#45 bbmap.sh identifying "broken reads" that are not broken

[Jacob Nearing]

Hello,

I have been using bbmap to map metagenomic reads to the human/phix genome. I ran into the following error:

Mismatch between length of bases and qualities for read 72274 (id=SRR5930536.86571 86571 length=100).
# qualities=60, # bases=100
AGGGGIIIIIGGIIIIIIIIIIIIIGIIIIIIIIIIGGGIIIIIIIGIIGIIIIIIGGGI
CGGCGACAAGGGCATCCGTGGCGTCGTCGTGGCGCTGGGCGAAGGCCTCTCCAACATTACGGTCGACGGTACGCACGTCACGGCGGCGGCCGGCGCCTTG
This can be bypassed with the flag 'tossbrokenreads' or 'nullifybrokenquality'

However, when I manually check this read this is not the case.

 @SRR5930536.86571 86571 length=100$
CGGCGACAAGGGCATCCGTGGCGTCGTCGTGGCGCTGGGCGAAGGCCTCTCCAACATTACGGTCGACGGTACGCACGTCACGGCGGCGGCCGGCGCCTTG$
+$
AGGGGIIIIIGGIIIIIIIIIIIIIGIIIIIIIIIIGGGIIIIIIIGIIGIIIIIIGGGIIIGIGAAGGIIIGGGGGGGGIGIGGIGIIIIIIGGGIIIG$

I double checked to make sure there was no hidden characters but that is not the case.
Furthermore, I checked the file to make sure it was not corrupted and it passed all fastq checks.

Any help on this would be great.

[Jacob Nearing]

I would like to give an update to this. I found the issue it occurs when you pause the job and then try and resume it in the background using the "bg" command on a unix system.