Thread: [svtoolkit-help] Left read of read pair fails left read test
Status: Beta
Brought to you by:
bhandsaker
Menu
▾
▴
svtoolkit-help
|
From: Philine F. <p.f...@un...> - 2011-06-22 12:14:28
|
Hi,
I am trying to run SVDiscovery on a non human data set (stickleback illumina paired end data).
The installation test was successful and the bam files I am using are also already run through the GATK framework.
The preprocessing of the reads also works but the SVDiscovery always fails with following error message:
Left read of read pair fails left read test
I attach the stack trace below.
Sorry, I don't have any idea what this is suggesting and how to solve this issue.
I would greatly appriciate any suggestions or help.
Thanks in advance.
Kind regards,
Philine
##### ERROR stack trace
java.lang.IllegalArgumentException: Left read of read pair fails left read test: HWI-ST143_0294:7:1:11533:163054#0 145 groupXXI 3556356 0 46M groupXXI 3556505 104 TAATAGACGTACCGGGAGTTTAAGGGAGAGGTGCCACGGCTGTTAA 6776767466773666768867766676766777783677768677 X0:i:4 X1:i:2 XA:Z:scaffold_27,-2047944,46M,0;scaffold_27,-2047901,46M,0;scaffold_27,-2047858,46M,0;scaffold_108,+243775,46M,1;groupXX,+949641,46M,1; MD:Z:46 RG:Z:BS27pair.2 XG:i:0 AM:i:0 NM:i:0 SM:i:0 XM:i:0 XO:i:0 MQ:i:0 OQ:Z:?DGDDGEGFGCIHHIIIIIHIBHIIIIIIIIIGIIHIIHIIIIHII XT:A:R
at org.broadinstitute.sv.util.ReadPair.create(ReadPair.java:135)
at org.broadinstitute.sv.discovery.ReadPairRecordFilter.createReadPair(ReadPairRecordFilter.java:228)
at org.broadinstitute.sv.discovery.ReadPairRecordFilter.generateReadPairs(ReadPairRecordFilter.java:149)
at org.broadinstitute.sv.discovery.ReadPairRecordFilter.filterReadPairs(ReadPairRecordFilter.java:80)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.finishReadPairSelection(DeletionDiscoveryAlgorithm.java:206)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:156)
at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:150)
at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:43)
at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:75)
at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:217)
at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:111)
at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:110)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:239)
at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:72)
at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0.5039M):
##### ERROR
##### ERROR Please visit to wiki to see if this is a known problem
##### ERROR If not, please post the error, with stack trace, to the GATK forum
##### ERROR Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki
##### ERROR Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa
##### ERROR
##### ERROR MESSAGE: Left read of read pair fails left read test: HWI-ST143_0294:7:1:11533:163054#0 145 groupXXI
3556356 0 46M groupXXI 3556505 104 TAATAGACGTACCGGGAGTTTAAGGGAGAGGTGCCACGGCTGTTAA 6776767466773666768867766676766777783677768677 X0:i:4 X1:i:2 XA:Z:scaffold_27,-2047944,46M,0;scaffold_27,-2047901,46M,0;scaffold_27,-2047858,46M,0;scaffold_108,+243775,46M,1;groupXX,+949641,46M,1; MD:Z:46 RG:Z:BS27pair.2 XG:i:0 AM:i:0 NM:i:0 SM:i:0 XM:i:0 XO:i:0 MQ:i:0 OQ:Z:?DGDDGEGFGCIHHIIIIIHIBHIIIIIIIIIGIIHIIHIIIIHII XT:A:R
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Dr Philine Feulner
Westfälische Wilhelms University
Institute for Evolution and Biodiversity
Evolutionary Bioinformatics Group
Hüfferstrasse 1
48149 Münster
Germany
Tel: +49 (0) 251 83 21636
Fax: +49 (0) 251 83 24668
Email: p.f...@un...
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
|
|
From: Philine F. <p.f...@un...> - 2011-07-15 15:47:42
|
Hi Bob,
sorry about my slow reply, we had some issues with our computing cluster.
But now I managed to try out the latest interim release you suggested previously, unfortunately the error message stays the same (as you can see below).
I also double checked that my input is a sorted bam. It was successfully run through realigning and recalibration using GATK, and SNPs and haplotypes can be called on this file utilizing GATK.
Besides I also split the combined bam (paired end and mate pair libraries) into separate bams, which still gives the same error.
Thanks for your help again,
Philine
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR stack trace
java.lang.IllegalArgumentException: Left read of read pair fails left read test: HWI-ST143_0294:7:1:19426:37893#0 97 groupXXI 4523762 37
46M groupXXI 4529101 5385 CACTAAGTGCTTCCTCGATTTCGCCAAGATTTGTTCAGCATGGAAC 7767687877776676387776376787877768767777776886 X0:i:1 X1:i:0
MD:Z:46 RG:Z:BS25pair XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:0 XO:i:0 OQ:Z:IIIIIHIIIIEIIIIIHIIIIIIIIIGIHIIIIHIIGIGIIIBHII XT:A:U
at org.broadinstitute.sv.util.ReadPair.create(ReadPair.java:135)
at org.broadinstitute.sv.discovery.ReadPairRecordFilter.createReadPair(ReadPairRecordFilter.java:300)
at org.broadinstitute.sv.discovery.ReadPairRecordFilter.generateReadPairs(ReadPairRecordFilter.java:221)
at org.broadinstitute.sv.discovery.ReadPairRecordFilter.filterReadPairs(ReadPairRecordFilter.java:97)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.finishReadPairSelection(DeletionDiscoveryAlgorithm.java:216)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:166)
at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:165)
at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:44)
at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:85)
at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:236)
at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:116)
at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:110)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221)
at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:72)
at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0.5718M):
##### ERROR
##### ERROR Please visit the wiki to see if this is a known problem
##### ERROR If not, please post the error, with stack trace, to the GATK forum
##### ERROR Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki
##### ERROR Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa
##### ERROR
##### ERROR MESSAGE: Left read of read pair fails left read test: HWI-ST143_0294:7:1:19426:37893#0 97 groupXXI 4523762 37 46M groupXXI 4529101 5385 CACTAAGTGCTTCCTCGATTTCGCCAAGATTTGTTCAGCATGGAAC 7767687877776676387776376787877768767777776886 X0:i:1 X1:i:0 MD:Z:46 RG:Z:BS25pair XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:0 XO:i:0 OQ:Z:IIIIIHIIIIEIIIIIHIIIIIIIIIGIHIIIIHIIGIGIIIBHII XT:A:U
##### ERROR ------------------------------------------------------------------------------------------
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Dr Philine Feulner
Westfälische Wilhelms University
Institute for Evolution and Biodiversity
Evolutionary Bioinformatics Group
Hüfferstrasse 1
48149 Münster
Germany
Tel: +49 (0) 251 83 21636
Fax: +49 (0) 251 83 24668
Email: p.f...@un...
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
|
|
From: Bob H. <han...@br...> - 2011-07-15 18:54:22
|
There isn't anything obviously wrong with that read. There are a couple of things to try: a) run Picard ValidateSamFile on the bam file to make sure it's ok b) extract from the bam file both reads from the read pair so we can see both reads, for example: samtools view in.bam | grep HWI-ST143_0294:7:1:19426:37893#0 c) create a small bam file containing just these two reads and see if the problem persists (and if it does, send me the small bam file so I can debug). -Bob On 7/15/11 11:47 AM, Philine Feulner wrote: > Hi Bob, > > sorry about my slow reply, we had some issues with our computing cluster. > > But now I managed to try out the latest interim release you suggested previously, unfortunately the error message stays the same (as you can see below). > I also double checked that my input is a sorted bam. It was successfully run through realigning and recalibration using GATK, and SNPs and haplotypes can be called on this file utilizing GATK. > Besides I also split the combined bam (paired end and mate pair libraries) into separate bams, which still gives the same error. > > Thanks for your help again, > Philine > > > > > ##### ERROR ------------------------------------------------------------------------------------------ > ##### ERROR stack trace > java.lang.IllegalArgumentException: Left read of read pair fails left read test: HWI-ST143_0294:7:1:19426:37893#0 97 groupXXI 4523762 37 > 46M groupXXI 4529101 5385 CACTAAGTGCTTCCTCGATTTCGCCAAGATTTGTTCAGCATGGAAC 7767687877776676387776376787877768767777776886 X0:i:1 X1:i:0 > MD:Z:46 RG:Z:BS25pair XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:0 XO:i:0 OQ:Z:IIIIIHIIIIEIIIIIHIIIIIIIIIGIHIIIIHIIGIGIIIBHII XT:A:U > at org.broadinstitute.sv.util.ReadPair.create(ReadPair.java:135) > at org.broadinstitute.sv.discovery.ReadPairRecordFilter.createReadPair(ReadPairRecordFilter.java:300) > at org.broadinstitute.sv.discovery.ReadPairRecordFilter.generateReadPairs(ReadPairRecordFilter.java:221) > at org.broadinstitute.sv.discovery.ReadPairRecordFilter.filterReadPairs(ReadPairRecordFilter.java:97) > at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.finishReadPairSelection(DeletionDiscoveryAlgorithm.java:216) > at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:166) > at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:165) > at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:44) > at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129) > at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:85) > at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:236) > at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:116) > at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:110) > at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:221) > at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:72) > at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21) > ##### ERROR ------------------------------------------------------------------------------------------ > ##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0.5718M): > ##### ERROR > ##### ERROR Please visit the wiki to see if this is a known problem > ##### ERROR If not, please post the error, with stack trace, to the GATK forum > ##### ERROR Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki > ##### ERROR Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa > ##### ERROR > ##### ERROR MESSAGE: Left read of read pair fails left read test: HWI-ST143_0294:7:1:19426:37893#0 97 groupXXI 4523762 37 46M groupXXI 4529101 5385 CACTAAGTGCTTCCTCGATTTCGCCAAGATTTGTTCAGCATGGAAC 7767687877776676387776376787877768767777776886 X0:i:1 X1:i:0 MD:Z:46 RG:Z:BS25pair XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:0 XO:i:0 OQ:Z:IIIIIHIIIIEIIIIIHIIIIIIIIIGIHIIIIHIIGIGIIIBHII XT:A:U > ##### ERROR ------------------------------------------------------------------------------------------ > > > > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > Dr Philine Feulner > Westfälische Wilhelms University > Institute for Evolution and Biodiversity > Evolutionary Bioinformatics Group > Hüfferstrasse 1 > 48149 Münster > Germany > Tel: +49 (0) 251 83 21636 > Fax: +49 (0) 251 83 24668 > Email: p.f...@un... > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > > > ------------------------------------------------------------------------------ > AppSumo Presents a FREE Video for the SourceForge Community by Eric > Ries, the creator of the Lean Startup Methodology on "Lean Startup > Secrets Revealed." This video shows you how to validate your ideas, > optimize your ideas and identify your business strategy. > http://p.sf.net/sfu/appsumosfdev2dev > _______________________________________________ > svtoolkit-help mailing list > svt...@li... > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help |
|
From: Philine F. <p.f...@un...> - 2011-11-10 16:06:51
Attachments:
failedreads.zip
|
Dear Bob, I am referring to your reply from the 2011-07-15. I am very sorry that it took me so long to come back to you! I run Picard ValidateSam on the bam files and they are fine. I also extracted 2 pairs of reads (from different chromosomes and libraries) which failed to run through svtoolkit (error: Left read of read pair fails left read test): NG-5241_BS25_4kb_7_68_16539_10233 65 scaffold_1073 245 37 36M = 755 510 CTATCTATCCACGCCGCGCAGACATCTCAAAATCTC 355767676676476474777877867679997675 X0:i:1 X1:i:0 MD:Z:16A19 RG:Z:BS25_4kb_read_run1t_matepair XG:i:0 AM:i:37 NM:i:1 SM:i:37 XM:i:1 XO:i:0 MQ:i:37 OQ:Z:IIGHIIIIHIIIHIIIIIIIIIIIIIIIIIIIHIII XT:A:U NG-5241_BS25_4kb_7_68_16539_10233 129 scaffold_1073 755 37 36M = 245 -510 TCACTTTCAAACCTTCATATTATGTGTGTCTATATA 345677767886677677677677878786767685 X0:i:1 X1:i:0 MD:Z:36 RG:Z:BS25_4kb_read_run1t_matepair XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:0 XO:i:0 MQ:i:37 OQ:Z:IGFHIEIIIIIIIIIIIHIIIIIIIIIIIIHIIIII XT:A:U HWI-ST225_0141:4:1:18064:55456#0 97 groupIV 12453454 37 50M = 12453809 404 CTTATATGACTCCACCAAATGCTCATCTTAACCGTCAATCCGCGAGAGTT 78767677867667667887777677677686638678766374878787 X0:i:1 X1:i:0 MD:Z:7C36C5 RG:Z:BS25_read_run2t_paired_50bp XG:i:0 AM:i:37 NM:i:2 SM:i:37 XM:i:2 XO:i:0 MQ:i:37 OQ:Z:IIIGGHIIIIIIIHIIIIIIIIGIIIIIIIIIIIIIHIIIIIIEIIIIHH XT:A:U HWI-ST225_0141:4:1:18064:55456#0 145 groupIV 12453809 37 50M = 12453454 -404 TGAGTATTTAGGGAAGAACTTATGTTAAAATGTTTGTTGACCTCAGGACT 76766788676667767878677686777776887687687787766887 X0:i:1 X1:i:0 MD:Z:12A37 RG:Z:BS25_read_run2t_paired_50bp XG:i:0 AM:i:37 NM:i:1 SM:i:37 XM:i:1 XO:i:0 MQ:i:37 OQ:Z:IIIIGIIIIIIIGHIIIIBIIIIIIGGIHIHIIIIIIIIIIHIIIIIIII XT:A:U If I run svtoolkit on these read pairs (bam files attached) only, one pair (from the paired end library) now runs through while the other one (from the mate pair library) still fails. Thanks for your help, Philine |
|
From: Bob H. <han...@br...> - 2011-11-10 18:39:31
|
I'm unable to reproduce that error here with these bam files (although I can't run completely through discovery because I don't have your reference sequence). If you are running a recent interim release, there should be debugging information on stdout (in addition to the stack trace). Can you send me that output for the pair that fails? Thanks, -Bob On 11/10/11 10:45 AM, Philine Feulner wrote: > Dear Bob, > > I am referring to your reply from the 2011-07-15. I am very sorry that it took me so long to come back to you! > > I run Picard ValidateSam on the bam files and they are fine. > > I also extracted 2 pairs of reads (from different chromosomes and libraries) which failed to run through svtoolkit (error: Left read of read pair fails left read test): > > NG-5241_BS25_4kb_7_68_16539_10233 65 scaffold_1073 245 37 36M = 755 510 CTATCTATCCACGCCGCGCAGACATCTCAAAATCTC 355767676676476474777877867679997675 X0:i:1 X1:i:0 MD:Z:16A19 RG:Z:BS25_4kb_read_run1t_matepair XG:i:0 AM:i:37 NM:i:1 SM:i:37 XM:i:1 XO:i:0 MQ:i:37 OQ:Z:IIGHIIIIHIIIHIIIIIIIIIIIIIIIIIIIHIII XT:A:U > NG-5241_BS25_4kb_7_68_16539_10233 129 scaffold_1073 755 37 36M = 245 -510 TCACTTTCAAACCTTCATATTATGTGTGTCTATATA 345677767886677677677677878786767685 X0:i:1 X1:i:0 MD:Z:36 RG:Z:BS25_4kb_read_run1t_matepair XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:0 XO:i:0 MQ:i:37 OQ:Z:IGFHIEIIIIIIIIIIIHIIIIIIIIIIIIHIIIII XT:A:U > > HWI-ST225_0141:4:1:18064:55456#0 97 groupIV 12453454 37 50M = 12453809 404 CTTATATGACTCCACCAAATGCTCATCTTAACCGTCAATCCGCGAGAGTT 78767677867667667887777677677686638678766374878787 X0:i:1 X1:i:0 MD:Z:7C36C5 RG:Z:BS25_read_run2t_paired_50bp XG:i:0 AM:i:37 NM:i:2 SM:i:37 XM:i:2 XO:i:0 MQ:i:37 OQ:Z:IIIGGHIIIIIIIHIIIIIIIIGIIIIIIIIIIIIIHIIIIIIEIIIIHH XT:A:U > HWI-ST225_0141:4:1:18064:55456#0 145 groupIV 12453809 37 50M = 12453454 -404 TGAGTATTTAGGGAAGAACTTATGTTAAAATGTTTGTTGACCTCAGGACT 76766788676667767878677686777776887687687787766887 X0:i:1 X1:i:0 MD:Z:12A37 RG:Z:BS25_read_run2t_paired_50bp XG:i:0 AM:i:37 NM:i:1 SM:i:37 XM:i:1 XO:i:0 MQ:i:37 OQ:Z:IIIIGIIIIIIIGHIIIIBIIIIIIGGIHIHIIIIIIIIIIHIIIIIIII XT:A:U > > > If I run svtoolkit on these read pairs (bam files attached) only, one pair (from the paired end library) now runs through while the other one (from the mate pair library) still fails. > > Thanks for your help, > Philine > > > > > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > Dr Philine Feulner > Westfälische Wilhelms University > Institute for Evolution and Biodiversity > Evolutionary Bioinformatics Group > Hüfferstrasse 1 > 48149 Münster > Germany > Tel: +49 (0) 251 83 21636 > Fax: +49 (0) 251 83 24668 > Email: p.f...@un... > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > > > > ------------------------------------------------------------------------------ > RSA(R) Conference 2012 > Save $700 by Nov 18 > Register now > http://p.sf.net/sfu/rsa-sfdev2dev1 > > > _______________________________________________ > svtoolkit-help mailing list > svt...@li... > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help |
|
From: Bob H. <han...@br...> - 2012-06-06 16:27:20
|
I was able to find and fix this problem thanks to lots of help from Martin Kircher who kindly provided debugging help and some sample data that recreated the problem. This should be resolved in interim releasev r939 and later versions. ftp://ftp.broadinstitute.org/pub/svtoolkit/releases/interim/svtoolkit_1.04.939.tar.gz -Bob On 11/10/11 10:45 AM, Philine Feulner wrote: > Dear Bob, > > I am referring to your reply from the 2011-07-15. I am very sorry that it took me so long to come back to you! > > I run Picard ValidateSam on the bam files and they are fine. > > I also extracted 2 pairs of reads (from different chromosomes and libraries) which failed to run through svtoolkit (error: Left read of read pair fails left read test): > > NG-5241_BS25_4kb_7_68_16539_10233 65 scaffold_1073 245 37 36M = 755 510 CTATCTATCCACGCCGCGCAGACATCTCAAAATCTC 355767676676476474777877867679997675 X0:i:1 X1:i:0 MD:Z:16A19 RG:Z:BS25_4kb_read_run1t_matepair XG:i:0 AM:i:37 NM:i:1 SM:i:37 XM:i:1 XO:i:0 MQ:i:37 OQ:Z:IIGHIIIIHIIIHIIIIIIIIIIIIIIIIIIIHIII XT:A:U > NG-5241_BS25_4kb_7_68_16539_10233 129 scaffold_1073 755 37 36M = 245 -510 TCACTTTCAAACCTTCATATTATGTGTGTCTATATA 345677767886677677677677878786767685 X0:i:1 X1:i:0 MD:Z:36 RG:Z:BS25_4kb_read_run1t_matepair XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:0 XO:i:0 MQ:i:37 OQ:Z:IGFHIEIIIIIIIIIIIHIIIIIIIIIIIIHIIIII XT:A:U > > HWI-ST225_0141:4:1:18064:55456#0 97 groupIV 12453454 37 50M = 12453809 404 CTTATATGACTCCACCAAATGCTCATCTTAACCGTCAATCCGCGAGAGTT 78767677867667667887777677677686638678766374878787 X0:i:1 X1:i:0 MD:Z:7C36C5 RG:Z:BS25_read_run2t_paired_50bp XG:i:0 AM:i:37 NM:i:2 SM:i:37 XM:i:2 XO:i:0 MQ:i:37 OQ:Z:IIIGGHIIIIIIIHIIIIIIIIGIIIIIIIIIIIIIHIIIIIIEIIIIHH XT:A:U > HWI-ST225_0141:4:1:18064:55456#0 145 groupIV 12453809 37 50M = 12453454 -404 TGAGTATTTAGGGAAGAACTTATGTTAAAATGTTTGTTGACCTCAGGACT 76766788676667767878677686777776887687687787766887 X0:i:1 X1:i:0 MD:Z:12A37 RG:Z:BS25_read_run2t_paired_50bp XG:i:0 AM:i:37 NM:i:1 SM:i:37 XM:i:1 XO:i:0 MQ:i:37 OQ:Z:IIIIGIIIIIIIGHIIIIBIIIIIIGGIHIHIIIIIIIIIIHIIIIIIII XT:A:U > > > If I run svtoolkit on these read pairs (bam files attached) only, one pair (from the paired end library) now runs through while the other one (from the mate pair library) still fails. > > Thanks for your help, > Philine > > > > > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > Dr Philine Feulner > Westfälische Wilhelms University > Institute for Evolution and Biodiversity > Evolutionary Bioinformatics Group > Hüfferstrasse 1 > 48149 Münster > Germany > Tel: +49 (0) 251 83 21636 > Fax: +49 (0) 251 83 24668 > Email: p.f...@un... > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > > > > ------------------------------------------------------------------------------ > RSA(R) Conference 2012 > Save $700 by Nov 18 > Register now > http://p.sf.net/sfu/rsa-sfdev2dev1 > > > _______________________________________________ > svtoolkit-help mailing list > svt...@li... > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help |
|
From: Bob H. <han...@br...> - 2011-06-22 16:10:31
|
I don't see any obvious problem with this SAM record. Could you download the latest interim release from here: ftp://ftp.broadinstitute.org/pub/svtoolkit/releases/interim/svtoolkit_1.04.683.tar.gz and run with that. This will produce a little bit of additional debugging information, but mostly I'd like to see if the problem happens with more recent code. -Bob On 6/22/11 8:14 AM, Philine Feulner wrote: > Hi, > > I am trying to run SVDiscovery on a non human data set (stickleback illumina paired end data). > The installation test was successful and the bam files I am using are also already run through the GATK framework. > The preprocessing of the reads also works but the SVDiscovery always fails with following error message: > Left read of read pair fails left read test > I attach the stack trace below. > > Sorry, I don't have any idea what this is suggesting and how to solve this issue. > > I would greatly appriciate any suggestions or help. > Thanks in advance. > > Kind regards, > Philine > > > > > > ##### ERROR stack trace > java.lang.IllegalArgumentException: Left read of read pair fails left read test: HWI-ST143_0294:7:1:11533:163054#0 145 groupXXI 3556356 0 46M groupXXI 3556505 104 TAATAGACGTACCGGGAGTTTAAGGGAGAGGTGCCACGGCTGTTAA 6776767466773666768867766676766777783677768677 X0:i:4 X1:i:2 XA:Z:scaffold_27,-2047944,46M,0;scaffold_27,-2047901,46M,0;scaffold_27,-2047858,46M,0;scaffold_108,+243775,46M,1;groupXX,+949641,46M,1; MD:Z:46 RG:Z:BS27pair.2 XG:i:0 AM:i:0 NM:i:0 SM:i:0 XM:i:0 XO:i:0 MQ:i:0 OQ:Z:?DGDDGEGFGCIHHIIIIIHIBHIIIIIIIIIGIIHIIHIIIIHII XT:A:R > at org.broadinstitute.sv.util.ReadPair.create(ReadPair.java:135) > at org.broadinstitute.sv.discovery.ReadPairRecordFilter.createReadPair(ReadPairRecordFilter.java:228) > at org.broadinstitute.sv.discovery.ReadPairRecordFilter.generateReadPairs(ReadPairRecordFilter.java:149) > at org.broadinstitute.sv.discovery.ReadPairRecordFilter.filterReadPairs(ReadPairRecordFilter.java:80) > at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.finishReadPairSelection(DeletionDiscoveryAlgorithm.java:206) > at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:156) > at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:150) > at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:43) > at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129) > at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:75) > at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:217) > at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:111) > at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:110) > at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:239) > at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:72) > at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21) > ##### ERROR ------------------------------------------------------------------------------------------ > ##### ERROR A GATK RUNTIME ERROR has occurred (version 1.0.5039M): > ##### ERROR > ##### ERROR Please visit to wiki to see if this is a known problem > ##### ERROR If not, please post the error, with stack trace, to the GATK forum > ##### ERROR Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki > ##### ERROR Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa > ##### ERROR > ##### ERROR MESSAGE: Left read of read pair fails left read test: HWI-ST143_0294:7:1:11533:163054#0 145 groupXXI > 3556356 0 46M groupXXI 3556505 104 TAATAGACGTACCGGGAGTTTAAGGGAGAGGTGCCACGGCTGTTAA 6776767466773666768867766676766777783677768677 X0:i:4 X1:i:2 XA:Z:scaffold_27,-2047944,46M,0;scaffold_27,-2047901,46M,0;scaffold_27,-2047858,46M,0;scaffold_108,+243775,46M,1;groupXX,+949641,46M,1; MD:Z:46 RG:Z:BS27pair.2 XG:i:0 AM:i:0 NM:i:0 SM:i:0 XM:i:0 XO:i:0 MQ:i:0 OQ:Z:?DGDDGEGFGCIHHIIIIIHIBHIIIIIIIIIGIIHIIHIIIIHII XT:A:R > > > > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > Dr Philine Feulner > Westfälische Wilhelms University > Institute for Evolution and Biodiversity > Evolutionary Bioinformatics Group > Hüfferstrasse 1 > 48149 Münster > Germany > Tel: +49 (0) 251 83 21636 > Fax: +49 (0) 251 83 24668 > Email: p.f...@un... > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > > > ------------------------------------------------------------------------------ > Simplify data backup and recovery for your virtual environment with vRanger. > Installation's a snap, and flexible recovery options mean your data is safe, > secure and there when you need it. Data protection magic? > Nope - It's vRanger. Get your free trial download today. > http://p.sf.net/sfu/quest-sfdev2dev > _______________________________________________ > svtoolkit-help mailing list > svt...@li... > https://lists.sourceforge.net/lists/listinfo/svtoolkit-help |
×
Want the latest updates on software, tech news, and AI?
Get latest updates about software, tech news, and AI from SourceForge directly in your inbox once a month.
Thanks for helping keep SourceForge clean.
X