| Name | Modified | Size | Downloads / Week |
|---|---|---|---|
| Parent folder | |||
| Human_mirBase_v21.zip | 2015-03-19 | 947.9 MB | |
| Human_mirBase_v20.zip | 2015-03-19 | 945.2 MB | |
| Other_species_miRBase_v20.zip | 2015-03-19 | 27.5 MB | |
| Totals: 3 Items | 1.9 GB | 6 | |
Author : Giorgio Giurato This is iMir, a modular pipeline for comprehensive analysis of smallRNA-Seq data, from linker removal and sequence quality checks to differential expression and biological target prediction, integrating multiple open source modules and resources linked together in an automated workflow. ********************************************************************************************************************************************************************************************************* ********************************************************************************************************************************************************************************************************* FOR INFORMATION HOW USE iMir AND INSTALL DEPENDENCES SEE DOCUMENTATION FILE ALSO. ********************************************************************************************************************************************************************************************************* ********************************************************************************************************************************************************************************************************* Prerequisites: - Python (libraries numpy,matplotlib,rpy2) - Perl (library PDF-API2) - Java - R Dependences: - Bowtie - Vienna RNA Secondary Structure package - Weka - DESeq Installation: Linux: Move in the directroy /iMir_Linux/src/ and from bash digit: >sh install_iMir.sh MAC: Move in the directory /iMir_Mac/src/ and from bash digit: >sh install_iMir.sh ********************************************************************************************************************************************************************************************************* How use iMir: iMir scripts can be execute directly using PYTHON after dependencies have been installed and DB folder (iMir_DB) have been populated with all libraries of the species of interest (for more details see section 5 of documentation). To run iMir change directory (cd) to the folder containing the iMir.py file (src) and run the script: > cd [path of iMir_folder] > python iMir.py #command line to launch iMir Graphical User Interface. To test iMir we provided a dataset contained in the folder Test_Samples. (It is mandatory download iMir_DB and refers to Human database contained in the folder iMir_DB/Human/miRanalyzerDB) For test use: 3' adapter sequence TGGAATTCTCGGGTGCCAAGG ********************************************************************************************************************************************************************************************************* iMir General structure of the database: In iMir several libraries, like mature microRNA, precursor microRNA, chromosome sequences, bowtie indexes, etc., are stored in a local file-base database called “iMir_DB". A full description of the database used by miRanalyzer can be found at miRanalyzer web-page, section “General Structure of the database” (http://bioinfo5.ugr.es/miRanalyzer/standalone.html#toc-Subsection-3.1). The miRanalyzerDB contains the folders: bowtie: the folder where the bowtie indexes must be. model: this folder holds the model files for the prediction of the new microRNA out: the default output folder, a folder with the name of the input file will be generated in this directory. seqOBJ: the genome sequences in miRanalyzer format. The bowtie folder is divided in several subfolders which need to be name exactly as follows: genome: the indexes of the whole genome sequences. The name must be the same as used for the genome sequences in seqOBJ folder. mature: the indexes for the mature microRNA hairpin: the indexes for the hairpin - precursor- sequences of microRNAs translibs: the indexes of the other libraries which should be used. It is a customize libray. The files can be generated with bowtie-built. Database population: iMir provides the libraries to analyze miRNA-Seq experiments from human. Is possible to download the corresponding DB folder, organized as described above. iMir refers to miRBase v.20 for the mature and hairpin sequences and to RFam v10.1, piRNA , RefSeq and tRNA for translibs sequences. DB not include reference genome (.fa,.ebwt) that can be downloaded at ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Homo_sapiens/UCSC/hg19/Homo_sapiens_UCSC_hg19.tar.gz ************************************************************************************************************************************************************************************************************ 29/10/2013 BUG FIXED install rpy2 version 2.3.8 02/01/2015 Cutadapt Version 1.4.2 (.gz input file)