Re: [svtoolkit-help] Unrecognized sequence: 1:0-0 error with ELAND mapped bams

[Bob H. <han...@br...>]

This is likely related to how you are invoking the Q script.  Can you 
send the command line you are using?
Thanks,
-Bob

On 9/27/11 8:41 AM, Verena Tischler wrote:
> Dear all,
>
> I am using GenomeSTRiP on eland mapped bam files and get the following 
> error message:
>
> INFO 04:20:04,705 HelpFormatter - Date/Time: 2011/09/27 04:20:04
> INFO 04:20:04,705 HelpFormatter - 
> ---------------------------------------------------------
> INFO 04:20:04,705 HelpFormatter - 
> ---------------------------------------------------------
> INFO 04:20:04,706 QCommandLine - Scripting SVDiscovery
> ##### ERROR 
> ------------------------------------------------------------------------------------------ 
>
> ##### ERROR stack trace
> java.lang.IllegalArgumentException: Unrecognized sequence: 1:0-0
> at 
> org.broadinstitute.sv.queue.ComputeDiscoveryPartitions.computePartitions(ComputeDiscoveryPartitions.java:96)
> at 
> org.broadinstitute.sv.qscript.SVQScript.computeDiscoveryPartitions(SVQScript.q:132)
> at SVDiscovery.script(SVDiscovery.q:19)
> at 
> org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:46)
> at 
> org.broadinstitute.sting.queue.QCommandLine$$anonfun$execute$1.apply(QCommandLine.scala:43)
> at scala.collection.Iterator$class.foreach(Iterator.scala:631)
> at 
> scala.collection.JavaConversions$JIteratorWrapper.foreach(JavaConversions.scala:549)
> at scala.collection.IterableLike$class.foreach(IterableLike.scala:79)
> at 
> scala.collection.JavaConversions$JListWrapper.foreach(JavaConversions.scala:596)
> at 
> org.broadinstitute.sting.queue.QCommandLine.execute(QCommandLine.scala:43)
> at 
> org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:239) 
> at 
> org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:117)
> at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)
> ##### ERROR ----------------------
>
> parsing the input bam files for this sequence I only get a hit in the 
> read quality string. Here is how a typical line in my bams looks like:
> HWI-ST169_185:3:41:17915:79533 89 chr15.fa 98634059 91 103M * 0 0 
> CTACAAAGATAAAAAATTAGCTGAGTCTGTTGTCACAGGCCTGTCGTCCCAGCTACTGGAGAGGCTGAGGCATGAGAATCGCTTGAACCCGGGGGCAGACGTT 
> BAD*96)4(17-@<=8+9+8D;>1:0-0@1+)'7(<><38=1).089FFD=FFF@FF=E=EEDD=?DD:EEE888EEF.DFD 
> XD:Z:AA1A2GA1A13G1CA2G2A1G2T6AA11T1G32A6G3 SM:i:91 AS:i:0 
> RG:Z:test_eland_101PE_1
>
>
> I hope this explains my problem
> Many thanks in advance for your help
> Verena
>
>
>
> ------------------------------------------------------------------------------
> All the data continuously generated in your IT infrastructure contains a
> definitive record of customers, application performance, security
> threats, fraudulent activity and more. Splunk takes this data and makes
> sense of it. Business sense. IT sense. Common sense.
> http://p.sf.net/sfu/splunk-d2dcopy1
>
>
> _______________________________________________
> svtoolkit-help mailing list
> svt...@li...
> https://lists.sourceforge.net/lists/listinfo/svtoolkit-help