Download Latest Version HMM-FRAME.tar.gz (81.6 kB) Google Add to Preferred Sources
Home
Name Modified Size InfoDownloads / Week
readme.txt 2014-07-24 2.9 kB
HMM-FRAME.tar.gz 2014-07-24 81.6 kB
Totals: 2 Items   84.6 kB 0
Version
===================
This software was last updated 7/24/2014. Questions, comments, suggestions, etc?
Send emails to nick.zhangyuan@gmail.com

Installation
===================
1. Untar the source file called "HMM-FRAME.tar.gz".
2. g++ compiler is required in your Unix system. To install HMM-FRAME, run the Makeme file using the following command:
make

Run HMM-FRAME
===================
The installation will generate the bin file: hmmframe. To run hmmframe, use the following command:
./run_hmmframe.sh -m <HMMER3 hmm file> -s <nucleotide fasta file> -o <output file> [-e]

The hmm file can contain multiple hmm models and should be in HMMER3.0's hmm file format. These files can be downloaded from Pfam ftp. The nucleotide sequence file should in be fasta format. The default reference model uses 0.0007 for non-homopolymer regions and 0.0044 for homopolymer regions. When the option "-e" is set, then the error model will shift to our self-trained model. For example, to run the fasta file test.fa, against nifH family model file nifH.hmm using the reference error model:

./run_hmmframe -m nifH.hmm -s test.fa -o test.hmmframe
 
Output
===================
The output of HMM-FRAME is in fasta format. It keeps the sequence name but adds additional information such as Pfam family, Viterbi score, number of errors and error positions in both the original sequence and the model. Also the sequences are corrected based on the predicted errors. 
For example, for the following input sequence against nifH family:

>GB4XUSJ05FQ71N
CACCCGTCTGATGCTTCACTCCAAAGCTCAAACCACCGTACTACACTTAGCTGCTGAACGCGGTGCAGTAGAAGACTTAGAACTCCACGAAGTAATGTTGACCGGTTTCCGTGGCGTTAAGTGCGTAGAATCTGGTGGTCCAGAACCCGGTGTAGGTTGCGCCGGTCGTGGTATCATCACCGCCATTAACTTCTTAGAAGAAAACGGCGCTTTACCAAGACCTAGACTTCGTATCCTACGACGTATTGGGTGACGTTGTATGTGGTGGTTTCGCTATGCCTATCCGTGAAGGTAAAGCACAAGAAATCTACATCGTTACC

The output of HMM-FRAME is:

>GB4XUSJ05FQ71N hmm_name=nifH score=216.586 error_num=1 seq_insertion_pos=211, seq_deletion_pos= state_insertion_pos=116, state_deletion_pos=
ACCCGTCTGATGCTTCACTCCAAAGCTCAAACCACCGTACTACACTTAGCTGCTGAACGCGGTGCAGTAGAAGACTTAGAACTCCACGAAGTAATGTTGACCGGTTTCCGTGGCGTTAAGTGCGTAGAATCTGGTGGTCCAGAACCCGGTGTAGGTTGCGCCGGTCGTGGTATCATCACCGCCATTAACTTCTTAGAAGAAAACGGCGCTTACCAAGACCTAGACTTCGTATCCTACGACGTATTGGGTGACGTTGTATGTGGTGGTTTCGCTATGCCTATCCGTGAAGGTAAAGCACAAGAAATCTACATCGTTACC

The sequence name is GB4XUSJ05FQ71N. The query hmm family is nifH family. The alignment score is 216.586 bits. There is one insertion error.

Referencing HMM-FRAME
=======================
HMM-FRAME can be referenced as:
Y. Zhang and Y. Sun, "HMM-FRAME: accurate protein domain classification for metagenomic sequences containing frameshift errors", BMC Bioinformatics, vol. 12, no. 1, p. 198, 2011.

License
===================
Copyright (C) 2011 Yuan Zhang, Yanni Sun.
You may redistribute this software under the terms of GNU GENERAL PUBLIC LICENSE.

Source: readme.txt, updated 2014-07-24