Re: [Bio-bwa-help] Why bwa maps pairs to same location. .

SourceForge Headquarters 225 Broadway Suite 1600 San Diego, CA 92101 +1 (858) 454-5900

The flags column is a bitmap, so you have to ask if FLAGS bitwise-and 4 = 0 or 4. In this case, the first record 69 & 4 = 4, so this record has the unmapped flag set.  Just as Peter suspected, the record is unmapped.  When you process the BAM data, you have to check the flag first to see if it's mapped or unmapped--if it's unmapped, then the position information is meaningless (though it does provide helpful sorting, as Peter also pointed out).

Michael

From: Peng, Peichao [mailto:ppe...@wh...]
Sent: Tuesday, October 23, 2012 9:44 PM
To: Peter Johansson
Cc: bio...@li...
Subject: Re: [Bio-bwa-help] Why bwa maps pairs to same location. .

Thanks for your reply. I don't think it's 0 in flag. Below is just one of the numerous examples.

ERR001268.16785 69      chr10   42529836        0       *       =       42529836        0       GGATTTCTTCTTATAATTCTTGACAAAAGAATTCTC    @I?IIICIIIII1<8,G78F4956>/2++,,8:19+
ERR001268.16785 137     chr10   42529836        0       36M     =       42529836        0       TGTGAGTTGAACGCACACATCCCAAAGTAGTTTCTG    .?@I0I?;..;674+783.+0$0*/%0'+.+1/<mailto:.?@I0I?;..;674+783.+0$0*/%250'+.+1/>(++    XT:A:R  NM:i:1  SM:i:0  AM:i:0  X0:i:12 X1:i:186        XM:i:1       XO:i:0  XG:i:0  MD:Z:21A14

Thanks!

Best,

--
Peichao Peng
Department of Statistics
The Wharton School
University of Pennsylvania
Philadelphia, PA 19104
E-mail: ppe...@wh...<mailto:ppe...@wh...>
Phone: 1-215-429-6918
________________________________
From: Peter Johansson [tr...@gm...]
Sent: Tuesday, October 23, 2012 10:34 PM
To: Peng, Peichao
Cc: bio...@li...<mailto:bio...@li...>
Subject: Re: [Bio-bwa-help] Why bwa maps pairs to same location
On 10/24/2012 12:31 PM, Peng, Peichao wrote:
I am just wondering, under default parameters, why bwa maps numerous paired-end reads to the same location on the reference genome and the TLEN (inferred template size) column is 0. Thanks.

Are both reads mapped, in other words, is the bit 0x4 zero in flag in both reads? Unmapped reads are typically given the position of their mapped reads, which is very handy when looking for structural variants.

Cheers,
Peter

________________________________
Email Disclaimer: www.stjude.org/emaildisclaimer
Consultation Disclaimer: www.stjude.org/consultationdisclaimer