Re: [Bio-bwa-help] understand XA in paired-end alignment

[Heng Li <lh...@sa...>]

XA is for single-end only.

Heng


On Jul 27, 2010, at 6:40 PM, Duke wrote:

> Hi all,
> 
> I have difficulties in understanding the XA tags for paired-end alignment. For example, for the following (paired) read:
> 
> HWUSI-EAS751_0006:1:1:1124:2814#0    99    chrM    1832    15    36M    =    1973    177    GGACTAACCCCTATACCTTCTGCATAATGAATTAAC    ^UVP\\UTRW\_]bT\_`_\``^\^aaaYaa^_^\^    XT:A:U    NM:i:0    SM:i:15    AM:i:15    X0:i:1    X1:i:2    XM:i:0    XO:i:0    XG:i:0    MD:Z:36    XA:Z:chr17,+22022584,36M,1;chr5,-79946672,36M,1;
> HWUSI-EAS751_0006:1:1:1124:2814#0    147    chrM    1973    15    36M    =    1832    -177    AAGATTTATAGATGAAGGCGACAAACCTACCGAGCC    bb]bK_S]Z]bKQJJRZJ^SH]_bU_\aX\LO^X^]    XT:A:M    NM:i:3    SM:i:15    AM:i:15    XM:i:3    XO:i:0    XG:i:0    MD:Z:11G1A0G21
> 
> My understanding is that the read can be considered as "mapped in proper pair" when the top one (above) matches the forward reference, and the bottom one matches the reverse reference. Since the top one has multiple hits: chr17,+22022584,36M,1 and chr5,-79946672,36M,1, the next pair can be only:
> 
> HWUSI-EAS751_0006:1:1:1124:2814#0    99    chr17    22022584    15    36M    =    1973    177    GGACTAACCCCTATACCTTCTGCATAATGAATTAAC    ^UVP\\UTRW\_]bT\_`_\``^\^aaaYaa^_^\^    XT:A:U    NM:i:1    SM:i:15    AM:i:15    X0:i:1    X1:i:2    XM:i:0    XO:i:0    XG:i:0    MD:Z:36    XA:Z:chr17,+22022584,36M,1;chr5,-79946672,36M,1;
> HWUSI-EAS751_0006:1:1:1124:2814#0    147    chrM    1973    15    36M    =    1832    -177    AAGATTTATAGATGAAGGCGACAAACCTACCGAGCC    bb]bK_S]Z]bKQJJRZJ^SH]_bU_\aX\LO^X^]    XT:A:M    NM:i:3    SM:i:15    AM:i:15    XM:i:3    XO:i:0    XG:i:0    MD:Z:11G1A0G21
> 
> whereas the second hit (chr5,-79946672,36M,1) can not be paired mapped since it matches reversely. Am I correct, or do I miss anything?
> 
> Thank you,
> 
> D.
> ------------------------------------------------------------------------------
> The Palm PDK Hot Apps Program offers developers who use the
> Plug-In Development Kit to bring their C/C++ apps to Palm for a share 
> of $1 Million in cash or HP Products. Visit us here for more details:
> http://ad.doubleclick.net/clk;226879339;13503038;l?
> http://clk.atdmt.com/CRS/go/247765532/direct/01/_______________________________________________
> Bio-bwa-help mailing list
> Bio...@li...
> https://lists.sourceforge.net/lists/listinfo/bio-bwa-help



-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE.