Menu
▾
▴
[Useq-users] SamTranscriptomeParser error
|
From: Desplat N. <cle...@ya...> - 2012-11-12 07:11:36
|
Hello, I analyse RNA-seq data and I use Novoalign protocol : http://www.novocraft.com/wiki/tiki-index.php?page=RNASeq+analysis%3A+mRNA+and+the+Spliceosome I have a problem with this step : "We now need to convert the splice junction coordinates back to genome coordinates using USeq SamTranscriptomeParser (external link) java -jar pathTo/USeq/USeq_8.4.4/Apps/SamTranscriptomeParser -f ./novo/alignments.sam -a 50000 -n 100 -u -s novo/alignments_Converted.sam #output is novo/alignments_Converted.sam.gz #Unmapped reads are saved with -u option in the same file in SAM format" When I run this command I get this message and the program stops. "USeq_8.4.4 Arguments: -n 100 -a 5000 -u -f Sample_F2_RNA_Seq_P1_alignments.sam -s Sample_F2_RNA_Seq_P1_alignments_converted.sam 5000.0 Maximum alignment score 0.0 Minimum mapping quality score 100 Maximum locations each read may align true Reverse the strand of the second paired alignemnt true Save unmapped and low score reads true Remove control chrPhiX and chrAdapter alignments false Randomly choose an alignment from read blocks that fail the max locations threshold Parsing, filtering, and merging SAM files... Sample_F2_RNA_Seq_P1_alignments.sam.............................................................................................Didn't find an intersecting chunk? for HISEQ9:202:D08DNACXX:4:1306:3933:11725 129 Chr7 81128509 1 16M1I77M2I5M Chr2 161017396 0 AAGATGGCTTGGGAGCAAAAGCTCCGCCAAGCTTGTCGAGCATCCAATGC TTGGGCACATTGAGCCTCTTCAAGTGCTTCTTCAATCCCCTAGCCTAGGAC 74688888888888788887876877888888777788988788889888898888789998888888888988788888888888888899887875232 PG:Z:novoalign AS:i :147 UQ:i:147 NM:i:5 ZS:Z:R ZN:i:5 NH:i:5 HI:i:1 IH:i:0 GN:Z:GRMZM2G542753 SJ:Z:Chr7:81128504-81128524_81128618-81128695_81128957-81128957_81139426-81139 523" Could you help me to understand this error? Thank you. Nelly |
