Re: [AMOS-help] oligo assembly fails using minimus

[Dan S. <ds...@um...>]

Marc,   The hash-overlap step is only finding one valid overlap between the
first oligo and the 13th oligo(FWD_seq_RES).  Do you know what the final
assembly should be?  If so, could you send me what other oligos should
overlap and I will check why hash-overlap is missing them.

Dan


On Jan 11, 2008 11:01 AM, Marc Logghe <Mar...@ab...> wrote:

> Hi all,
>
> I was trying to make a minimus based amos script to assemble overlapping
> oligonucleotides, let's call it micromus ;-)
> The only differences with the original minimus script are:
> - conversion of the fasta read sequences to amos format
> - hash-overlap parameters saying the minimum overlap is 10
> The script is shown below between AMOS_SCRIPT tags, the oligos between
> OLIGOS tags.
>
> The resulting contig is only 31 nt long, not the expected one of 234 nt.
> What did I do wrong here ?
>
> Thanks and regards,
> Marc
>
> <AMOS_SCRIPT>
> #!/usr/share/amos-2.0.4/bin/runAmos -C
> # `minimus' - The AMOS Lightweight Assembler Pipeline
> #--------------------------------------- USER DEFINED VALUES
> ------------------#
> PREF = $(strip .afg PREFIX)
> TGT = $(PREF).afg
> #-----------------------------------------------------------------------
> -------#
> BINDIR=/usr/share/amos-2.0.4/bin
> BANK    = $(PREF).bnk
> CONTIG  = $(PREF).contig
> FASTA   = $(CONTIG).fasta
> INPUTS  = $(TGT)
> OUTPUTS = $(CONTIG) $(FASTA)
>
> ## Converting input reads fasta to AMOS format
> 1:$(BINDIR)/../src/Converters/toAmos.pl -s $(PREF) -o $(TGT)
>
> ## Building AMOS bank
> 10: $(BINDIR)/bank-transact -c -z -b $(BANK) -m $(TGT)
>
> ## Running overlap
> 20: $(BINDIR)/hash-overlap -o 10 -B $(BANK)
>
> ## Running contigger
> 30: $(BINDIR)/tigger -b $(BANK)
>
> ## Running consensus
> 40: $(BINDIR)/make-consensus -B -b $(BANK)
>
> ## Outputting contigs
> 50: $(BINDIR)/bank2contig $(BANK) > $(CONTIG)
>
> ## Converting to FastA file
> 60: $(BINDIR)/bank2fasta -b $(BANK) > $(FASTA)
> </AMOS_SCRIPT>
>
> <OLIGOS>
> >FWD_seq_1
> aggcataggcttggttatgccggtactgcc
> >FWD_seq_2
> cgggatatcgtccattccgacagcatcgcc
> >FWD_seq_3
> gcgtgctgctagcgctatatgcgttgatgc
> >FWD_seq_4
> cgcacccgttctcggagcactgtccgaccg
> >FWD_seq_5
> cgcccagtcctgctcgcttcgctacttgga
> >FWD_seq_6
> gactacgcgatcatggcgaccacacccgt
> >REV_seq_1
> cacaggacgggtgtgg
> >REV_seq_2
> tcgcgtagtcgatagtggctccaagtagc
> >REV_seq_3
> ggactgggcggcggccaaagcggtcggaca
> >REV_seq_4
> aacgggtgcgcatagaaattgcatcaacgc
> >REV_seq_5
> agcagcacgccatagtgactggcgatgctg
> >REV_seq_6
> cgatatcccgcaagaggcccggcagtaccg
> >FWD_seq_RES
> aggcataggcttggttatgc
> >REV_seq_RES
> cacaggacgggtgtggtcgc
> </OLIGOS>
>
>
> -------------------------------------------------------------------------
> Check out the new SourceForge.net Marketplace.
> It's the best place to buy or sell services for
> just about anything Open Source.
>
> http://ad.doubleclick.net/clk;164216239;13503038;w?http://sf.net/marketplace
> _______________________________________________
> AMOS-help mailing list
> AMO...@li...
> https://lists.sourceforge.net/lists/listinfo/amos-help
>