Menu
▾
▴
Re: [Useq-users] error message
|
From: Noboru Jo S. <ns...@uc...> - 2010-11-16 17:32:09
|
<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html> <head> <meta content="text/html;charset=ISO-8859-1" http-equiv="Content-Type"> </head> <body bgcolor="#ffffff" text="#000000"> Hi Sonja, I am sending our emails to the list, I replied your message, and unlike other mailing lists that I subscribe to, this one was sent only to your email.<br> Let's make sure we send to the list, so other users can benefit.<br> <br> Answering your question, the Tag2Point app converts .bed to USeq's format. I think it will be easier than assembling an eland file from what you have. For what I understand, you don't have qualities, so it won't matter anyway.<br> I never used this ChIPSeq app, it's something new. I wrote a bash script that allows me to go step by step. I might start using the app now, but I like the flexibility of the bash script, because I can see if everything is going well.<br> Also, I don't always use the PeakShiftFinder app, so I can bypass it in my script.<br> You just have to write the script once, anyway, so you might want to give it a try.<br> <br> noboru<br> <br> <br> Sonja Althammer wrote: <blockquote cite="mid:AAN...@ma..." type="cite">yes I have seen this and I found already my problem. my files are not really in eland format.<br> the wrapper doesnt work with bed-files, right?<br> As I have to run the program a lot of times I would like to make it run with one command...<br> <br> I checked which fields I need for eland format here:<br> <a moz-do-not-send="true" href="http://bioinfo.cgrb.oregonstate.edu/docs/solexa/Whole%20genome%20alignments%20using%20ELAND.html">http://bioinfo.cgrb.oregonstate.edu/docs/solexa/Whole%20genome%20alignments%20using%20ELAND.html</a><br> <br> Now I am trying to convert my files to eland. So maybe you can help me here: which columns are really required? Because I dont have such information as for column "7. Genome file in which match was found".<br> <br> <br> I am working on NRSF files: <a moz-do-not-send="true" href="http://www.wip.ncbi.nlm.nih.gov/projects/geo/query/acc.cgi?acc=GSE13047">http://www.wip.ncbi.nlm.nih.gov/projects/geo/query/acc.cgi?acc=GSE13047</a><br> The files are in txt format like:<br> Uniq files: all tags has single alignments in the genome <br> <br> Column 1: tag sequence <br> Column 2: alignment score<br> Column 3: # of hit in the genome, 1 = unique hit<br> Column 4: Chr position<br> Column 5: Chr direction<br> Column 6: matched genome sequence<br> Column 7: next best possible alignment score<br> <br> <br> example:<br> <span style="font-family: courier new,monospace;">head -5 GSM327023_chipFC1592_uniq_hg17.txt</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">GCAGAGTAACCCGCCCCACCCCACC 10406 1 chr6:156964520 F GCAGAGTAACTCTCCCCACCCCACC 9359</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">TATTAAGGGATGATGGAAATTTATT 12500 1 chr15:51601146 F TATTAAGGGATGATGGAAATTTATT 9359</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">TTGGCTTTGCACAGTTGAGTCTTTT 10406 1 chr1:12326299 F TTGGCTTTGAAAAGTTGAGTCTTTT 9359</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">CTGGCTTTATCCCTGCTCTGCTCCG 10406 1 chr9:75499435 F CTGGCTTTATCCCTGCTCTCCTCCC 9359</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">AGAACGGTACACTCCCTACATTGTA 10406 1 chr1:193107861 F AGAACGGTACACTCCATAAATTGTA 9359</span><br> <br> <br> Or do you have another idea how I could proceed?<br> Thanks a lot!<br> dani<br> <br> <br> <br> <div class="gmail_quote">2010/11/16 Noboru Jo Sakabe <span dir="ltr"><<a moz-do-not-send="true" href="mailto:ns...@uc...">ns...@uc...</a>></span><br> <blockquote class="gmail_quote" style="border-left: 1px solid rgb(204, 204, 204); margin: 0pt 0pt 0pt 0.8ex; padding-left: 1ex;"> <div bgcolor="#ffffff" text="#000000"> Hi Sonja, try running each app individually and see if the error still occurs.<br> The ChIPSeq app is a wrapper to other apps. Maybe it will be easier for you to debug the problem if you run step by step.<br> You can find info on how to run each individual app in the USeq webpage.<br> Hope this helps.<br> <br> <br> <br> Sonja Althammer wrote: <blockquote type="cite"> <div> <div class="h5">Hello!<br> I am a new user and I am not very familiar with Java... However I would like to use Useq on Chip-Seq data...<br> My command fails and I dont know why.<br> Can s.o. help? <br> I paste my command and error message below!<br> <br> thanks!<br> dani<br> <br> <br> <span style="font-family: courier new,monospace;">java -Xmx2G -jar /home/daniela/USeq_7.2/Apps/ChIPSeq -y eland -v H_sapiens_May_2004 -r /soft/bin/R -t /home/daniela/otherDatasets/NRSF/ChIP-Seq/allChip/ -c /home/daniela/otherDatasets/NRSF/ChIP-Seq/allMock/ -s /home/daniela/test_useq</span><br style="font-family: courier new,monospace;"> <br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">Checking parameters...</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Results directory = /home/daniela/test_useq</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Window filter file = null</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Alignment type = eland</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Maximum alignment score = 60.0</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Minimum mapping quality score = 13.0</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Genome version = H_sapiens_May_2004</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Treatment replica directories:</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> /home/daniela/otherDatasets/NRSF/ChIP-Seq/allChip</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Control replica directories:</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> /home/daniela/otherDatasets/NRSF/ChIP-Seq/allMock</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> Convert bar graph files to useq format = false</span><br style="font-family: courier new,monospace;"> <br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">Notes: Your save results directory exits, may overwrite the files within.</span><br style="font-family: courier new,monospace;"> <br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">*******************************************************************************</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">Parsing PointData from raw alignments...</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> PointData directory exists, skipping parsing and using files within. Delete it to reprocess.</span><br style="font-family: courier new,monospace;"> <br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">*******************************************************************************</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">Filtering PointData for duplicate reads (same strand and start position)...</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> DupFiltPointData directory exists, skipping filtering. Delete it to reprocess.</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;">Exception in thread "main" java.lang.NullPointerException</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> at edu.utah.seq.analysis.ChIPSeq.filterDuplicates(ChIPSeq.java:223)</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> at edu.utah.seq.analysis.ChIPSeq.<init>(ChIPSeq.java:74)</span><br style="font-family: courier new,monospace;"> <span style="font-family: courier new,monospace;"> at edu.utah.seq.analysis.ChIPSeq.main(ChIPSeq.java:408)</span><br style="font-family: courier new,monospace;"> <br> </div> </div> <pre><hr size="4" width="90%"> ------------------------------------------------------------------------------ Beautiful is writing same markup. Internet Explorer 9 supports standards for HTML5, CSS3, SVG 1.1, ECMAScript5, and DOM L2 & L3. Spend less time writing and rewriting code and more time creating great experiences on the web. Be a part of the beta today <a moz-do-not-send="true" href="http://p.sf.net/sfu/msIE9-sfdev2dev" target="_blank">http://p.sf.net/sfu/msIE9-sfdev2dev</a></pre> <pre><hr size="4" width="90%"> _______________________________________________ Useq-users mailing list <a moz-do-not-send="true" href="mailto:Use...@li..." target="_blank">Use...@li...</a> <a moz-do-not-send="true" href="https://lists.sourceforge.net/lists/listinfo/useq-users" target="_blank">https://lists.sourceforge.net/lists/listinfo/useq-users</a> </pre> </blockquote> <br> </div> </blockquote> </div> <br> </blockquote> <br> </body> </html> |
