Re: [Transdecoder-users] Transdecoder help: failure to output final .pep files

[Brian H. <bh...@br...>]

Excellent!  Thanks for the update!

~brian



On Tue, May 13, 2014 at 6:54 PM, Edward Gilding <e.g...@im...>wrote:

>  Hi Brian
>
>
>
> Thanks! That did the trick. It works like a charm now.
>
>
>
> -Ed
>
>
>
> Dr. Edward K Gilding
>
>
>
> The Institute of Molecular Biosciences
>
> The University of Queensland
>
> Brisbane, QLD 4072
>
> Australia
>
>
>
> O: +61 07 3346 2014
>
>
>
> *From:* Brian Haas [mailto:bh...@br...]
> *Sent:* Tuesday, 13 May 2014 1:27 AM
> *To:* Edward Gilding
> *Cc:* tra...@li...
> *Subject:* Re: [Transdecoder-users] Transdecoder help: failure to output
> final .pep files
>
>
>
> Hi Ed,
>
>
>
> It might be that the fasta header format of your transcripts file is
> incompatible with transdecoder.  Perhaps try creating a version of the file
> that has a simpler header format, such as by:
>
>
>
>    cat input.fasta | perl -lane 's/centroid=//; s/;.*//g; print;' >
> input.adj.fasta
>
>
>
> and running the input.adj.fasta through transdecoder.
>
>
>
> If it still fails, we can look into it further.
>
>
>
> best,
>
>
>
> ~brian
>
>
>
>
>
> On Sun, May 11, 2014 at 11:43 PM, Edward Gilding <e.g...@im...>
> wrote:
>
> Hello
>
>
>
> I’ve been trying to run Transdecoder with pfam searching on transcriptome
> assemblies that I made using Soapdenovo-Trans(SdT). With different
> assemblies and different PBS parameters (like where I place the data on our
> system’s parallel shared file system etc), Transdecoder creates the temp
> directory with some of the intermediate files. No finished output files are
> ever produced. Once I got the .dat file with the pfam hits for my assembly
> but there were no final .pep .gff3 .cds or .bed files produced and stored
> anywhere. Am I missing something?
>
>
>
> Unlike Trinity, SdT plugs in Ns if there is an expected gap between the
> fragments of a transcript. Could these Ns be tripping up Transdecoder?
>
>
>
> NOTES:
>
> My scripts load the modules our system operators made for Transdecoder and
> hmmer before sending commands for Transdecoder.
>
>
>
> These are example entries from my input fasta:
>
>
>
> >centroid=Fi49merScaf_11503;seqs=3;
>
>
> AACTAAGGGTTTGTTGCTTTTATCAGCGAAATATATTAATGTTTTTAAATTATAGTTGACAACTTTACCGATGAACTATTGAGGTACAGCTTTTTGGGAACATATAGTCTAGTGCCAAGTCCTTCTAGTGCTTTCACACACTCGGCAATACTCTCTTCACTATCAATGTCCATGTTCCAAATTGCCGC…
>
> >centroid=Fi49merScaf_29126;seqs=1;
>
>
> TTGGCTGAGAGAACTTACACAAGCCACTTATCGAGCTTCTGCCCCTCCGCCCATCAACATACTTGGAGAACTAAGCAATGATGTAGCGGAAACTGCTGAACCTAGAGCTGTAAATGCTAGGACAGCGGATCTTGTTGTTAATGGAACACTGATTGAGATGAAGTTATCATTATATGTGAAGG…
>
> centroid=Fi49merScaf_29118;seqs=1;
>
>
> CTGACATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCAAATAGACTGTACAGCATTATAGACAGGTACCTCACAGACTTAAAAAGCCCTTAAGACTGTTTTCCTGTAAAAGAATCTCCTTTTTTAACACAGAAATTATCTACAAAATCTAATTCGGAGACCACGGTGTTAACCAAATC…
>
>
>
>
>
> Thanks
>
> Ed
>
>
>
> Dr. Edward K Gilding
>
>
>
> The Institute of Molecular Biosciences
>
> The University of Queensland
>
> Brisbane, QLD 4072
>
> Australia
>
>
>
> O: +61 07 3346 2014
>
>
>
>
>
> ------------------------------------------------------------------------------
> "Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE
> Instantly run your Selenium tests across 300+ browser/OS combos.
> Get unparalleled scalability from the best Selenium testing platform
> available
> Simple to use. Nothing to install. Get started now for free."
> http://p.sf.net/sfu/SauceLabs
> _______________________________________________
> Transdecoder-users mailing list
> Tra...@li...
> https://lists.sourceforge.net/lists/listinfo/transdecoder-users
>
>
>
>
>
> --
> --
> Brian J. Haas
> The Broad Institute
> http://broad.mit.edu/~bhaas
>
>
>



-- 
--
Brian J. Haas
The Broad Institute
http://broad.mit.edu/~bhaas