
>ss_view, row_group_id, user_write, other_read, group_write,
>external_database_release_id, source_id, g_count, c_count, taxon_id, nam
>e, secondary_identifier, description, row_user_id, a_count, t_count, length,
>row_project_id, row_alg_invocation_id, sequence_version
>, na_sequence_id )
>    VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?, ?,
>?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
>0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502', :p15='GI:41056860',
>:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
>2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
>Trypanosoma cruzi Berenice putative chimeric protein gene, partia
>l cds.', :p6='ExternalNASequence',
>:p3='1',
>:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
>cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa', :p7='1', :p17='1', :p22=1, :p9=1, :
>p11=135] at /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
>145, <GEN0> line 112.
>Fri Jan 30 15:41:12 2004        Genbank entries inserted= 0;  updated= 0;
>total #(inserted::updated::deleted)=16::::
>
>Fri Jan 30 15:41:12 2004        FAILURES        Unable to process 2 entries.
>See gbparserFailures/
>Fri Jan 30 15:41:12 2004        RESULT  Genbank entries inserted= 0;
>updated= 0;  failed= 2
>
>
>
>I see the problem, that the table DOTS.NASEQUENCEIMP is not set by the
>perlprogramm. I thought about setting the variables manually, but doesn't
>make
>sence.
>
>To inserte the values ot the the ExternalDatabaseRelease tables, I
>orientited myself on the
>installguide_UGA.html .
>The registration of the perl class InsertNewExtDbRelease gave following
>error:
>
>ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
>Reading properties from /home/oracle/gus_home/config/GUS-PluginMgr.prop
>Reading properties from /home/oracle/.gus.properties
>Warning: Use of "require" without parens is ambiguous at (eval 3) line 1.
> 
>ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval 3) line
>1.
>Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed while
>"strict subs" in use at (eval 3) line 1.
> 
> 
>--------------------------- STACK TRACE -------------------------
>      
>
>GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword "pm" not allowed while "strict subs" in use at
>(eval...') called at
>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>line 248
>      
>
>GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>line 664
>      
>
>GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm') called at
>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 456
>      
>
>GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>line 283
>      
>
>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>line
>192
>      
>
>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at
>/home/oracle/gus_home/bin/ga line 11
>
>I hope, that someone can help me.
>
>I wish a nice weekend and good luck with the grand -
>Thomas
>
>
>
>
>-------------------------------------------------------
>The SF.Net email is sponsored by EclipseCon 2004
>Premiere Conference on Open Tools Development and Integration
>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>http://www.eclipsecon.org/osdn
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>