You can subscribe to this list here.
| 2010 |
Jan
|
Feb
|
Mar
|
Apr
(1) |
May
(4) |
Jun
(2) |
Jul
(3) |
Aug
(3) |
Sep
(5) |
Oct
(2) |
Nov
(4) |
Dec
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2011 |
Jan
(12) |
Feb
|
Mar
(5) |
Apr
(6) |
May
|
Jun
|
Jul
(1) |
Aug
|
Sep
|
Oct
(15) |
Nov
(3) |
Dec
|
| 2012 |
Jan
|
Feb
(7) |
Mar
(3) |
Apr
(17) |
May
(5) |
Jun
|
Jul
(5) |
Aug
(1) |
Sep
(2) |
Oct
(3) |
Nov
(2) |
Dec
(1) |
| 2013 |
Jan
|
Feb
|
Mar
|
Apr
|
May
(4) |
Jun
|
Jul
(1) |
Aug
|
Sep
(2) |
Oct
(2) |
Nov
(2) |
Dec
(2) |
| 2014 |
Jan
|
Feb
(2) |
Mar
(9) |
Apr
(2) |
May
|
Jun
(2) |
Jul
(1) |
Aug
(1) |
Sep
|
Oct
|
Nov
(1) |
Dec
(1) |
| 2015 |
Jan
|
Feb
|
Mar
(4) |
Apr
|
May
|
Jun
|
Jul
|
Aug
|
Sep
|
Oct
|
Nov
|
Dec
|
| 2017 |
Jan
|
Feb
|
Mar
|
Apr
|
May
|
Jun
(1) |
Jul
|
Aug
|
Sep
|
Oct
|
Nov
|
Dec
|
|
From: Noboru Jo S. <ns...@uc...> - 2010-11-16 17:32:09
|
<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html> <head> <meta content="text/html;charset=ISO-8859-1" http-equiv="Content-Type"> </head> <body bgcolor="#ffffff" text="#000000"> Hi Sonja, I am sending our emails to the list, I replied your message, and unlike other mailing lists that I subscribe to, this one was sent only to your email.<br> Let's make sure we send to the list, so other users can benefit.<br> <br> Answering your question, the Tag2Point app converts .bed to USeq's format. I think it will be easier than assembling an eland file from what you have. For what I understand, you don't have qualities, so it won't matter anyway.<br> I never used this ChIPSeq app, it's something new. I wrote a bash script that allows me to go step by step. I might start using the app now, but I like the flexibility of the bash script, because I can see if everything is going well.<br> Also, I don't always use the PeakShiftFinder app, so I can bypass it in my script.<br> You just have to write the script once, anyway, so you might want to give it a try.<br> <br> noboru<br> <br> <br> Sonja Althammer wrote: <blockquote cite="mid:AAN...@ma..." type="cite">yes I have seen this and I found already my problem. my files are not really in eland format.<br> the wrapper doesnt work with bed-files, right?<br> As I have to run the program a lot of times I would like to make it run with one command...<br> <br> I checked which fields I need for eland format here:<br> <a moz-do-not-send="true" href="http://bioinfo.cgrb.oregonstate.edu/docs/solexa/Whole%20genome%20alignments%20using%20ELAND.html">http://bioinfo.cgrb.oregonstate.edu/docs/solexa/Whole%20genome%20alignments%20using%20ELAND.html</a><br> <br> Now I am trying to convert my files to eland. So maybe you can help me here: which columns are really required? Because I dont have such information as for column "7. Genome file in which match was found".<br> <br> <br> I am working on NRSF files: <a moz-do-not-send="true" href="http://www.wip.ncbi.nlm.nih.gov/projects/geo/query/acc.cgi?acc=GSE13047">http://www.wip.ncbi.nlm.nih.gov/projects/geo/query/acc.cgi?acc=GSE13047</a><br> The files are in txt format like:<br> Uniq files: all tags has single alignments in the genome <br> <br> Column 1: tag sequence <br> Column 2: alignment score<br> Column 3: # of hit in the genome, 1 = unique hit<br> Column 4: Chr position<br> Column 5: Chr direction<br> Column 6: matched genome sequence<br> Column 7: next best possible alignment score<br> <br> <br> example:<br> <span style="font-family: courier new,monospace;">head -5 GSM327023_chipFC1592_uniq_hg17.txt</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">GCAGAGTAACCCGCCCCACCCCACC 10406 1 chr6:156964520 F GCAGAGTAACTCTCCCCACCCCACC 9359</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">TATTAAGGGATGATGGAAATTTATT 12500 1 chr15:51601146 F TATTAAGGGATGATGGAAATTTATT 9359</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">TTGGCTTTGCACAGTTGAGTCTTTT 10406 1 chr1:12326299 F TTGGCTTTGAAAAGTTGAGTCTTTT 9359</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">CTGGCTTTATCCCTGCTCTGCTCCG 10406 1 chr9:75499435 F CTGGCTTTATCCCTGCTCTCCTCCC 9359</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">AGAACGGTACACTCCCTACATTGTA 10406 1 chr1:193107861 F AGAACGGTACACTCCATAAATTGTA 9359</span><br> <br> <br> Or do you have another idea how I could proceed?<br> Thanks a lot!<br> dani<br> <br> <br> <br> <div class="gmail_quote">2010/11/16 Noboru Jo Sakabe <span dir="ltr"><<a moz-do-not-send="true" href="mailto:ns...@uc...">ns...@uc...</a>></span><br> <blockquote class="gmail_quote" style="border-left: 1px solid rgb(204, 204, 204); margin: 0pt 0pt 0pt 0.8ex; padding-left: 1ex;"> <div bgcolor="#ffffff" text="#000000"> Hi Sonja, try running each app individually and see if the error still occurs.<br> The ChIPSeq app is a wrapper to other apps. Maybe it will be easier for you to debug the problem if you run step by step.<br> You can find info on how to run each individual app in the USeq webpage.<br> Hope this helps.<br> <br> <br> <br> Sonja Althammer wrote: <blockquote type="cite"> <div> <div class="h5">Hello!<br> I am a new user and I am not very familiar with Java... However I would like to use Useq on Chip-Seq data...<br> My command fails and I dont know why.<br> Can s.o. help? <br> I paste my command and error message below!<br> <br> thanks!<br> dani<br> <br> <br> <span style="font-family: courier new,monospace;">java -Xmx2G -jar /home/daniela/USeq_7.2/Apps/ChIPSeq -y eland -v H_sapiens_May_2004 -r /soft/bin/R -t /home/daniela/otherDatasets/NRSF/ChIP-Seq/allChip/ -c /home/daniela/otherDatasets/NRSF/ChIP-Seq/allMock/ -s /home/daniela/test_useq</span><br style="font-family: courier new,monospace;"> <br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">Checking parameters...</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Results directory = /home/daniela/test_useq</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Window filter file = null</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Alignment type = eland</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Maximum alignment score = 60.0</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Minimum mapping quality score = 13.0</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Genome version = H_sapiens_May_2004</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Treatment replica directories:</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> /home/daniela/otherDatasets/NRSF/ChIP-Seq/allChip</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Control replica directories:</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> /home/daniela/otherDatasets/NRSF/ChIP-Seq/allMock</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Convert bar graph files to useq format = false</span><br style="font-family: courier new,monospace;"> <br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">Notes: Your save results directory exits, may overwrite the files within.</span><br style="font-family: courier new,monospace;"> <br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">*******************************************************************************</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">Parsing PointData from raw alignments...</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> PointData directory exists, skipping parsing and using files within. Delete it to reprocess.</span><br style="font-family: courier new,monospace;"> <br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">*******************************************************************************</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">Filtering PointData for duplicate reads (same strand and start position)...</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> DupFiltPointData directory exists, skipping filtering. Delete it to reprocess.</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">Exception in thread "main" java.lang.NullPointerException</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> at edu.utah.seq.analysis.ChIPSeq.filterDuplicates(ChIPSeq.java:223)</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> at edu.utah.seq.analysis.ChIPSeq.<init>(ChIPSeq.java:74)</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> at edu.utah.seq.analysis.ChIPSeq.main(ChIPSeq.java:408)</span><br style="font-family: courier new,monospace;"> <br> </div> </div> <pre><hr size="4" width="90%"> ------------------------------------------------------------------------------ Beautiful is writing same markup. Internet Explorer 9 supports standards for HTML5, CSS3, SVG 1.1, ECMAScript5, and DOM L2 & L3. Spend less time writing and rewriting code and more time creating great experiences on the web. Be a part of the beta today <a moz-do-not-send="true" href="http://p.sf.net/sfu/msIE9-sfdev2dev" target="_blank">http://p.sf.net/sfu/msIE9-sfdev2dev</a></pre> <pre><hr size="4" width="90%"> _______________________________________________ Useq-users mailing list <a moz-do-not-send="true" href="mailto:Use...@li..." target="_blank">Use...@li...</a> <a moz-do-not-send="true" href="https://lists.sourceforge.net/lists/listinfo/useq-users" target="_blank">https://lists.sourceforge.net/lists/listinfo/useq-users</a> </pre> </blockquote> <br> </div> </blockquote> </div> <br> </blockquote> <br> </body> </html> |
|
From: Sonja A. <son...@go...> - 2010-11-16 15:36:24
|
Hello!
I am a new user and I am not very familiar with Java... However I would like
to use Useq on Chip-Seq data...
My command fails and I dont know why.
Can s.o. help?
I paste my command and error message below!
thanks!
dani
java -Xmx2G -jar /home/daniela/USeq_7.2/Apps/ChIPSeq -y eland -v
H_sapiens_May_2004 -r /soft/bin/R -t
/home/daniela/otherDatasets/NRSF/ChIP-Seq/allChip/ -c
/home/daniela/otherDatasets/NRSF/ChIP-Seq/allMock/ -s
/home/daniela/test_useq
Checking parameters...
Results directory = /home/daniela/test_useq
Window filter file = null
Alignment type = eland
Maximum alignment score = 60.0
Minimum mapping quality score = 13.0
Genome version = H_sapiens_May_2004
Treatment replica directories:
/home/daniela/otherDatasets/NRSF/ChIP-Seq/allChip
Control replica directories:
/home/daniela/otherDatasets/NRSF/ChIP-Seq/allMock
Convert bar graph files to useq format = false
Notes: Your save results directory exits, may overwrite the files within.
*******************************************************************************
Parsing PointData from raw alignments...
PointData directory exists, skipping parsing and using files
within. Delete it to reprocess.
*******************************************************************************
Filtering PointData for duplicate reads (same strand and start position)...
DupFiltPointData directory exists, skipping filtering. Delete it to
reprocess.
Exception in thread "main" java.lang.NullPointerException
at edu.utah.seq.analysis.ChIPSeq.filterDuplicates(ChIPSeq.java:223)
at edu.utah.seq.analysis.ChIPSeq.<init>(ChIPSeq.java:74)
at edu.utah.seq.analysis.ChIPSeq.main(ChIPSeq.java:408)
|
|
From: David N. <Dav...@hc...> - 2010-10-05 15:03:59
|
Hello Folks, Here is likely to be an excellent seminar on RNA-Seq analysis put on by Partek this Thursday. (PI's please forward this email to lab members likely to be involved in next generation sequencing analysis.) After reviewing several commercial software packages (GeneSifter/Geospiza, CLC Bio, and DNAStar) we purchased a 1 year license for Partek's Genomic Suite for the U of U Bioinformatics Shared Resource. It was by far the most useful and statistically rigorous of the GUI based analysis packages. This is installed on our Big Mac workstation. Feel free to come use it for chIP-seq, RNA-seq, and resequencing variant analysis. -cheers, David -- David Austin Nix, PhD | Bioinformatics Shared Resource | Huntsman Cancer Institute | 2000 Circle of Hope | SLC, UT 84112 | Rm: 3165 | Vc: 801.587.4611 | Fx: 801.585.6458 | dav...@hc... | Skype/iChat: LiveNix | WebSite: http://bioserver.hci.utah.edu | DAS/2: http://bioserver.hci.utah.edu:8080/DAS2DB/genome ------ Forwarded Message From: Partek Workshops <wor...@pa...> Date: Thu, 23 Sep 2010 15:45:40 -0600 To: David Nix <dav...@hc...> Subject: Whole Transcriptome Analysis of Illumina RNA-Seq Data Webinar [cid:3369113952_6363969] Partek Inc. Presents an Informative and Educational Complimentary Streaming Audio Webinar Whole Transcriptome Analysis of Illumina RNA-Seq Data Broadcast Date: Thursday, October 7, 2010 Who should attend? This webinar is designed for scientists with interest in RNA-Seq research. The concepts discussed will be relevant to seasoned veterans and novices alike. The presentation will outline the broadest range of RNA-Seq data analysis aspects available today in Partek® Genomics Suite(tm). Key Learning Points: 1. Announcement of upcoming Partek Web Tools for data alignment 2. Overview of the RNA-Seq Workflow (including Alternative Splicing, Differential Expression, cSNP Discovery, Allele Specific Expression and more) 3. Introduction to Statistical Analysis, PCA & Clustering 4. Data Visualization & Biological Interpretation with Gene Ontologies and Pathways 5. Examples of RNA-Seq Data Integration with microarray data, methylation and ChIP-Seq data Session 1: Local times: 2:30 PM GMT (London) / 3:30 PM CET (Paris) / 9:30 AM EST (New York) Register for session 1: https://www2.gotomeeting.com/register/494209018 OR Session 2: Local times: 12:00pm PST (San Francisco) / 2:00pm CDT (Chicago) / 3:00pm EDT (New York) Register for session 2: https://www2.gotomeeting.com/register/773191906 Note: Saving the calendar attachment that came with this email will add the session to your Outlook or iCal calendar; however, to register, you must follow the link above for the session you want to attend. Saving the calendar attachment does not register you for the session. A live Q&A session will follow the presentation. Feel welcome to spread this information further! We look forward to your participation! The Partek Team This email was sent by: Partek Inc. 12747 Olive Blvd, Suite 205, St. Louis, MO 63141 USA Phone: 314-878-2329 * Fax: 314-275-8453 To unsubscribe from Webinar invitations, go to http://www.partek.com/html/unsubscribe/Unsubscribe.html <http://www.partek.com/html/unsubscribe/Unsubscribe.html> . ------ End of Forwarded Message |
|
From: Xueguang S. <xs...@zy...> - 2010-10-05 00:48:27
|
Any one can tell me how to generate the repeatmask.bed file. Thanks. |
|
From: David N. <Dav...@hc...> - 2010-09-29 11:41:48
|
Hello Kathrin, Looks like that zip file is corrupted. Try uncompressing it or testing the archive with "unzip -t chrY_-_.bar.zip" . If those fail then try rerunning the Tag2Point. -cheers, D -- David Austin Nix, PhD | Bioinformatics Shared Resource | Huntsman Cancer Institute | 2000 Circle of Hope | SLC, UT 84112 | Rm: 3165 | Vc: 801.587.4611 | Fx: 801.585.6458 | dav...@hc... | Skype/iChat: LiveNix | WebSite: http://bioserver.hci.utah.edu | DAS/2: http://bioserver.hci.utah.edu:8080/DAS2DB/genome On 9/29/10 5:26 AM, "Kathrin Poos" <kp...@un...> wrote: > Hi David > > thanks for the great applications provided by USeq. > > I'am analyzing some CHIP-seq data using USeq and by running the > 'MultipleReplicaScanSeqs' script I got some error messages, even by > using 'ScanSeqs' those messages appear :( > The functions cannot read-in the chrY_-_.bar.zip files from the control > data, I generated the point data files with 'Tag2Point'. By swapping the > treatment and the control directories the same error occurs. > > Additionaly, I got a java.io.FileNotFoundException and an 'R has a > problem in estimating the binomial P values' error that might be > consequences of the former one!?! > > Do you have an idea for solving my problem? > > Thanks in advance > Kathrin > > Code example: > > kathrin@server:$ java -Xmx4G -jar <pathToUSeq>/Apps/ScanSeqs -t > <pathOfTreatment> -c <pathOfInput> -s <pathOfResults> -p 100 -w 250 > > Arguments: -t <pathOfTreatment> -c <pathOfInput> -s <pathOfResults> > -p 100 -w 250 > > Scanning for enriched regions... > 2 Minium number reads in window > 100 Peak shift > 250 Window size > Calculating read count stats and binomial p-value look up tables... > 20449873 Treatment Observations > Cannot read <pathOfInput>/chrY_-_.bar.zip > java.util.zip.ZipException: error in opening zip file > at java.util.zip.ZipFile.open(Native Method) > at java.util.zip.ZipFile.<init>(ZipFile.java:131) > at java.util.zip.ZipFile.<init>(ZipFile.java:148) > at edu.utah.seq.parsers.BarParser.loadSimpleBarFile(BarParser.java:161) > at edu.utah.seq.parsers.BarParser.readBarFile(BarParser.java:141) > at edu.utah.seq.data.PointData.<init>(PointData.java:38) > at > edu.utah.seq.data.PointData.fetchStrandedPointDataNoMerge(PointData.java:1277) > at > edu.utah.seq.analysis.ScanSeqs.calculateReadCountStatistics(ScanSeqs.java:931) > at edu.utah.seq.analysis.ScanSeqs.scan(ScanSeqs.java:119) > at edu.utah.seq.analysis.ScanSeqs.<init>(ScanSeqs.java:107) > at edu.utah.seq.analysis.ScanSeqs.main(ScanSeqs.java:1307) > 17026011 Control Observations > java.io.FileNotFoundException: <pathOfResults>/3C6G8Q_Scores.txt > (Operation not permitted) > at java.io.FileOutputStream.open(Native Method) > at java.io.FileOutputStream.<init>(FileOutputStream.java:209) > at java.io.FileOutputStream.<init>(FileOutputStream.java:160) > at java.io.FileWriter.<init>(FileWriter.java:90) > at util.gen.Num.binomialPValues(Num.java:623) > at util.gen.Num.binomialPValMatrix(Num.java:749) > at > edu.utah.seq.analysis.ScanSeqs.calculateReadCountStatistics(ScanSeqs.java:947) > at edu.utah.seq.analysis.ScanSeqs.scan(ScanSeqs.java:119) > at edu.utah.seq.analysis.ScanSeqs.<init>(ScanSeqs.java:107) > at edu.utah.seq.analysis.ScanSeqs.main(ScanSeqs.java:1307) > > Problem with estimating binomial pvalues in R. > |
|
From: Kathrin P. <kp...@un...> - 2010-09-29 11:26:29
|
Hi David thanks for the great applications provided by USeq. I'am analyzing some CHIP-seq data using USeq and by running the 'MultipleReplicaScanSeqs' script I got some error messages, even by using 'ScanSeqs' those messages appear :( The functions cannot read-in the chrY_-_.bar.zip files from the control data, I generated the point data files with 'Tag2Point'. By swapping the treatment and the control directories the same error occurs. Additionaly, I got a java.io.FileNotFoundException and an 'R has a problem in estimating the binomial P values' error that might be consequences of the former one!?! Do you have an idea for solving my problem? Thanks in advance Kathrin Code example: kathrin@server:$ java -Xmx4G -jar <pathToUSeq>/Apps/ScanSeqs -t <pathOfTreatment> -c <pathOfInput> -s <pathOfResults> -p 100 -w 250 Arguments: -t <pathOfTreatment> -c <pathOfInput> -s <pathOfResults> -p 100 -w 250 Scanning for enriched regions... 2 Minium number reads in window 100 Peak shift 250 Window size Calculating read count stats and binomial p-value look up tables... 20449873 Treatment Observations Cannot read <pathOfInput>/chrY_-_.bar.zip java.util.zip.ZipException: error in opening zip file at java.util.zip.ZipFile.open(Native Method) at java.util.zip.ZipFile.<init>(ZipFile.java:131) at java.util.zip.ZipFile.<init>(ZipFile.java:148) at edu.utah.seq.parsers.BarParser.loadSimpleBarFile(BarParser.java:161) at edu.utah.seq.parsers.BarParser.readBarFile(BarParser.java:141) at edu.utah.seq.data.PointData.<init>(PointData.java:38) at edu.utah.seq.data.PointData.fetchStrandedPointDataNoMerge(PointData.java:1277) at edu.utah.seq.analysis.ScanSeqs.calculateReadCountStatistics(ScanSeqs.java:931) at edu.utah.seq.analysis.ScanSeqs.scan(ScanSeqs.java:119) at edu.utah.seq.analysis.ScanSeqs.<init>(ScanSeqs.java:107) at edu.utah.seq.analysis.ScanSeqs.main(ScanSeqs.java:1307) 17026011 Control Observations java.io.FileNotFoundException: <pathOfResults>/3C6G8Q_Scores.txt (Operation not permitted) at java.io.FileOutputStream.open(Native Method) at java.io.FileOutputStream.<init>(FileOutputStream.java:209) at java.io.FileOutputStream.<init>(FileOutputStream.java:160) at java.io.FileWriter.<init>(FileWriter.java:90) at util.gen.Num.binomialPValues(Num.java:623) at util.gen.Num.binomialPValMatrix(Num.java:749) at edu.utah.seq.analysis.ScanSeqs.calculateReadCountStatistics(ScanSeqs.java:947) at edu.utah.seq.analysis.ScanSeqs.scan(ScanSeqs.java:119) at edu.utah.seq.analysis.ScanSeqs.<init>(ScanSeqs.java:107) at edu.utah.seq.analysis.ScanSeqs.main(ScanSeqs.java:1307) Problem with estimating binomial pvalues in R. -- MSc Kathrin Poos Institute of Bioinformatics Muenster University Medical Center Niels-Stensen Str 12 48149 Muenster Germany Phone +49-251-83-50 004 Fax +49-251-83-53 005 email kp...@un... http://bioinformatics.uni-muenster.de/ |
|
From: David N. <dav...@gm...> - 2010-09-26 13:25:08
|
Hello Zeynep, No that is correct. The checker returns null or a non empty error message when things go wrong. I suspect that R is not aware of the environmental variables in your .bashrc when called from java. It¹s as if these don¹t exist. I recommend you install a local copy of R in your home directory and then load the libraries into that local copy. Alternatively, get someone with root access to install DESeq into the global R. To test if this is working, comment out your R_HOME and R_LIBS and launch R and type the library(DESeq). The thing that is puzzling to me is the : > WARNING: ignoring environment value of R_HOME This says that R did see your R_HOME upon launch but is ignoring it. Weird! -cheers, D -- David Austin Nix, PhD | Bioinformatics Shared Resource | Huntsman Cancer Institute | 2000 Circle of Hope | SLC, UT 84112 | Rm: 3165 | Vc: 801.587.4611 | Fx: 801.585.6458 | dav...@hc... | Skype/iChat: LiveNix | WebSite: http://bioserver.hci.utah.edu | DAS/2: http://bioserver.hci.utah.edu:8080/DAS2DB/genome On 9/25/10 5:46 PM, "Zeynep Hulya Gumus" <zey...@gm...> wrote: > Hi > > It looks like in the sourcecode for ChIPSeq.java, there may be a bug that > causes the error I described in my previous email: I highlighted how this can > be changed to fix the error message with ***: > > else { > String errors = > IO.runRCommandLookForError("library(DESeq)", rApplication, resultsDirectory); > *** Do you mean errors != null (instead of > errors==null)? *** > if (errors == null || errors.length() !=0){ > passed = false; > notes.append("\nError: Cannot find the > required R library. Did you install DESeq " + > > "(http://www-huber.embl.de/users/anders/DESeq/)? See the author's websites > for installation instructions. Once installed, " + > "launch an R terminal and type > 'library(DESeq)' to see if it is present. Error > message:\n\t\t"+errors+"\n\n"); > } > } > > > However, I don't know how to re-compile this within the application and make > it into the jar ChIPseq. Help would be appreciated! Thank you! - Z > > > > > > On Sat, Sep 25, 2010 at 3:37 PM, Zeynep Hulya Gumus <zey...@gm...> > wrote: >> > Hi >> > >> > I've installed USeq and also DESeq. When I open R in my local >> > directory, and library(DESeq), I see that it is there. >> > Now, when I try to run ChIPSeq, I get the following error: >> > >> > mimi@panda TEST_MIMI $ java -Xmx2G -jar ../ChIPSeq -y sam -v >> > M_musculus_Jul_2007 -t ../../../MOUSE_SEQ/TRT_H3K4me/ -c >> > ../../../MOUSE_SEQ/TRT_Input/ -r >> > /softlib/exe/x86_64/pkg/R/2.11.1/gcc_64/bin/R -s TEST >> > >> > Checking parameters... >> > WARNING: ignoring environment value of R_HOME >> > >> > The following problems were encountered when processing your parameter >> > file. Correct and restart. -> >> > >> > Error: Cannot find the required R library. Did you install DESeq >> > (http://www-huber.embl.de/users/anders/DESeq/)? See the author's >> > websites for installation instructions. Once installed, launch an R >> > terminal and type 'library(DESeq)' to see if it is present. Error >> > message: >> > null >> > >> > --- >> > I am running it in a linux cluster, where R.11.1 is installed >> > globally. However, I install the libraries locally, such that my >> > .bashrc file is: >> > >> > # to install R: >> > export R_HOME=/softlib/exe/x86_64/pkg/R/2.11.1/gcc_64 >> > export PATH=$R_HOME/bin${PATH+:$PATH} >> > export R_LIBS=/panda_scratch_homes002/mimi/.R/mylibrary >> > >> > How can I make ChIPSeq correctly? Is this a problem with my paths in >> > .bashrc (note that it works when I open R in the command line)? >> > ChIPSeq seems to go to the global network library as opposed to >> > mylibrary in my local folders. >> > >> > Thank you for your help! >> > - Z >> > > > > > > ------------------------------------------------------------------------------ > Start uncovering the many advantages of virtual appliances > and start using them to simplify application deployment and > accelerate your shift to cloud computing. > http://p.sf.net/sfu/novell-sfdev2dev > > _______________________________________________ > Useq-users mailing list > Use...@li... > https://lists.sourceforge.net/lists/listinfo/useq-users |
|
From: Zeynep H. G. <zey...@gm...> - 2010-09-25 23:46:37
|
Hi
It looks like in the sourcecode for ChIPSeq.java, there may be a bug that
causes the error I described in my previous email: I highlighted how this
can be changed to fix the error message with* ***:*
else {
String errors =
IO.runRCommandLookForError("library(DESeq)", rApplication,
resultsDirectory);
**** Do you mean errors != null (instead of
errors==null)? ****
if (errors == null || errors.length() !=0){
passed = false;
notes.append("\nError: Cannot find the
required R library. Did you install DESeq " +
"(
http://www-huber.embl.de/users/anders/DESeq/)? See the author's websites
for installation instructions. Once installed, " +
"launch an R terminal and
type 'library(DESeq)' to see if it is present. Error
message:\n\t\t"+errors+"\n\n");
}
}
However, I don't know how to re-compile this within the application and make
it into the jar ChIPseq. Help would be appreciated! Thank you! - Z
On Sat, Sep 25, 2010 at 3:37 PM, Zeynep Hulya Gumus <zey...@gm...>
wrote:
> Hi
>
> I've installed USeq and also DESeq. When I open R in my local
> directory, and library(DESeq), I see that it is there.
> Now, when I try to run ChIPSeq, I get the following error:
>
> mimi@panda TEST_MIMI $ java -Xmx2G -jar ../ChIPSeq -y sam -v
> M_musculus_Jul_2007 -t ../../../MOUSE_SEQ/TRT_H3K4me/ -c
> ../../../MOUSE_SEQ/TRT_Input/ -r
> /softlib/exe/x86_64/pkg/R/2.11.1/gcc_64/bin/R -s TEST
>
> Checking parameters...
> WARNING: ignoring environment value of R_HOME
>
> The following problems were encountered when processing your parameter
> file. Correct and restart. ->
>
> Error: Cannot find the required R library. Did you install DESeq
> (http://www-huber.embl.de/users/anders/DESeq/)? See the author's
> websites for installation instructions. Once installed, launch an R
> terminal and type 'library(DESeq)' to see if it is present. Error
> message:
> null
>
> ---
> I am running it in a linux cluster, where R.11.1 is installed
> globally. However, I install the libraries locally, such that my
> .bashrc file is:
>
> # to install R:
> export R_HOME=/softlib/exe/x86_64/pkg/R/2.11.1/gcc_64
> export PATH=$R_HOME/bin${PATH+:$PATH}
> export R_LIBS=/panda_scratch_homes002/mimi/.R/mylibrary
>
> How can I make ChIPSeq correctly? Is this a problem with my paths in
> .bashrc (note that it works when I open R in the command line)?
> ChIPSeq seems to go to the global network library as opposed to
> mylibrary in my local folders.
>
> Thank you for your help!
> - Z
>
|
|
From: Zeynep H. G. <zey...@gm...> - 2010-09-25 19:37:19
|
Hi I've installed USeq and also DESeq. When I open R in my local directory, and library(DESeq), I see that it is there. Now, when I try to run ChIPSeq, I get the following error: mimi@panda TEST_MIMI $ java -Xmx2G -jar ../ChIPSeq -y sam -v M_musculus_Jul_2007 -t ../../../MOUSE_SEQ/TRT_H3K4me/ -c ../../../MOUSE_SEQ/TRT_Input/ -r /softlib/exe/x86_64/pkg/R/2.11.1/gcc_64/bin/R -s TEST Checking parameters... WARNING: ignoring environment value of R_HOME The following problems were encountered when processing your parameter file. Correct and restart. -> Error: Cannot find the required R library. Did you install DESeq (http://www-huber.embl.de/users/anders/DESeq/)? See the author's websites for installation instructions. Once installed, launch an R terminal and type 'library(DESeq)' to see if it is present. Error message: null --- I am running it in a linux cluster, where R.11.1 is installed globally. However, I install the libraries locally, such that my .bashrc file is: # to install R: export R_HOME=/softlib/exe/x86_64/pkg/R/2.11.1/gcc_64 export PATH=$R_HOME/bin${PATH+:$PATH} export R_LIBS=/panda_scratch_homes002/mimi/.R/mylibrary How can I make ChIPSeq correctly? Is this a problem with my paths in .bashrc (note that it works when I open R in the command line)? ChIPSeq seems to go to the global network library as opposed to mylibrary in my local folders. Thank you for your help! - Z |
|
From: David N. <Dav...@hc...> - 2010-08-24 21:48:41
|
Hmm, yes, the junction would flow into an adjacent exon if the intron were very short. Basically this app just uses the genomic sequence and cuts a piece out of sequence surrounding a exon/intron junction. You raise a good point though. To be entirely thorough, one should pad short exons with other exonic sequence, the problem is the combinatorial number of junctions increases exponentially. Let me think how best to implement this. -cheers, David On 8/24/10 1:41 PM, "Middha, Sumit" <Mid...@ma...> wrote: Dear David, Thanks for sharing the set of very useful utilities with useq. I am working with creating splice junctions from an exon definition file and have a question about exons smaller than the specified radius. It seems useq includes the intron sequence to make up the required length of junction file, rather than following over to the next exon in line. Could you comment on that? The small exon is in bold, and the followed up intron sequence in red... >chr1_1218951_1224587 (exon length(1224587 to 1224599)=12bp) GCCAGGGCGCCCGGGGGACCAGGGGCAGCCTCGGCCTCGCGCATTTCCTCCGCCATGCGCGCCAGACGGAGCCTGCAGCAGCGTCTGGAGGGCCGGAGCAGGAGGGGGTAGGGGGAGAAAGCCAGTGAGTGACGGCTGCCAACT exon (1225073 to 1225148) to the right of the 12bp exon CCGCTGCTGGATGGCGGCGTGCTTTCGCTCCATCTCACGCTTTTCCACCGCAGAGTCGATCACCAGCTGGTCCAGC Thanks, Sumit |
|
From: David N. <Dav...@hc...> - 2010-08-11 14:52:15
|
Sounds like you're trying to load up whole chromosomes of track data. Best to use a DAS2 server like GenoPub and serve slices. All browsers will choke when you load millions of data points. By default IGB starts with the whole of chr1 open, you should zoom into a small region, say by clicking one of the html links in the excel output from the EnrichedRegionMaker. Then load your data. Don't use the xxx.useq format for local file loading, use the xxx.bar files and only load the chromosome of interest after zooming in on a particular region. I haven't implemented sliced local file loading for xxx.useq in the latest IGB release, this is coming. If you like I can make you a trial account on our GenoPub DAS/2 server where you can upload data (after converting to xxx.useq format, see Bar2USeq) and then visualize slices in IGB. Let me know what university/ lab/ company your with , a phone contact number, etc. You can also install your own GenoPub server (recommended). See http://bioserver.hci.utah.edu/BioInfo/index.php/Software:DAS2 for details. I'd recommend using a 64bit computer with > 4G ram. IGB is, in my opinion, the best genome browser available, no other comes even close to matching it's sophistication and data manipulation tool set. I like UCSC for it's data not it's display or graph manipulation capabilities. That said, check out their wig, bigwig, and bigbed file formats. It's pretty easy to convert bar files to gr format (Bar2Gr) and then with a bit of parsing to make wig files that can then be converted to bigwig using UCSC's tools and visualized as custom tracks. -cheers, David -- David Austin Nix, PhD | Bioinformatics Shared Resource | Huntsman Cancer Institute | 2000 Circle of Hope | SLC, UT 84112 | Rm: 3165 | Vc: 801.587.4611 | Fx: 801.585.6458 | dav...@hc... | Skype/iChat: LiveNix | WebSite: http://bioserver.hci.utah.edu | DAS/2: http://bioserver.hci.utah.edu:8080/DAS2DB/genome On 8/11/10 2:39 AM, "Anuj Pahwa" <anu...@an...> wrote: Gday David, I have just been playing around with the useq suite of applications (particularly ChIPSeq) and am interested in the outputs that are generated from that application. I know that you can generate BAR files and USEQ format files which IGB can handle and you can also generate bed files which UCSC can handle. I tried using IGB, but on the machines that I am trying it on, it is painfully slow, extremely memory and cpu intensive and not really usable (I have tried it on a machine with 4GB of RAM). Have you experienced such difficulties in performance with IGB? And do you have any recommendations on how to proceed with using UCSC? (Bed files that are generated are too big - approximately 1.2GBs and uploading them is not really an option) Thanks for your help in advance, Best wishes, Anuj |
|
From: David N. <Dav...@hc...> - 2010-08-02 13:12:05
|
Hello Nicole, You're close, just provide to the EnrichedRegionMaker a score index and a score for the one sample scanned data. In this case use '-i 0 , -s 50' to use index zero (the sum of reads in the window) and 50 to select peaks that have 50 or more reads. I used to provide a poisson p-value based on a global lambda but it was so inaccurate as to be meaningless. I wouldn't recommend this approach though. Best to download an input sequencing sample as close to the tissue/ organism you can. There are 100's of false positives that will come up in your data without a control. Better yet use a second chIP sample under a different condition or a different time point as the control. -cheers, D -- David Austin Nix, PhD | Bioinformatics Shared Resource | Huntsman Cancer Institute | 2000 Circle of Hope | SLC, UT 84112 | Rm: 3165 | Vc: 801.587.4611 | Fx: 801.585.6458 | dav...@hc... | Skype/iChat: LiveNix | WebSite: http://bioserver.hci.utah.edu | DAS/2: http://bioserver.hci.utah.edu:8080/DAS2DB/genome On 8/2/10 3:34 AM, "Nicole Cheung" <ms...@ca...> wrote: Dear David, I am writing to ask if I can USeq to call peaks on my ChIP-seq data without input control? I followed the instructions and was able to run ScanSeqs without an input control data, which gave me 3 folders called "Sum", "Sum+" and "Sum-". However, I cannot work out a way to run EnrichedRegionMaker as it requires a score and a corresponding index. The examples use QValFDR, EmpFDR and Log2Ratio, but I don't think these are available in my case (without an input). Could you please give me some advices of what I can do to find enriched regions without using an input control data? Thank you very much in advance. Best regards, Nicole |
|
From: David N. <Dav...@hc...> - 2010-07-27 15:06:40
|
Hmm, looks like this is working to me. This is the typical DESeq startup, no errors. You actually want to use R64. I really need to post some test data for folks to play around with. See below for an email I sent regarding some simulated RNA-Seq data that might be helpful. -cheers, D ------ Forwarded Message From: David Nix <dav...@hc...> Date: Thu, 15 Jul 2010 08:53:32 -0600 To: Mariann Micsinai <mm...@ny...>, Jasreet Hundal <jh...@ge...> Conversation: Overdispersed multiple replica RNA-Seq dataset Subject: Overdispersed multiple replica RNA-Seq dataset Hello Mariann and Jasreet, It's been my intention to post another challenge to the Seqanswers forum but in this case just give the data and key and ask for submissions but I'm pretty much blown out of the water with analysis and programming requests and don't have time to put together the required documentation. http://bioserver.hci.utah.edu/TempFiles/OverDispersedRNASeqDataset.zip That said, this multiple replica overdispersed RNA-Seq dataset has proven quite helpful in sifting out which algorithms really work on more real world datasets. I've posted the data (novoalignments which can be converted to SAM format if you prefer using the free Novocraft novo2sam.pl utility), the key, a bit of documentation as well as a some powerpoint slides detailing my work with the data. If you use this data in a paper, please consider this a collaboration with the potential of authorship. It was a fair bit of work to put together, validate, and test this dataset. -cheers, David -- David Austin Nix, PhD | Bioinformatics Shared Resource | Huntsman Cancer Institute | 2000 Circle of Hope | SLC, UT 84112 | Rm: 3165 | Vc: 801.587.4611 | Fx: 801.585.6458 | dav...@hc... | Skype/iChat: LiveNix | WebSite: http://bioserver.hci.utah.edu | DAS/2: http://bioserver.hci.utah.edu:8080/DAS2DB/genome On 7/26/10 11:42 PM, "M H" <mhd...@gm...> wrote: Hi, I have installed all the dependencies but still I am getting the following error. > library(DESeq) Loading required package: Biobase Welcome to Bioconductor Vignettes contain introductory material. To view, type 'openVignette()'. To cite Bioconductor, see 'citation("Biobase")' and for packages 'citation(pkgname)'. Loading required package: locfit Loading required package: akima Loading required package: lattice locfit 1.5-6 2010-01-20 Is there any problem with R64 or how can this be figured out to start functioning. Your help in this regard will highly be appreciated. M. Hussain ________________________________ ------------------------------------------------------------------------------ The Palm PDK Hot Apps Program offers developers who use the Plug-In Development Kit to bring their C/C++ apps to Palm for a share of $1 Million in cash or HP Products. Visit us here for more details: http://ad.doubleclick.net/clk;226879339;13503038;l? http://clk.atdmt.com/CRS/go/247765532/direct/01/ ________________________________ _______________________________________________ Useq-users mailing list Use...@li... https://lists.sourceforge.net/lists/listinfo/useq-users |
|
From: David N. <Dav...@hc...> - 2010-07-27 15:00:02
|
Hello Xiao-yu, Let's see.... 1. Using the Tophat SAM file shouldn't be a problem. I assume it maps junction reads to a particular location in genomic coordinates. None the less I haven't tried it so to be safe realign your data using Bowtie and a Bowtie index that contains a chromosome of known junctions. The usage guide describes this in some detail, http://useq.sourceforge.net/usage.html . 2. Looks like DESeq didn't complete, it didn't produce an output file that USeq could read in. There should be several temporary files that were left in your save directory. These contain a big matrix files of raw data, the R shell script for executing R and an R output error file. Open the script and error log in a text editor and take a look at the messages. Also, try executing the shell script by copying and pasting each line into an R command line terminal. 3. If you like, de-identify your data and post it and I can give it a quick debugging. Check out the http://useq.sourceforge.net/outputFileTypeDescriptions.html link, most of the results folders are named after the application that generated them so check out the usage docs manual processing sections for what is to be expected. http://useq.sourceforge.net/usage.html -cheers, D -- David Austin Nix, PhD | Bioinformatics Shared Resource | Huntsman Cancer Institute | 2000 Circle of Hope | SLC, UT 84112 | Rm: 3165 | Vc: 801.587.4611 | Fx: 801.585.6458 | dav...@hc... | Skype/iChat: LiveNix | WebSite: http://bioserver.hci.utah.edu | DAS/2: http://bioserver.hci.utah.edu:8080/DAS2DB/genome On 7/27/10 8:14 AM, "Liu, Xiaoyu (Xiao-Yu)" <Liu...@ma...> wrote: Hello David, This is Xiao-yu Liu from the Mayo Clinic. I am starting to experiment with mRNA-seq tools and got interested in Useq based on my colleagues recommandation. I run into a few questions and wondering if you could help me with. 1. when providing raw alignment to Useq, is there any drawbacks if I use the SAM file made by Tophat? ( I belive it contains the alignment at junctions) 2. I had an exception when calculating negative binomial p-values: .......................................................... Calculating negative binomial p-values and FDRs in R using DESeq (http://www-huber.embl.de/users/anders/DESeq/)... java.io.IOException: R results file doesn't exist. Check temp files in save directory for error. at edu.utah.seq.analysis.MultipleReplicaDefinedRegionScanSeqs.executeDESeq( MultipleReplicaDefinedRegionScanSeqs.java:318) at edu.utah.seq.analysis.MultipleReplicaDefinedRegionScanSeqs.calculateDESe qPValues(MultipleReplicaDefinedRegionScanSeqs.java:434) at edu.utah.seq.analysis.MultipleReplicaDefinedRegionScanSeqs.run(MultipleR eplicaDefinedRegionScanSeqs.java:124) at edu.utah.seq.analysis.MultipleReplicaDefinedRegionScanSeqs.<init>(Multip leReplicaDefinedRegionScanSeqs.java:85) at edu.utah.seq.analysis.RNASeq.definedRegionScanSeqs(RNASeq.java:152) at edu.utah.seq.analysis.RNASeq.<init>(RNASeq.java:90) at edu.utah.seq.analysis.RNASeq.main(RNASeq.java:482) Do you know what's the possible causes? Could you help me to find a way to avoid it? 3. I still got some results from the run. There are quite a few folders/files in the output directory. Do you have a documentation explain how to read/understand them. The doc probably is somewhere online, but I have not find it yet. Thanks! Xiao-yu Liu, Ph.D. Informatic Specialist Mayo Clinic 507 284-8728 |
|
From: M H <mhd...@gm...> - 2010-07-27 05:42:56
|
Hi,
I have installed all the dependencies but still I am getting the following
error.
> library(DESeq)
Loading required package: Biobase
Welcome to Bioconductor
Vignettes contain introductory material. To view, type
'openVignette()'. To cite Bioconductor, see
'citation("Biobase")' and for packages 'citation(pkgname)'.
Loading required package: locfit
Loading required package: akima
Loading required package: lattice
locfit 1.5-6 2010-01-20
Is there any problem with R64 or how can this be figured out to start
functioning. Your help in this regard will highly be appreciated.
M. Hussain
|
|
From: David N. <Dav...@hc...> - 2010-06-29 22:35:50
|
Hello Noboru, Thanks for pointing out that dataset, it's very interesting.... I'm seeing the same issue you are. ScanSeqs -> EnrichedRegionMaker -> 50K peaks! These look very real. A visual inspection shows lots of enrichment, maybe too much enrichment for DESeq. With the MultipleReplicaScanSeqs I don't get anything coming back from DESeq. The problem here is that DESeq really needs biological replicas to get an accurate estimation of the overdispersion in the count data. When no replicas are present, DESeq takes the treatment and control samples and treats them as replicas to estimate the variance. This works fine for typical chIp-seq samples where the number of peaks is relatively small. But when the number gets huge then DESeq thinks it's seeing huge overdispersion between the replicas and drastically down weights the pvalues. Hmm, no easy way to fix this. Would be good to add a catch to warn folks when the overdispersion factor gets too big. For now use the ScanSeqs results. Be sure to remove duplicate reads using the PointDataManipulator. I noticed they were 15%, a bit high. Also, in running the PeakShiftFinder, a window size of 350bp would be better, 100bp peak shift is fine. Lastly, there's a big standard deviation in the peak sizes. Again, this is likely do to the nature of H3K4Me1 marks, so would be good to increase the max gap permitted to say 500-1000 bp in the EnrichedRegionMaker. -cheers, D P.S. Hope you don't mind but I'm going to forward this to the useq-users forum. -- David Austin Nix, PhD | Director HCI Bioinformatics/ Co-Director UofU Bioinformatics Shared Resource | Huntsman Cancer Institute | 2000 Circle of Hope | SLC, UT 84112 | Rm: 3165 | Vc: 801.587.4611 | Fx: 801.585.6458 | dav...@hc... | Skype/iChat: LiveNix | WebSite: http://bioserver.hci.utah.edu | DAS/2: http://bioserver.hci.utah.edu:8080/DAS2DB/genome On 6/29/10 3:04 PM, "Noboru Jo Sakabe" <ns...@uc...> wrote: Hi David, I've been having problems with MultipleReplicaScanSeqs. I ran MACS and QuEST on a public data set and found tens of thousands of peaks with very low FDR. However, when I use MultipleReplicaScanSeqs, I don't get peaks. ScanSeqs works fine. I tried versions 6.4 and 6.6. Below's what I see on my screen, and I get nothing in my results directory (only a Temp... directory). These are the raw data I used: from NCBI GEO GSE19553 -> GSM487453: Input_DNA, GSM487452: H3K4me1.UT Hope this was helfpul in some way. noboru $ java -Xmx4500M -jar /programs/chip/USeq_6.6/Apps/MultipleReplicaScanSeqs -t ../../useq_pointData -c ../../../../input/useq_pointData -s ./results -p 100 -w 200 Arguments: -t ../../useq_pointData -c ../../../../input/useq_pointData -s ./results -p 100 -w 200 Calculating read count stats... 6100635 Treatment Observations 6058571 Control Observations 100 Peak shift 200 Window size 0.5 Minimum Window FDR Scanning chromosomes...... Skipping chrY. No windows found with minimum reads of 10 within a window size of 200 ............... Calculating negative binomial p-values and FDRs in R using DESeq (http://www-huber.embl.de/users/anders/DESeq/). This requires patience, 64bit R, and > 6-8G RAM... Parsing results... WARNING: No significant windows found?! FDR threshold is set to 0.5 . Try restarting with a less stringent threshold. Done! 6 min |
|
From: David N. <Dav...@hc...> - 2010-06-16 14:45:40
|
Hello Noboru, Duplicate reads need to be removed, they represent amplification/ fragmentation artifacts. If included in your analysis then the negative binomial p-values -> FDR statistics become inaccurate since they assume independent observations. (I'm assuming you're using the MultipleReplicaScanSeqs. This works even with no replica data. The old binomial based ScanSeqs is shortly going to be depreciated.) Clumpy data really plays havoc with this type of window based analysis. I suspect that the peaks you see without duplicate removal are actually present in the filtered data but just at a lower significance. The additional peaks are present because the duplicate reads threw the confidence estimation. I'd recommend using the filtered data and setting a lower threshold and accept the lower confidence. 75% unique is OK but typical chIP samples should be in the 80-90 range. Try increasing the amount of chIP DNA you provide for library construction through scale up for your next experiments -cheers, D -- David Austin Nix, PhD | Director HCI Bioinformatics/ Co-Director UofU Bioinformatics Shared Resource | Huntsman Cancer Institute | 2000 Circle of Hope | SLC, UT 84112 | Rm: 3165 | Vc: 801.587.4611 | Fx: 801.585.6458 | dav...@hc... | Skype/iChat: LiveNix | WebSite: http://bioserver.hci.utah.edu | DAS/2: http://bioserver.hci.utah.edu:8080/DAS2DB/genome On 6/15/10 4:30 PM, "Noboru Jo Sakabe" <ns...@uc...> wrote: Hi David, I'm using USeq 6.4 to call ChIP-seq peaks and for one TF sample, whether I filter for duplicate alignments or not makes a big difference, even though I don't have that many duplicates (75% is unique). The number of peaks before filtering is ~2500 and after filtering ~80. For PolII, the variation is not that high, ~70% of the number of peaks match between both runs. So I believe this reflects the quality of the sample, but I'm not sure exactly how. I would like to know if you've seen this behavior before, and what this could tell about the sample. Thank you. Noboru |
|
From: David N. <dav...@gm...> - 2010-05-25 13:46:34
|
------ Forwarded Message From: David Nix <dav...@hc...> Date: Tue, 25 May 2010 07:43:57 -0600 To: Ravi Alla <Rav...@hc...> Conversation: random chromosomes Subject: Re: random chromosomes You need a folder containing chromosome split files (chr1, chr2, chr3, ...). These represent regions that were possibly interrogated (sequenced) in your dataset where each file contains three tab delimited columns (chr start stop). The easiest way to make these is to pool all of your PointData into a hypothetical ³treatment² sample, run ScanSeqs on this sample using the peak shift and window size you used in your analysis, then run the EnrichedRegionMaker selecting enriched regions with 1 or more reads. You¹ll then need to parse the gff or egr file from the EnrichedRegionMaker using the PrintSelectColumns app to extract just the chr, start, and stop columns. Then split the parsed file by chromosome using a shell script. For example: ³for x in 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 X Y M; do echo chr$x; cat myParsedFile.txt | grep w chr$x > chr$x; done² -cheers, D On 5/24/10 4:46 PM, "Ravi Alla" <Rav...@hc...> wrote: > Hi David, > I was wondering how one would go about making a random chromosomes folder, to > use in IntersectRegions. I want to make one for mouse. > Thanks > Ravi > ------ End of Forwarded Message |
|
From: Jesse R. <jes...@u2...> - 2010-05-19 16:03:34
|
Hi - I tried the new wrapped RNASeq. The program ran pretty rapidly until it got to MRDRSS and now has taken 2 days and still running. I haven't run MRDRSS before, but when I run the original DRSS, it only takes a few minutes on our machine. Is it normal for MRDRSS to take significantly longer than DRSS? Also is there any way to run the new RNASeq on a single sample (it works with treatment and control, but not with just treatment). thanks, Jesse Rowley Post-Doctoral Research Fellow Andrew Weyrich Lab Eccles Institute of Human Genetics University of Utah |
|
From: David N. <dav...@gm...> - 2010-05-14 15:48:10
|
test2 after email change |
|
From: David N. <dav...@gm...> - 2010-05-14 15:40:51
|
test |
|
From: David N. <Dav...@hc...> - 2010-04-14 14:48:42
|
Testing. |