Re: [svtoolkit-help] Unrecognized sequence: 1:0-0 error with ELAND mapped bams
Status: Beta
Brought to you by:
bhandsaker
From: Verena T. <ver...@em...> - 2011-09-30 07:24:08
|
Hi Bob, thanks a lot for your quick reply. Here is the command right before the error stack: INFO 23:32:06,755 QGraph - Deleting intermediate files. INFO 23:32:06,764 QCommandLine - Done INFO 23:32:09,047 QScriptManager - Compiling 2 QScripts INFO 23:32:13,741 QScriptManager - Compilation complete INFO 23:32:15,767 HelpFormatter - --------------------------------------------------------- INFO 23:32:15,767 HelpFormatter - Program Name: org.broadinstitute.sting.queue.QCommandLine INFO 23:32:15,768 HelpFormatter - Program Args: -S /home/tischler/software/svtoolkit/qscript/SVDiscovery.q -S /home/tischler/software/svtoolkit/qscript/SVQScript.q -gatk /home/tischler/software/svtoolkit/lib/gatk/GenomeAnalysisTK.jar -cp /home/tischler/software/svtoolkit/lib/SVToolkit.jar:/home/tischler/software/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/tischler/software/svtoolkit/lib/gatk/Queue.jar -configFile conf/genstrip_parameters.txt -tempDir /home/tischler/tmp/ -R home/tischler/genomes/GenomeSTRiP_ref/test.fa -genomeMaskFile /home/tischler/genomes/GenomeSTRiP_ref/test.mask.fasta -genderMapFile gender.map -runDirectory test -md test/metadata -jobLogDir test/logs -L 1 -minimumSize 100 -maximumSize 1000000 -I /home/tischler/test1/test1.bam -I /home/tischler/test2/test2.bam -I /home/tischler/test3/test3.bam -I /home/tischler/test4/test4.bam -I /home/tischler/test5/test5.bam -O /home/tischler/GenomeSTRiP/deletions.discovery.vcf -run INFO 23:32:15,768 HelpFormatter - Date/Time: 2011/09/29 23:32:15 INFO 23:32:15,768 HelpFormatter - --------------------------------------------------------- INFO 23:32:15,768 HelpFormatter - --------------------------------------------------------- INFO 23:32:15,769 QCommandLine - Scripting SVDiscovery The command from the bash-script (provided in the GenomeSTRiP package) I only modified according to my paths: export SV_DIR=`pwd` SV_TMPDIR=/home/tischler/tmp/ export LD_LIBRARY_PATH=${SV_DIR}/bwa:${LD_LIBRARY_PATH} mx="-Xmx8g" classpath="${SV_DIR}/lib/SVToolkit.jar:${SV_DIR}/lib/gatk/GenomeAnalysisTK.jar:${SV_DIR}/lib/gatk/Queue.jar" ... ... # Run discovery java -cp ${classpath} ${mx} \ org.broadinstitute.sting.queue.QCommandLine \ -S ${SV_DIR}/qscript/SVDiscovery.q \ -S ${SV_DIR}/qscript/SVQScript.q \ -gatk ${SV_DIR}/lib/gatk/GenomeAnalysisTK.jar \ -cp ${classpath} \ -configFile conf/genstrip_parameters.txt \ -tempDir ${SV_TMPDIR} \ -R /home/tischler/genomes/GenomeSTRiP_ref/test.fa \ -genomeMaskFile /home/tischler/genomes/GenomeSTRiP_ref/test.mask.fasta \ -genderMapFile gender.map \ -runDirectory ${runDir} \ -md ${runDir}/metadata \ -jobLogDir ${runDir}/logs \ -L 1 \ -minimumSize 100 \ -maximumSize 1000000 \ -I ${bam1} \ -I ${bam2} \ -I ${bam3} \ -I ${bam4} \ -I ${bam5} \ -O ${sites} \ -run \ || exit 1 I hope this helps! Cheers Verena 2011/9/27 Verena Tischler <ver...@em...> > Dear all, > > I am using GenomeSTRiP on eland mapped bam files and get the following > error message: > > INFO 04:20:04,705 HelpFormatter - Date/Time: 2011/09/27 04:20:04 > INFO 04:20:04,705 HelpFormatter - > --------------------------------------------------------- > INFO 04:20:04,705 HelpFormatter - > --------------------------------------------------------- > INFO 04:20:04,706 QCommandLine - Scripting SVDiscovery > ##### ERROR > ------------------------------------------------------------------------------------------ > > ##### ERROR stack trace > java.lang.IllegalArgumentException: Unrecognized sequence: 1:0-0 > at > org.broadinstitute.sv.queue.ComputeDiscoveryPartitions.computePartitions(ComputeDiscoveryPartitions.java:96) > > at > org.broadinstitute.sv.qscript.SVQScript.computeDiscoveryPartitions(SVQScript.q:132) > > at SVDiscovery.script(SVDiscovery.q:19) > at > org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:46) > > at > org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:43) > > at scala.collection.Iterator$class.foreach(Iterator.scala:631) > at > scala.collection.JavaConversions$JIteratorWrapper.foreach(JavaConversions.scala:549) > > at scala.collection.IterableLike$class.foreach(IterableLike.scala:79) > at > scala.collection.JavaConversions$JListWrapper.foreach(JavaConversions.scala:596) > > at > org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:43) > at > org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:239) > at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:117) > > at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala) > ##### ERROR ---------------------- > > parsing the input bam files for this sequence I only get a hit in the read > quality string. Here is how a typical line in my bams looks like: > HWI-ST169_185:3:41:17915:79533 89 chr15.fa 98634059 91 103M * 0 0 > CTACAAAGATAAAAAATTAGCTGAGTCTGTTGTCACAGGCCTGTCGTCCCAGCTACTGGAGAGGCTGAGGCATGAGAATCGCTTGAACCCGGGGGCAGACGTT > BAD*96)4(17-@<=8+9+8D;>1:0-0@1+)'7(<><38=1).089FFD=FFF@FF=E=EEDD=?DD:EEE888EEF.DFD > XD:Z:AA1A2GA1A13G1CA2G2A1G2T6AA11T1G32A6G3 SM:i:91 AS:i:0 > RG:Z:test_eland_101PE_1 > > > I hope this explains my problem > Many thanks in advance for your help > Verena > > -- Predoctoral fellow Korbel Group - Genome Biology Unit EMBL (European Molecular Biology Laboratories) Meyerhofstrasse 1 69117 Heidelberg Germany +49 (0) 6221 387-8479 ver...@em... 13th International EMBL PhD Symposium Heidelberg, 17th-19th November 2011 Find out more information by visiting: http://phdsymposium.embl.org/ |