#22 seal.sh restrict parameter doesn't work?

[Jeltje van Baren]

I recently conda installed bbmap (version 38.68) using bioconda. I'm trying to separate an RNASeq fastq file based on sequencing primers using seal.sh and I expect the primer to be always at the start of the sequence like so:

primer (..)CGACATGGTTCTACACTAAACGAGGGTCCAACTGTCTC
read                      CTAAACGAGGGTCCAACTGTCTCTTATCTTTAATCAGTGAAAT(...)

This works when I run seal.sh like so:
seal.sh in=test.fq pattern=%.fq ref=ref.fa k=10 mm=f restrictleft=30
However, it ALSO works when I run it like so:
seal.sh in=test.fq pattern=%.fq ref=ref.fa k=10 mm=f restrictright=30
In fact I can set restrictleft or restrictright to tiny values and I still end up with a primer.fq file that contains the read.
Unfortunately my experiment contains overlapping amplicons and primers will therefore match the middle of a sequence, which results in incorrect pooling.
How do I enforce restrictleft?

[Jeltje van Baren]

it wouldn't let me attach two files somehow, here's the primer