Re: [Transdecoder-users] Transdecoder help: failure to output final .pep files

[Edward G. <e.g...@im...>]

Hi Brian

Thanks! That did the trick. It works like a charm now.

-Ed

Dr. Edward K Gilding

The Institute of Molecular Biosciences
The University of Queensland
Brisbane, QLD 4072
Australia

O: +61 07 3346 2014

From: Brian Haas [mailto:bh...@br...]
Sent: Tuesday, 13 May 2014 1:27 AM
To: Edward Gilding
Cc: tra...@li...
Subject: Re: [Transdecoder-users] Transdecoder help: failure to output final .pep files

Hi Ed,

It might be that the fasta header format of your transcripts file is incompatible with transdecoder.  Perhaps try creating a version of the file that has a simpler header format, such as by:

   cat input.fasta | perl -lane 's/centroid=//; s/;.*//g; print;' > input.adj.fasta

and running the input.adj.fasta through transdecoder.

If it still fails, we can look into it further.

best,

~brian


On Sun, May 11, 2014 at 11:43 PM, Edward Gilding <e.g...@im...<mailto:e.g...@im...>> wrote:
Hello

I’ve been trying to run Transdecoder with pfam searching on transcriptome assemblies that I made using Soapdenovo-Trans(SdT). With different assemblies and different PBS parameters (like where I place the data on our system’s parallel shared file system etc), Transdecoder creates the temp directory with some of the intermediate files. No finished output files are ever produced. Once I got the .dat file with the pfam hits for my assembly but there were no final .pep .gff3 .cds or .bed files produced and stored anywhere. Am I missing something?

Unlike Trinity, SdT plugs in Ns if there is an expected gap between the fragments of a transcript. Could these Ns be tripping up Transdecoder?

NOTES:
My scripts load the modules our system operators made for Transdecoder and hmmer before sending commands for Transdecoder.

These are example entries from my input fasta:

>centroid=Fi49merScaf_11503;seqs=3;
AACTAAGGGTTTGTTGCTTTTATCAGCGAAATATATTAATGTTTTTAAATTATAGTTGACAACTTTACCGATGAACTATTGAGGTACAGCTTTTTGGGAACATATAGTCTAGTGCCAAGTCCTTCTAGTGCTTTCACACACTCGGCAATACTCTCTTCACTATCAATGTCCATGTTCCAAATTGCCGC…
>centroid=Fi49merScaf_29126;seqs=1;
TTGGCTGAGAGAACTTACACAAGCCACTTATCGAGCTTCTGCCCCTCCGCCCATCAACATACTTGGAGAACTAAGCAATGATGTAGCGGAAACTGCTGAACCTAGAGCTGTAAATGCTAGGACAGCGGATCTTGTTGTTAATGGAACACTGATTGAGATGAAGTTATCATTATATGTGAAGG…
centroid=Fi49merScaf_29118;seqs=1;
CTGACATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCAAATAGACTGTACAGCATTATAGACAGGTACCTCACAGACTTAAAAAGCCCTTAAGACTGTTTTCCTGTAAAAGAATCTCCTTTTTTAACACAGAAATTATCTACAAAATCTAATTCGGAGACCACGGTGTTAACCAAATC…


Thanks
Ed

Dr. Edward K Gilding

The Institute of Molecular Biosciences
The University of Queensland
Brisbane, QLD 4072
Australia

O: +61 07 3346 2014<tel:%2B61%2007%203346%202014>


------------------------------------------------------------------------------
"Accelerate Dev Cycles with Automated Cross-Browser Testing - For FREE
Instantly run your Selenium tests across 300+ browser/OS combos.
Get unparalleled scalability from the best Selenium testing platform available
Simple to use. Nothing to install. Get started now for free."
http://p.sf.net/sfu/SauceLabs
_______________________________________________
Transdecoder-users mailing list
Tra...@li...<mailto:Tra...@li...>
https://lists.sourceforge.net/lists/listinfo/transdecoder-users



--
--
Brian J. Haas
The Broad Institute
http://broad.mit.edu/~bhaas