#11 Question about invalid QVs

[Matthew Kellom]

Hello, could you please elucidate the following alert message from the errorLog:

ILL Alert: Fragment @M02586:6:000000000-A7YKD:1:1101:10407:1175 has 2 invalid QVs.

Here are the corresponding fragment mates from the illumina fastq files:

@M02586:6:000000000-A7YKD:1:1101:10407:1175 1:N:0:1
TGCTGATACTGTAATGGATCTAAGCCTCGGGGCAATTCTGAACGAGATGAGAAAGAGTATTTTAGAAGTATCAACTCTGCCGGTAGGAACTGTTCCAATTTATCAGGTTGGATTTAGTCTCTCAAAAAAGAAGAAAAGGATTG
+
CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG

@M02586:6:000000000-A7YKD:1:1101:10407:1175 2:N:0:1
NAATCCTTTTCTTCTTTTTTGAGAGACTAAATCCAACCTGATAAATTGGAACAGTTCCTACCGGCAGAGTTGATACTTCTAAAATACTCTTTCTCATCTCGTTCAGAATTGCCCCGAGGCTTAGATCCATTACAGTATCAGCA
+
#8BCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDFGG

Which QVs are invalid?
Thank you for your time

[Matthew Kellom]

Attached here are the alert message and the fragments, because formatting on this page is not as I imagined

[Sergey Koren]

Hi,

In your earlier email you indicated that the -type parameter for fastqToCA
was set to Illumina. This is equivalent to PHRED64 and this the lowest
possible QV is @. In your second sequence, the starting values of # and 8
would be negative, causing the error message. The highest quality value in
your file is also only 7 with PHRED64 offset so I think you need to set
-type to sanger for PHRED32. The parameters for fastqToCA are documented on
the wiki page:
http://sourceforge.net/apps/mediawiki/wgs-assembler/index.php?title=FastqToCAand
if you run the command with no parameters.

Sergey

Attached here is the alert message and the fragments, because formatting on
this page is not as I imagined

Attachment: invalid_QVs.txt (780 Bytes; text/plain)

• [support-requests:#11]
  http://sourceforge.net/p/wgs-assembler/support-requests/11/ Question
  about invalid QVs*

Status: open
Group: v1.0_(example)
Created: Wed Mar 26, 2014 11:30 PM UTC by Matthew Kellom
Last Updated: Wed Mar 26, 2014 11:30 PM UTC
Owner: nobody

Hello, could you please elucidate the following alert message from the
errorLog:
ILL Alert: Fragment @M02586:6:000000000-A7YKD:1:1101:10407:1175 has 2
invalid QVs.

Here are the corresponding fragment mates from the illumina fastq files:

@M02586:6:000000000-A7YKD:1:1101:10407:1175 1:N:0:1
TGCTGATACTGTAATGGATCTAAGCCTCGGGGCAATTCTGAACGAGATGAGAAAGAGTATTTTAGAAGTATCAACTCTGCCGGTAGGAACTGTTCCAATTTATCAGGTTGGATTTAGTCTCTCAAAAAAGAAGAAAAGGATTG
+
CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG

@M02586:6:000000000-A7YKD:1:1101:10407:1175 2:N:0:1
NAATCCTTTTCTTCTTTTTTGAGAGACTAAATCCAACCTGATAAATTGGAACAGTTCCTACCGGCAGAGTTGATACTTCTAAAATACTCTTTCTCATCTCGTTCAGAATTGCCCCGAGGCTTAGATCCATTACAGTATCAGCA
+

8BCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGDFGG

Which QVs are invalid?
Thank you for your time

---

Sent from sourceforge.net because you indicated interest in
https://sourceforge.net/p/wgs-assembler/support-requests/11/

To unsubscribe from further messages, please visit
https://sourceforge.net/auth/subscriptions/

[Matthew Kellom]

That did the trick!

Thank you very much