Re: [Useq-users] Splice junctions file

[David N. <Dav...@hc...>]

Hmm, yes, the junction would flow into an adjacent exon if the intron were very short.  Basically this app just uses the genomic sequence and cuts a piece out of sequence surrounding a exon/intron junction.

You raise a good point though.  To be entirely thorough, one should pad short exons with other exonic sequence, the problem is the combinatorial number of junctions increases exponentially.  Let me think how best to implement this.

-cheers, David




On 8/24/10 1:41 PM, "Middha, Sumit" <Mid...@ma...> wrote:

Dear David,

Thanks for sharing the set of very useful utilities with useq.

I am working with creating splice junctions from an exon definition file and have a question about exons smaller than the specified radius. It seems useq includes the intron sequence to make up the required length of junction file, rather than following over to the next exon in line. Could you comment on that?

The small exon is in bold, and the followed up intron sequence in red...

>chr1_1218951_1224587 (exon length(1224587 to 1224599)=12bp)
GCCAGGGCGCCCGGGGGACCAGGGGCAGCCTCGGCCTCGCGCATTTCCTCCGCCATGCGCGCCAGACGGAGCCTGCAGCAGCGTCTGGAGGGCCGGAGCAGGAGGGGGTAGGGGGAGAAAGCCAGTGAGTGACGGCTGCCAACT

exon (1225073 to 1225148) to the right of the 12bp exon
CCGCTGCTGGATGGCGGCGTGCTTTCGCTCCATCTCACGCTTTTCCACCGCAGAGTCGATCACCAGCTGGTCCAGC

Thanks,
Sumit