Re: [svtoolkit-help] Left read of read pair fails left read test

[Bob H. <han...@br...>]

I'm unable to reproduce that error here with these bam files (although I 
can't run completely through discovery because I don't have your 
reference sequence).
If you are running a recent interim release, there should be debugging 
information on stdout (in addition to the stack trace).
Can you send me that output for the pair that fails?
Thanks,
-Bob

On 11/10/11 10:45 AM, Philine Feulner wrote:
> Dear Bob,
>
> I am referring to your reply from the 2011-07-15. I am very sorry that it took me so long to come back to you!
>
> I run Picard ValidateSam on the bam files and they are fine.
>
> I also extracted 2 pairs of reads (from different chromosomes and libraries) which failed to run through svtoolkit (error: Left read of read pair fails left read test):
>
> NG-5241_BS25_4kb_7_68_16539_10233       65      scaffold_1073   245     37      36M     =       755     510     CTATCTATCCACGCCGCGCAGACATCTCAAAATCTC    355767676676476474777877867679997675    X0:i:1  X1:i:0  MD:Z:16A19      RG:Z:BS25_4kb_read_run1t_matepair       XG:i:0  AM:i:37 NM:i:1  SM:i:37 XM:i:1  XO:i:0  MQ:i:37 OQ:Z:IIGHIIIIHIIIHIIIIIIIIIIIIIIIIIIIHIII     XT:A:U
> NG-5241_BS25_4kb_7_68_16539_10233       129     scaffold_1073   755     37      36M     =       245     -510    TCACTTTCAAACCTTCATATTATGTGTGTCTATATA    345677767886677677677677878786767685 X0:i:1  X1:i:0  MD:Z:36 RG:Z:BS25_4kb_read_run1t_matepair       XG:i:0  AM:i:37 NM:i:0  SM:i:37 XM:i:0  XO:i:0  MQ:i:37 OQ:Z:IGFHIEIIIIIIIIIIIHIIIIIIIIIIIIHIIIII       XT:A:U
>
> HWI-ST225_0141:4:1:18064:55456#0        97      groupIV 12453454        37      50M     =       12453809        404     CTTATATGACTCCACCAAATGCTCATCTTAACCGTCAATCCGCGAGAGTT      78767677867667667887777677677686638678766374878787      X0:i:1  X1:i:0  MD:Z:7C36C5     RG:Z:BS25_read_run2t_paired_50bp        XG:i:0  AM:i:37 NM:i:2  SM:i:37 XM:i:2  XO:i:0  MQ:i:37 OQ:Z:IIIGGHIIIIIIIHIIIIIIIIGIIIIIIIIIIIIIHIIIIIIEIIIIHH XT:A:U
> HWI-ST225_0141:4:1:18064:55456#0        145     groupIV 12453809        37      50M     =       12453454        -404    TGAGTATTTAGGGAAGAACTTATGTTAAAATGTTTGTTGACCTCAGGACT      76766788676667767878677686777776887687687787766887      X0:i:1  X1:i:0  MD:Z:12A37      RG:Z:BS25_read_run2t_paired_50bp        XG:i:0  AM:i:37 NM:i:1  SM:i:37 XM:i:1  XO:i:0  MQ:i:37 OQ:Z:IIIIGIIIIIIIGHIIIIBIIIIIIGGIHIHIIIIIIIIIIHIIIIIIII XT:A:U
>
>
> If I run svtoolkit on these read pairs (bam files attached) only, one pair (from the paired end library) now runs through while the other one (from the mate pair library) still fails.
>
> Thanks for your help,
> Philine
>
>
>
>
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Dr Philine Feulner
> Westfälische Wilhelms University
> Institute for Evolution and Biodiversity
> Evolutionary Bioinformatics Group
> Hüfferstrasse 1
> 48149 Münster
> Germany
> Tel: +49 (0) 251 83 21636
> Fax: +49 (0) 251 83 24668
> Email: p.f...@un...
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
>
>
>
> ------------------------------------------------------------------------------
> RSA(R) Conference 2012
> Save $700 by Nov 18
> Register now
> http://p.sf.net/sfu/rsa-sfdev2dev1
>
>
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help