staden-package Mailing List for Staden Package

staden-package — General purpose discussion related to the package.

You can subscribe to this list here.

2004	Jan	Feb (2)	Mar (5)	Apr	May (8)	Jun	Jul (3)	Aug (1)	Sep	Oct	Nov	Dec
2006	Jan	Feb (1)	Mar (2)	Apr	May	Jun	Jul (1)	Aug (2)	Sep	Oct (2)	Nov (1)	Dec (2)
2007	Jan (2)	Feb (1)	Mar (2)	Apr	May	Jun	Jul	Aug	Sep	Oct	Nov	Dec
2008	Jan (6)	Feb	Mar	Apr	May	Jun	Jul	Aug	Sep	Oct	Nov	Dec
2009	Jan	Feb (5)	Mar (1)	Apr	May	Jun	Jul	Aug	Sep (2)	Oct	Nov	Dec (1)
2015	Jan	Feb (1)	Mar	Apr	May	Jun	Jul	Aug	Sep	Oct	Nov	Dec (2)
2016	Jan	Feb (1)	Mar	Apr	May	Jun	Jul	Aug	Sep	Oct	Nov	Dec
2018	Jan	Feb	Mar	Apr	May	Jun	Jul	Aug	Sep	Oct	Nov	Dec (1)

Flat | Threaded

1 2 3 > >> (Page 1 of 3)

[Staden-package] I can't run the packages on MacOS Mojave

From: Jean F. C. <jca...@gm...> - 2018-12-11 19:35:08

Hello,

I'm trying to use PreGap4 and Gap4 of the Staden Package on MacOS Mojave
(recently updated from MacOS High Sierra). Every time I try to open it it
says that the program is damaged. I have erased everything and downloaded
the package again, but the error is still there.

Any ideas on a possible solution?

Thanks,

JFC

[Staden-package] Installation on OS X 10.11.3

From: Raquel P. <ims...@gm...> - 2016-02-24 10:04:28

Dear all

Sorry for bother, but I have been trying unsuccessfully to install any staden (from 1.6.0 to more recent) on OS X 10.11.3 (El capitan).

I have xcode required and Xquartz and I have tried the following option: 

To compile myself
make  - does not respond

./ configure  - it asks me for io_lib (which I cannot find anywhere in the stamen packages)


Through macports as in:

The old "tutorial" in the file: 

The libzma changed/fused with xz

and 

itcl is not found

https://sourceforge.net/p/staden/discussion/347718/thread/02805b4a/

The new tutorial 
https://sourceforge.net/p/staden/discussion/347718/thread/d36794a2/ 

On the step: 

sudo rm -rf /opt/local /Applications/DarwinPorts /Applications/MacPorts /Library/LaunchDaemons/org.macports.* /Library/Receipts/DarwinPorts*.pkg /Library/Receipts/MacPorts*.pkg /Library/StartupItems/DarwinPortsStartup /Library/Tcl/darwinports1.0 /Library/Tcl/macports1.0 ~/.macports

It gives me an output saying: no such file or directory.


I tried fink without success and Homebrew. Latest, even has a sub sub repository where I can find the staden, but I fail miserably to proceed the installation. 

https://github.com/chapmanb/homebrew-cbl/blob/master/staden_io_lib.rb <https://github.com/chapmanb/homebrew-cbl/blob/master/staden_io_lib.rb>


I would be great if someone could help.
Sorry for the n00bness and bad format
Raquel

Re: [Staden-package] Editing/ cleanup of MIRA assembly with gap5

From: James B. <jk...@sa...> - 2015-12-14 09:39:42

Hello,

On Sat, Dec 12, 2015 at 07:31:42PM +0530, Chitra P wrote:
> I would like to edit a MIRA assembly with gap5 ( I have installed
> staden-2.0.0b9.i686 on a Ubuntu 14.04). At present, I am able to load but
> unable to edit the sequences.
> 
> This is what I did :
> I converted the MIRA maf and fasta files to sam
> 
> then used tg_index to convert it to a gap5 database
> 
> I am able to view the sequences but unable to edit the sequence. In my
> terminal get the following error message when I try editing
> 
> *'D8YB9:08803:07440': couldn't open*

I'm not sure I really understand this.  What specifically did you do
to get that error?

This looks rather like it is trying to open a "trace" file - eg a
chromatogram.  You get this if you try to double click on a sequence
or in the consensus.  This isn't really applicable to any modern
instruments (and we probably ought to disable it for such data).

However you should be able to simply single click to set the editing
cursor and then type in new sequence or press "i" or "insert" key to
insert a gap (and delete to remove one).

James

-- 
James Bonfield (jk...@sa...) | Hora aderat briligi. Nunc et Slythia Tova
                                  | Plurima gyrabant gymbolitare vabo;
  A Staden Package developer:     | Et Borogovorum mimzebant undique formae,
https://sf.net/projects/staden/   | Momiferique omnes exgrabure Rathi. 

-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE.

[Staden-package] Editing/ cleanup of MIRA assembly with gap5

From: Chitra P <pat...@gm...> - 2015-12-12 14:02:09

Hi,

I would like to edit a MIRA assembly with gap5 ( I have installed
staden-2.0.0b9.i686 on a Ubuntu 14.04). At present, I am able to load but
unable to edit the sequences.

This is what I did :
I converted the MIRA maf and fasta files to sam

then used tg_index to convert it to a gap5 database

I am able to view the sequences but unable to edit the sequence. In my
terminal get the following error message when I try editing

*'D8YB9:08803:07440': couldn't open*

I would be grateful for any suggestions regarding this.

Thanks,

PC

[Staden-package] diploid re-sequencing

From: Pablo G G. <pab...@gm...> - 2015-02-10 12:57:04

Dear members
I am new to the forum and although I have tried to search an answer for my
question, I have been unable to do it. So, please forgive me if I ask a
silly, or old, question. Or perhaps it should be asked to phred maintainer.

My problem is that I have diploid reads from several gene fragments. I have
been looking through the documentation, specifically the "Mutation
detection methods" and I have found nothing of the kind.
I wonder whether Staden can be used (or has been used) in such case to
detect SNPs within individuals.

Kind regards
Pablo

-- 
-------
Pablo G Goikoetxea
Don Vela 54, 2º izda
01009 Vitoria-Gasteiz (SPAIN)

Re: [Staden-package] install staden

From: Simon A. <sim...@bb...> - 2009-09-04 15:29:04

On 4 Sep 2009, at 14:53, steffiw wrote:

>
> i have a pc and im trying to install staden. it gives me a .tar  
> file. how to
> open and install the staden package:working:

I'm assuming you're using windows.  In this case you've probably  
downloaded the wrong file.  There is a windows installer file which  
you can just double click to install on windows.  The direct link to  
the latest version is:

http://sourceforge.net/projects/staden/files/staden/1.7.0/staden-windows-1-7-0.msi/download

Simon.

[Staden-package] install staden

From: steffiw <SJW...@gm...> - 2009-09-04 14:12:58

i have a pc and im trying to install staden. it gives me a .tar file. how to
open and install the staden package:working:
-- 
View this message in context: http://www.nabble.com/install-staden-tp25294754p25294754.html
Sent from the staden-package mailing list archive at Nabble.com.

[Staden-package] Pregap/Enter_assembly: Couldn't find pregap.assembly/fofn.

From: Sam L. <tim...@fa...> - 2009-03-27 13:20:19

Hei,

I am running the staden-linux_x86_64-1-7-1b on an Ubuntu 8.04 64bit system.
I already compiled gcphrap using the phrap-sources plus phrap_extra sources.
I have some trouble getting to run phrap/phrap_assembly in pregap4. 

I configured the modules
- Phred
- Initialise Experiment Files
- Augment Experiment Files
- Sequencing Vector Clip
- Screen for Unclipped Vector
- Cloning Vector Clip
- Phrap Assembly
- Enter Assembly (into Gap4)

and it seems that everything is working fine until it comes to
phrap_assembly or enter_assembly. Then it stops with the error 

ERR: Could not open file [..]/pregap.assembly/fofn.
ERR: "couldn't open "fofn". No such file or directory.
ERR: Aborting enter assembly.

I already tried an old dataset that work fine on an 32bit mashine to be sure
that it's not because of the dataset/filenames etc. But I get the same error
there. 
The directory pregap.assembly is created but no *.ph files of fofn.* files
are found there. It's just the phrap_stdout file in it. Nothing else. 

I will post shortened phrap-output below...


I would really appreciate any suggestions/help.
Thanks,
Sam


---------------- Pregap4 Output ------------------------------------
============================================================
Thu 26 Mar 16:36:25 2009: Running modules
------------------------------------------------------------
- General Configuration -
................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................
- Phred -
................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................
- Initialise Experiment Files -
................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................
- Augment Experiment Files -
................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................
- Sequencing Vector Clip -
................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................
- Screen For Unclipped Vector -
............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................
- Cloning Vector Clip -
..........!!..................!!..................!!........................!....!.............!!!........................!!..........................!..............................................................!.!!.....!....!!..........................!!.....!..........!!.....................................................................................!!.........................!!!.!!..........!!!.........................!!......!....................!!!!........!!....!!.............!!..........!!!!!...!!......!!........!...........................!!..................................!!........!!................!!......!!.............!.....!!........!!!..................!................................!..............................!..
Error: sequence entirely cloning vector
                . 
                .
                .
Error: sequence entirely cloning vector
Error: sequence entirely cloning vector
- Phrap assembly -
- Enter assembly (into Gap4) -
============================================================
Thu 26 Mar 16:37:32 2009: open database
------------------------------------------------------------

============================================================
Thu 26 Mar 16:37:32 2009: Terminating modules
------------------------------------------------------------
- Report Production -
Passed files:
    /home/tim/tracefiles/a1202b_001_a01.p1ca.exp (EXP)
    /home/tim/tracefiles/a1202b_001_a01.q1ca.exp (EXP)
                .
                .
                .
    /home/tim/tracefiles/A1202B_004_h11.q1ca.exp (EXP)
    /home/tim/tracefiles/A1202B_004_h12.q1ca.exp (EXP)

Failed files:
    /home/tim/tracefiles/a1202b_001_c03.p1ca.exp (EXP) 'cloning_vector_clip:
sequence entirely cloning vector'
    /home/tim/tracefiles/A1202B_003_f09.q1ca.exp (EXP) 'cloning_vector_clip:
sequence entirely cloning vector'
                .
                .
                .
    /home/tim/tracefiles/A1202B_003_c06.q1ca.exp (EXP) 'cloning_vector_clip:
sequence entirely cloning vector'

- Report from 'Phred' -
SEQ /home/tim/tracefiles/a1202b_001_a01.p1ca..scf: created from
/home/tim/eriks_phrapStuff/tracefiles/a1202b_001_a01.p1ca.scf
                .
                .
                .
SEQ /home/tim/tracefiles/A1202B_004_h12.p1ca..scf: created from
/home/tim/eriks_phrapStuff/tracefiles/A1202B_004_h12.p1ca.scf
SEQ /home/tim/tracefiles/A1202B_004_h12.q1ca..scf: created from
/home/tim/eriks_phrapStuff/tracefiles/A1202B_004_h12.q1ca.scf

- Report from 'Initialise Experiment Files' -
SEQ /home/tim/tracefiles/a1202b_001_a01.p1ca.exp: created from
/home/tim/eriks_phrapStuff/tracefiles/a1202b_001_a01.p1ca..scf
                .
                .
                .
SEQ /home/tim/tracefiles/A1202B_004_h12.p1ca.exp: created from
/home/tim/eriks_phrapStuff/tracefiles/A1202B_004_h12.p1ca..scf
SEQ /home/tim/tracefiles/A1202B_004_h12.q1ca.exp: created from
/home/tim/eriks_phrapStuff/tracefiles/A1202B_004_h12.q1ca..scf

- Report from 'Augment Experiment Files' -
SEQ /home/tim/tracefiles/a1202b_001_a01.p1ca.exp: added fields CF TN PR SI
CH
SEQ /home/tim/tracefiles/a1202b_001_a01.q1ca.exp: added fields CF TN PR SI
CH
                .
                .
                .
SEQ /home/tim/tracefiles/A1202B_004_h12.p1ca.exp: added fields CF TN PR SI
CH
SEQ /home/tim/tracefiles/A1202B_004_h12.q1ca.exp: added fields CF TN PR SI
CH

- Report from 'Sequencing Vector Clip' -
SEQ /home/tim/tracefiles/a1202b_001_a01.p1ca.exp: passed
SEQ /home/tim/tracefiles/a1202b_001_a01.q1ca.exp: passed
                .
                .
                .
SEQ /home/tim/tracefiles/A1202B_004_h12.p1ca.exp: passed
SEQ /home/tim/tracefiles/A1202B_004_h12.q1ca.exp: passed

- Report from 'Screen For Unclipped Vector' -
SEQ /home/tim/tracefiles/a1202b_001_a01.p1ca.exp: passed
SEQ /home/tim/tracefiles/a1202b_001_a01.q1ca.exp: passed
                .
                .
                .
SEQ /home/tim/tracefiles/A1202B_004_e02.p1ca.exp: failed
SEQ /home/tim/tracefiles/A1202B_004_h12.p1ca.exp: failed

- Report from 'Cloning Vector Clip' -
SEQ /home/tim/tracefiles/a1202b_001_a01.p1ca.exp: checked
SEQ /home/tim/tracefiles/a1202b_001_a01.q1ca.exp: checked
                .
                .
                .
SEQ /home/tim/tracefiles/A1202B_004_g07.q1ca.exp: failed (sequence entirely
cloning vector)
SEQ /home/tim/tracefiles/A1202B_004_h11.p1ca.exp: failed (sequence entirely
cloning vector)

- Report from 'Phrap assembly' -
ERR: Failed to execute phrap.
ERR: "
gcphrap -minmatch 12 -minscore 30 -exp /home/tim/tracefiles/pregap.assembly
/home/tim/eriks_phrapStuff/tracefiles/pregap.tmp 
gcphrap version 0.990329
Reading parameters ... 1.008 Mbytes allocated -- total 1.008 Mbytes
Run date:time  090326:163726
 Done
Total space allocated: 1.008 Mbytes; currently free: 1.003 Mbytes in 2
blocks
Reading query file into memory ...............................1.008 Mbytes
allocated -- total 2.016 Mbytes
..............................2.016 Mbytes allocated -- total 4.032 Mbytes
2.016 Mbytes allocated -- total 6.048 Mbytes
......... Done
Total space allocated: 6.048 Mbytes; currently free: 3.802 Mbytes in 7
blocks
Complementing ...2.016 Mbytes allocated -- total 8.064 Mbytes
 Done
Total space allocated: 8.064 Mbytes; currently free: 5.656 Mbytes in 8
blocks
Allocating align_entries ... Done
Total space allocated: 8.064 Mbytes; currently free: 4.962 Mbytes in 8
blocks
Reading quality files ...

NO QUALITY FILE /home/tim/tracefiles/pregap.tmp.qual WAS FOUND. REMAINING
INPUT QUALITIES SET TO 15. Done
Total space allocated: 8.064 Mbytes; currently free: 4.962 Mbytes in 8
blocks
5.040 Mbytes allocated -- total 13.104 Mbytes
Finding words ...
 0  918892
 10  119038
 20  9495
 30  1056
 40  81
 50  9
 60  2
 80  1
 100  1
 410  1
min no. words: 0 at 6
max no. words: 410 at 699050
avg no. words: 0.03.024 Mbytes allocated -- total 16.128 Mbytes
 Done
Total space allocated: 16.128 Mbytes; currently free: 6.077 Mbytes in 10
blocks
592058 words; after pruning: 549923
Sorting words ... Done

12  148721
13  216
14  152
15  127
16  109
17  104
18  95
19  88
20  69
21  68
22  67
23  64
24  59
25  56
26  51
27  48
28  49
29  49
30  48
Finding complement word matches ... Done
Total space allocated: 16.128 Mbytes; currently free: 5.678 Mbytes in 10
blocks
n_cross_matches: 20080
# pass words: 40488, #fail words: 24507
num_cand_pairs: 9060, num_dups: 11020
Finding internal word matches ...  n_same_matches: 20562
, #pass words: 20562, #fail words: 11723 num_cand_pairs: 18357, num_dups:
22285
 Done
Total space allocated: 16.128 Mbytes; currently free: 5.302 Mbytes in 10
blocks
Finding duplicates ...  Done
Total space allocated: 16.128 Mbytes; currently free: 12.249 Mbytes in 11
blocks
SWATTING ....................................... Done
Total space allocated: 16.128 Mbytes; currently free: 11.454 Mbytes in 18
blocks
Quickalign: 9418 successes, 198 failures
36035 SWAT alignments performed. 9428 pairs have score >= 30
Making reversed pairs ... Done
Total space allocated: 16.128 Mbytes; currently free: 11.364 Mbytes in 16
blocks
Finding starts/ends ...  Done
Total space allocated: 16.128 Mbytes; currently free: 11.364 Mbytes in 16
blocks
Total # pairs: 19000, size: 1.064 Mbytes
Finding segments ...  Done
Total space allocated: 16.128 Mbytes; currently free: 11.284 Mbytes in 16
blocks
Finding more vector ...  Done
Total space allocated: 16.128 Mbytes; currently free: 11.284 Mbytes in 16
blocks
Finding mean offsets ...  Done
Total space allocated: 16.128 Mbytes; currently free: 11.284 Mbytes in 16
blocks
Finding near duplicates ...  Done
Total space allocated: 16.128 Mbytes; currently free: 11.284 Mbytes in 16
blocks
Finding self matches ...  Done
Total space allocated: 16.128 Mbytes; currently free: 11.284 Mbytes in 16
blocks
Finding node rejects ...  Done
Total space allocated: 16.128 Mbytes; currently free: 11.284 Mbytes in 16
blocks
Finding truncated pairs ...  Done
Total space allocated: 16.128 Mbytes; currently free: 11.284 Mbytes in 16
blocks
Finding multi-segment reads ...  Done
Total space allocated: 16.128 Mbytes; currently free: 11.284 Mbytes in 16
blocks
Finding starts/ends ...  Done
Total space allocated: 16.128 Mbytes; currently free: 11.284 Mbytes in 16
blocks
Finding deletions ...  Done
Total space allocated: 16.128 Mbytes; currently free: 11.284 Mbytes in 16
blocks
Finding extents ...  Done
Total space allocated: 16.128 Mbytes; currently free: 10.148 Mbytes in 16
blocks
Printing qualities ... Done
Total space allocated: 16.128 Mbytes; currently free: 10.148 Mbytes in 16
blocks
Computing LLR scores ... Done
Total space allocated: 16.128 Mbytes; currently free: 10.148 Mbytes in 16
blocks
Finding extents ...  Done
Total space allocated: 16.128 Mbytes; currently free: 10.148 Mbytes in 16
blocks
Computing LLR scores ... Done
Total space allocated: 16.128 Mbytes; currently free: 10.148 Mbytes in 16
blocks
Printing qualities ... Done
Total space allocated: 16.128 Mbytes; currently free: 10.148 Mbytes in 16
blocks
Printing coverage ... Done
Total space allocated: 16.128 Mbytes; currently free: 10.148 Mbytes in 16
blocks
Finding blocked reads ...  Done
Total space allocated: 16.128 Mbytes; currently free: 10.148 Mbytes in 16
blocks
Merging ...

Pass: 1
#reads  #contigs (not counting singlets)
    1      6
   61      1
   73      1
   76      1
  100      1
  167      1
  172      1

Pass: 3
#reads  #contigs (not counting singlets)
    1      2
   75      1
   76      1
  100      1
  173      1
  229      1

Pass: 4
#reads  #contigs (not counting singlets)
   75      1
  100      1
  174      1
  306      1

Read equivalence class histogram:
    1   92
   47    1
   75    1
   94    1
  174    1
  191    1
 Done
Total space allocated: 16.128 Mbytes; currently free: 9.967 Mbytes in 18
blocks
Merging chimeras ... Done
Total space allocated: 16.128 Mbytes; currently free: 9.967 Mbytes in 18
blocks
Merging other singletons ...
LLR_join_cutoff: -60
 Done
Total space allocated: 16.128 Mbytes; currently free: 9.967 Mbytes in 18
blocks
Finding extents ...  Done
Total space allocated: 16.128 Mbytes; currently free: 10.042 Mbytes in 18
blocks
Making contig sequences ...11.088 Mbytes allocated -- total 27.216 Mbytes

stack depth: 1000
stack depth: 1000
stack depth: 1000
stack depth: 1000 Done
Total space allocated: 27.216 Mbytes; currently free: 20.888 Mbytes in 23
blocks
Aligning reads to contigs ..."
ERR: Aborting assembly.

- Report from 'Enter assembly (into Gap4)' -
ERR: Could not open file /home/tim/tracefiles/pregap.assembly/fofn.
ERR: "couldn't open "fofn": no such file or directory"
ERR: Aborting enter assembly.



                       ***   Processing finished   ***

-- 
View this message in context: http://www.nabble.com/Pregap-Enter_assembly%3A-Couldn%27t-find-pregap.assembly-fofn.-tp22741443p22741443.html
Sent from the staden-package mailing list archive at Nabble.com.

Re: [Staden-package] GAP4 Assembly Error : second sequence too short

From: James B. <jk...@sa...> - 2009-02-23 11:15:14

On Fri, Feb 20, 2009 at 11:49:25AM -0800, Surez wrote:
> >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
> Processing        3 in batch
> File name P001__S101_C.exp
> Reading length    522
> Total matches found     1
> Contig       2 position     366 matches strand  1 at position      23
> Trying to align with contig        2
> Percent mismatch  3.2, pads in contig  0, pads in gel  0
>  Percentage mismatch   3.2
>                344       354       364       374       384       394
>       Consensus  ATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAA
>                   :::::::::::::::::::: ::::::::::::::::::::::::::::::::::::::
>         Reading  -TCAATACATGGATGATTTGTGTGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAA
>                  1        11        21        31        41        51
> 
>                404       414       424       434       444       454
>       Consensus  AAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGATTTACCACACCAGACCAAAAAA
>                  ::::::::::::::::::::::::::: ::::::::::::::::::::::::: ::::::
>         Reading  AAATAGAGGAGCTGAGACAACATCTGT-GAGGTGGGGATTTACCACACCAGAC-AAAAAA
>                 61        71        81        91       101       111
> 
>                464
>       Consensus  CATCAG
>                  ::::::
>         Reading  CATCAG
>                121
> 
> Fri 20 Feb 11:39:11 2009 Failed file P001__S101_C.exp written to error file
> Failed file P001__S101_C.exp written to error file

The fact that it managed to perform an alignment and display it
implies that the alignment matrix is correct. What error code is it
giving in the error file? Gap4 is hideously unfriendly like that as it
just gives a number, but they're listed at:

http://staden.sourceforge.net/manual/gap4_unix_92.html#IDX394

James

-- 
James Bonfield (jk...@sa...) | Hora aderat briligi. Nunc et Slythia Tova
                                  | Plurima gyrabant gymbolitare vabo;
  A Staden Package developer:     | Et Borogovorum mimzebant undique formae,
https://sf.net/projects/staden/   | Momiferique omnes exgrabure Rathi. 


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE.

Re: [Staden-package] GAP4 Assembly Error : second sequence too short

From: Surez <sur...@ce...> - 2009-02-20 19:49:35

Update: I loaded the default score matrix - align_lib_nuc_matrix and still I
have the same problem. It is able to find matches during alignment, I think,
but fails to join the contigs. Here is the extract of the output I get:
---------------------------------
Automatic sequence assembler
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing        1 in batch
File name P001__S101_A.exp
Reading length    571
New reading does not overlap: start a new contig
This gel reading has been given the number        1
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing        2 in batch
File name P001__S101_B.exp
Reading length    469
Total matches found     0
New reading does not overlap: start a new contig
This gel reading has been given the number        2
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing        3 in batch
File name P001__S101_C.exp
Reading length    522
Total matches found     1
Contig       2 position     366 matches strand  1 at position      23
Trying to align with contig        2
Percent mismatch  3.2, pads in contig  0, pads in gel  0
 Percentage mismatch   3.2
               344       354       364       374       384       394
      Consensus 
ATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAA
                  ::::::::::::::::::::
::::::::::::::::::::::::::::::::::::::
        Reading 
-TCAATACATGGATGATTTGTGTGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAA
                 1        11        21        31        41        51

               404       414       424       434       444       454
      Consensus 
AAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGATTTACCACACCAGACCAAAAAA
                 ::::::::::::::::::::::::::: :::::::::::::::::::::::::
::::::
        Reading 
AAATAGAGGAGCTGAGACAACATCTGT-GAGGTGGGGATTTACCACACCAGAC-AAAAAA
                61        71        81        91       101       111

               464
      Consensus  CATCAG
                 ::::::
        Reading  CATCAG
               121

Fri 20 Feb 11:39:11 2009 Failed file P001__S101_C.exp written to error file
Failed file P001__S101_C.exp written to error file
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing        4 in batch
File name P001__S101_D.exp
....
....
Batch finished
       7 sequences processed
       2 sequences entered into database
       0 joins made
       0 joins failed
--------------------------------------------------------------


Surez wrote:
> 
> I am trying to call the auto_assemble() function in gap.dll from a java
> program (Using JNI) to do a Shotgun Assembly. The assembler throws the
> following error:
> 
> Automatic sequence assembler
> Database is logically consistent
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
> Processing        1 in batch
> File name P001__S101_A.exp
> Reading length    571
> Fri 13 Feb 12:05:26 2009 second sequence too short
> Fri 13 Feb 12:05:26 2009 Failed file P001__S101_A.exp written to error
> file
> Failed file P001__S101_A.exp written to error file
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
> 
> This is how I call the auto_assemble() function:
>        GapIO *io;
>        inlist = "P001__S101_A.exp P001__S101_B.exp P001__S101_C.exp
> P001__S101_D.exp    P001__S101_F.exp P001__S101_G.exp P001__S101_H.exp";
> 	int option = 1;
> 	int entry = 1;
> 	int disp_mode = 1;
> 	int min_ini_match = 20;
> 	int min_ovr = 0;
> 	int max_pad = 25;
> 	float max_pert_mis = 5.0;
> 	int align = 1;
> 	int joins = 1;
> 	int fail_mode = 1;
> 	int win_size = 0;
> 	int max_dash = 0;
> 	int ignore_prev = 1;
> 	float consensus_cutoff = 0;
> 	int status;
> 	int access = 0;
> 	io = open_db("vsdb", "0", &status, 0, access);
> 
> 	int handle = get_free_handle(io);
>        
>        ret = auto_assemble(handle, inlist, option, entry, disp_mode,
> min_ini_match, min_ovr, max_pad, max_pert_mis, align, joins, fail_mode,
> win_size, max_dash, ignore_prev, consensus_cutoff);
> 
> ----
> Can someone help me in solving this error.
> 
> Thanks in advance,
> Surez
> 
> 

-- 
View this message in context: http://www.nabble.com/GAP4-Assembly-Error-%3A-second-sequence-too-short-tp22004232p22126053.html
Sent from the staden-package mailing list archive at Nabble.com.

Re: [Staden-package] GAP4 Assembly Error : second sequence too short

From: Surez <sur...@ce...> - 2009-02-18 00:55:48

It helped a bit. I included the initialisation steps and I got a different
error now. It seems there is some problem with the alignment. Here is the
output that I get now:
----------------------
Automatic sequence assembler
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing        1 in batch
File name P001__S101_A.exp
Reading length    571
New reading does not overlap: start a new contig
This gel reading has been given the number        1
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing        2 in batch
File name P001__S101_B.exp
Reading length    469
Total matches found     0
New reading does not overlap: start a new contig
This gel reading has been given the number        2
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing        3 in batch
File name P001__S101_C.exp
Reading length    522
Total matches found     1
Contig       2 position     366 matches strand  1 at position      23
Trying to align with contig        2
Tue 17 Feb 16:47:04 2009 Failed file P001__S101_C.exp written to error file
Failed file P001__S101_C.exp written to error file
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing        4 in batch
File name P001__S101_D.exp
Reading length    482
Total matches found     2
Contig       1 position     343 matches strand  1 at position     169
Contig       2 position      32 matches strand  1 at position     427
Trying to align with contig        1
Trying to align with contig        2
Tue 17 Feb 16:47:04 2009 Failed file P001__S101_D.exp written to error file
Failed file P001__S101_D.exp written to error file
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing        5 in batch
File name P001__S101_F.exp
Reading length    514
Total matches found     1
Contig       1 position       2 matches strand -1 at position     184
Trying to align with contig        1
Tue 17 Feb 16:47:04 2009 Failed file P001__S101_F.exp written to error file
Failed file P001__S101_F.exp written to error file
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing        6 in batch
File name P001__S101_G.exp
Reading length    520
Total matches found     2
Contig       1 position     343 matches strand -1 at position     117
Contig       2 position      32 matches strand -1 at position     375
Trying to align with contig        1
Trying to align with contig        2
Tue 17 Feb 16:47:04 2009 Failed file P001__S101_G.exp written to error file
Failed file P001__S101_G.exp written to error file
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing        7 in batch
File name P001__S101_H.exp
Reading length    496
Total matches found     1
Contig       2 position     185 matches strand -1 at position       1
Trying to align with contig        2
Tue 17 Feb 16:47:04 2009 Failed file P001__S101_H.exp written to error file
Failed file P001__S101_H.exp written to error file
Batch finished
       7 sequences processed
       2 sequences entered into database
       0 joins made
       0 joins failed
-------------------------------------
I am not sure if I have to create (and Load) the Score Matrix before I call
the assemble function.
I will try that.

Many Thanks,
Surez


James Bonfield wrote:
> 
> On Fri, Feb 13, 2009 at 12:27:18PM -0800, Surez wrote:
>> I am trying to call the auto_assemble() function in gap.dll from a java
>> program (Using JNI) to do a Shotgun Assembly. The assembler throws the
>> following error:
>> 
>> Automatic sequence assembler
>> Database is logically consistent
>> >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
>> Processing        1 in batch
>> File name P001__S101_A.exp
>> Reading length    571
>> Fri 13 Feb 12:05:26 2009 second sequence too short
>> Fri 13 Feb 12:05:26 2009 Failed file P001__S101_A.exp written to error
>> file
>> Failed file P001__S101_A.exp written to error file
>> >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
> 
> Ugh it's been years since I looked at the assembly code. It's actually
> still mostly in FORTRAN for good measure too.
> 
>>From what i recall though you'll need to call several initialisation
> functions first which setup various lookup tables. (Eg converting ACGT
> to 0123, etc). I can't recall which are needed for assembly, but see
> the init_globals() function. This is part of the Tcl module
> initialisation so it's not applicable for you, but you could rip out
> the same calls. The most useful ones are probably these:
> 
>     int idm = 5;
>     set_char_set(1);    /* 1 == DNA */
>     set_dna_lookup(); 	/* general lookup and complementing */
>     set_iubc_lookup();	/* iubc codes for restriction enzymes */
>     set_hash8_lookupn();	/* used by word8 hashing */
>     set_mask_lookup();  /* used to mask/mark consensus */
>     init_genetic_code();
>     inits_();		/* fortran stuff */
>     initlu_(&idm);	/* fortran stuff */
> 
> The last two setup various tables in the fortran code so are the two
> most likely to be directly related to failure of the auto assembly
> function. Whether you can call Fortran directly from JNI I've no idea!
> The argument is 5 (ACGTN) of 26 (amina acid chars), but it has to be
> passed by reference. Even literals are passed that way to fortran.
> 
> James
> -- 
> James Bonfield (jk...@sa...) | Hora aderat briligi. Nunc et Slythia
> Tova
>                                   | Plurima gyrabant gymbolitare vabo;
>   A Staden Package developer:     | Et Borogovorum mimzebant undique
> formae,
> https://sf.net/projects/staden/   | Momiferique omnes exgrabure Rathi. 
> 
> 
> -- 
>  The Wellcome Trust Sanger Institute is operated by Genome Research 
>  Limited, a charity registered in England with number 1021457 and a 
>  company registered in England with number 2742969, whose registered 
>  office is 215 Euston Road, London, NW1 2BE. 
> 
> ------------------------------------------------------------------------------
> Open Source Business Conference (OSBC), March 24-25, 2009, San Francisco,
> CA
> -OSBC tackles the biggest issue in open source: Open Sourcing the
> Enterprise
> -Strategies to boost innovation and cut costs with open source
> participation
> -Receive a $600 discount off the registration fee with the source code:
> SFAD
> http://p.sf.net/sfu/XcvMzF8H
> _______________________________________________
> Staden-package mailing list
> Sta...@li...
> https://lists.sourceforge.net/lists/listinfo/staden-package
> 
> 

-- 
View this message in context: http://www.nabble.com/GAP4-Assembly-Error-%3A-second-sequence-too-short-tp22004232p22070015.html
Sent from the staden-package mailing list archive at Nabble.com.

Re: [Staden-package] GAP4 Assembly Error : second sequence too short

From: James B. <jk...@sa...> - 2009-02-16 09:49:21

On Fri, Feb 13, 2009 at 12:27:18PM -0800, Surez wrote:
> I am trying to call the auto_assemble() function in gap.dll from a java
> program (Using JNI) to do a Shotgun Assembly. The assembler throws the
> following error:
> 
> Automatic sequence assembler
> Database is logically consistent
> >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
> Processing        1 in batch
> File name P001__S101_A.exp
> Reading length    571
> Fri 13 Feb 12:05:26 2009 second sequence too short
> Fri 13 Feb 12:05:26 2009 Failed file P001__S101_A.exp written to error file
> Failed file P001__S101_A.exp written to error file
> >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

Ugh it's been years since I looked at the assembly code. It's actually
still mostly in FORTRAN for good measure too.

>From what i recall though you'll need to call several initialisation
functions first which setup various lookup tables. (Eg converting ACGT
to 0123, etc). I can't recall which are needed for assembly, but see
the init_globals() function. This is part of the Tcl module
initialisation so it's not applicable for you, but you could rip out
the same calls. The most useful ones are probably these:

    int idm = 5;
    set_char_set(1);    /* 1 == DNA */
    set_dna_lookup(); 	/* general lookup and complementing */
    set_iubc_lookup();	/* iubc codes for restriction enzymes */
    set_hash8_lookupn();	/* used by word8 hashing */
    set_mask_lookup();  /* used to mask/mark consensus */
    init_genetic_code();
    inits_();		/* fortran stuff */
    initlu_(&idm);	/* fortran stuff */

The last two setup various tables in the fortran code so are the two
most likely to be directly related to failure of the auto assembly
function. Whether you can call Fortran directly from JNI I've no idea!
The argument is 5 (ACGTN) of 26 (amina acid chars), but it has to be
passed by reference. Even literals are passed that way to fortran.

James
-- 
James Bonfield (jk...@sa...) | Hora aderat briligi. Nunc et Slythia Tova
                                  | Plurima gyrabant gymbolitare vabo;
  A Staden Package developer:     | Et Borogovorum mimzebant undique formae,
https://sf.net/projects/staden/   | Momiferique omnes exgrabure Rathi. 


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE.

[Staden-package] GAP4 Assembly Error : second sequence too short

From: Surez <sur...@ce...> - 2009-02-13 20:27:22

I am trying to call the auto_assemble() function in gap.dll from a java
program (Using JNI) to do a Shotgun Assembly. The assembler throws the
following error:

Automatic sequence assembler
Database is logically consistent
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing        1 in batch
File name P001__S101_A.exp
Reading length    571
Fri 13 Feb 12:05:26 2009 second sequence too short
Fri 13 Feb 12:05:26 2009 Failed file P001__S101_A.exp written to error file
Failed file P001__S101_A.exp written to error file
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

This is how I call the auto_assemble() function:
       GapIO *io;
       inlist = "P001__S101_A.exp P001__S101_B.exp P001__S101_C.exp
P001__S101_D.exp    P001__S101_F.exp P001__S101_G.exp P001__S101_H.exp";
	int option = 1;
	int entry = 1;
	int disp_mode = 1;
	int min_ini_match = 20;
	int min_ovr = 0;
	int max_pad = 25;
	float max_pert_mis = 5.0;
	int align = 1;
	int joins = 1;
	int fail_mode = 1;
	int win_size = 0;
	int max_dash = 0;
	int ignore_prev = 1;
	float consensus_cutoff = 0;
	int status;
	int access = 0;
	io = open_db("vsdb", "0", &status, 0, access);

	int handle = get_free_handle(io);
       
       ret = auto_assemble(handle, inlist, option, entry, disp_mode,
min_ini_match, min_ovr, max_pad, max_pert_mis, align, joins, fail_mode,
win_size, max_dash, ignore_prev, consensus_cutoff);

----
Can someone help me in solving this error.

Thanks in advance,
Surez

-- 
View this message in context: http://www.nabble.com/GAP4-Assembly-Error-%3A-second-sequence-too-short-tp22004232p22004232.html
Sent from the staden-package mailing list archive at Nabble.com.

[Staden-package] Error when running prefinish

From: Simon A. <sim...@bb...> - 2008-01-24 09:37:24

I'm trying to use the prefinish option to generate a set of primers  
to help close my assembly.  However when I run the prefinish option  
in gap4 I get the following error:

Thu 24 Jan 09:32:45 2008 prefinish: extra characters after close-brace
     while executing
"proc finishing_rules {bits} {
"
     (file "/tmp/prefinish25233_0.script" line 8)

This is using gap 4.9 on fedora 8.

Unfortunately the temp script seems to be cleared up after the  
failure so I can't see the full script to tell what's happened.

Any ideas as to how I can fix this?

Cheers

Simon.

Re: [Staden-package] Problems with staden-linux-x86_64-1-7-1b

From: Bastien C. <ba...@ch...> - 2008-01-17 21:05:29

On Thursday 17 January 2008 14:09, Carlos Canchaya wrote:
> you can find below the output of gap4.
> would I need to install other system software? I am using opensuse 10.3
> and I can't find libg2c of gcc-g77 because g77 was replaced by gfortran
> wich does not incluede libg2c. libgfortran replaced
> libg2c and in installed as a dependency when you install gcc42-fortran.
> Could there be a solution for this?

You should find and install the "compat-g77" package in YAST, then all is well 
(at least on my 10.2, I don't have a 10.3 at hand at the moment).

Regards,
  Bastien

Re: [Staden-package] Problems with staden-linux-x86_64-1-7-1b

From: Carlos C. <cca...@gm...> - 2008-01-17 13:09:21

Hi James,

you can find below the output of gap4.
would I need to install other system software? I am using opensuse 10.3
and I can't find libg2c of gcc-g77 because g77 was replaced by gfortran
wich does not incluede libg2c. libgfortran replaced 
libg2c and in installed as a dependency when you install gcc42-fortran.

Could there be a solution for this?

Regards,

Carlos



Carlos

--------------------------------
carlos@auki:~> gap4
load libcopy_reads.so => couldn't load file "libcopy_reads.so":
libg2c.so.0: cannot open shared object file: No such file or directory
load libitcl3.3.so =>
load libitk3.3.so =>
load libiwidgets.so => couldn't load file "libiwidgets.so":
libiwidgets.so: cannot open shared object file: No such file or
directory
load libcap2.so =>
load libcap3.so =>
load libfak2.so =>
load libphrap.so =>
load libhaplo.so => couldn't load file "libhaplo.so": libg2c.so.0:
cannot open shared object file: No such file or directory
load libgap.so => couldn't load file "libgap.so": libg2c.so.0: cannot
open shared object file: No such file or directory
invalid command name "load_alignment_matrix"
    while executing
"load_alignment_matrix       [keylget gap_defs ALIGNMENT.MATRIX_FILE]"
    (file "/usr/local/share/staden/linux-x86_64-bin/../lib/gap/gap.tcl"
line 683)




On Thu, 2008-01-17 at 10:18 +0000, James Bonfield wrote:
> On Thu, Jan 17, 2008 at 11:12:46AM +0100, Carlos Canchaya wrote:
> > ---------------------------------------- 
> >  
> > invalid command name "load_alignment_matrix" 
> > while executing 
> > "load_alignment_matrix [keylget gap_defs ALIGNMENT.MATRIX_FILE]" 
> > (file "/usr/local/share/staden/linux-x86_64-bin/../lib/gap/gap.tcl"
line
> > 683) 
> > ---------------------------------------------

Re: [Staden-package] Problems with staden-linux-x86_64-1-7-1b

From: James B. <jk...@sa...> - 2008-01-17 10:18:09

On Thu, Jan 17, 2008 at 11:12:46AM +0100, Carlos Canchaya wrote:
> ---------------------------------------- 
>  
> invalid command name "load_alignment_matrix" 
> while executing 
> "load_alignment_matrix [keylget gap_defs ALIGNMENT.MATRIX_FILE]" 
> (file "/usr/local/share/staden/linux-x86_64-bin/../lib/gap/gap.tcl" line
> 683) 
> --------------------------------------------- 

This typically means a library is missing somewhere. Try setting the
STADEN_DEBUG environment variable to 1 and see what it claims. It'll
whinge about some libraries not being found that never needed to exist
anyway, but hopefully some more system related thing - libcurl, png,
or some such - will show up.

James

-- 
James Bonfield (jk...@sa...) | Hora aderat briligi. Nunc et Slythia Tova
                                  | Plurima gyrabant gymbolitare vabo;
  A Staden Package developer:     | Et Borogovorum mimzebant undique formae,
https://sf.net/projects/staden/   | Momiferique omnes exgrabure Rathi. 


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE.

[Staden-package] Problems with staden-linux-x86_64-1-7-1b

From: Carlos C. <cca...@gm...> - 2008-01-17 10:12:52

Hi, 
 
I've installed today the latest X68_64 version
(http://downloads.sourceforge.net/staden/staden-linux-x86_64-1-7-1b.tar.gz?modtime=1200398338&big_mirror=0). 


However I receive an error message when trying to open a database: 
 
---------------------------------------- 
 
invalid command name "load_alignment_matrix" 
while executing 
"load_alignment_matrix [keylget gap_defs ALIGNMENT.MATRIX_FILE]" 
(file "/usr/local/share/staden/linux-x86_64-bin/../lib/gap/gap.tcl" line
683) 
--------------------------------------------- 
 
pregap4 works fine by the way... 
 
 
Does any one succeded to install it?
 
Regards, 
 
Carlos

[Staden-package] STADEN_QUAD6600_GUTSY.tar.gz

From: Eyal <ser...@ag...> - 2008-01-03 14:40:15

The staden-src-1-7-0 compiled successfully under AMD 64bit Ubuntu 7.10
(gutsy) on  a system with Intel (R) Core(TM)2 Quad CPU.

This was not a simple task but Adam Sj=C3=B8gren's patch is a good starting
point... Thank you Adam.=20

Binaries are downloadable at:
http://cowry.agri.huji.ac.il/STADEN_QUAD6600_GUTSY.tar.gz

--=20
View this message in context: http://www.nabble.com/STADEN_QUAD6600_GUTSY.t=
ar.gz-tp14598049p14598049.html
Sent from the staden-package mailing list archive at Nabble.com.

[Staden-package] Or solexa for that matter...

From: Marcus C. <mcl...@bi...> - 2007-03-29 09:25:35

Hi again,

In addition to the email I just sent about including 454 sequences, I
wonder if anyone has experience from including Solexa reads in Staden?
Or if it's possible at all to use these short reads in Gap/Pregap?

Cheers,
Marcus

[Staden-package] Hos easy is it to include 454 reads in Gap4?

From: Marcus C. <mcl...@bi...> - 2007-03-28 16:14:47

Hello, 
 
I have an assembly in Gap4 (from the latest Staden version 1.7)
consisting of 10,000 fosmid reads and want to complement it with a large
number of 454 reads. I have read that Staden can read this new file
format, but also that phrap isn't good at assembling them.

My question is, can I without too much problems, process the 454 reads
in Pregap4 using e.g. RepeatMasker and Phrap, and then appending them to
the existing Gap database?
 
If there are major difficulties assembling them into an existing Gap4
database, or if other non-Staden software is needed, I need to know this
before I order the sequences. 
 
Many thanks in advance! 
 
Marcus

[Staden-package] Building Staden on Linux x86_64

From: Andreas W. <and...@eb...> - 2007-02-19 08:50:31

Attachments: make.out

Dear all,

I've tried to compile the 1.7.0 release and yesterdays cvs on a Linux x86_64 
system with GCC 4.1.1 and gfortran, or GCC 3.4 and g77. With some minor 
tweaks in makefiles, I can compile all the packages in Makefile.thirdparty, 
but I can not compile the staden packages; compilation halts on the fortran 
code in gap4. This is occurs on a Debian and on a Frugalware system.

I here attach the make.out file.

Very happy for input on this problem!

Best regards,
Andreas

[Staden-package] Building on x86_64

From: Michael M. US-H. <Mic...@op...> - 2007-01-12 21:32:34

Greetings

I'm trying to build the io library on Pentium with 64-bit extension
RedHat E4 machine (uname -m =3D x86_64). There's nothing in the
configure.guess file that looks appropriate, and everything I've tried
(that will build) produces a library that generates alignment errors
when I try to link to it. Can anyone offer any suggestions how to fool
the automaker or how to modify the configure files?

Thanks

Mike

[Staden-package] "Suggest Primers" function and quality primers

From: <Sq...@we...> - 2007-01-05 08:32:54

Hello,

New Year, new Problem ;)

I was looking for a function which designs me some walk and quality primer=
s on my assembly.
The "Suggest Primers" functions seems to do what I need.

Reading the manual says:
"The purpose of this function (which is available from the gap4 Experiment=
s menu) is to suggest custom primer experiments to extend and "double stra=
nd" contigs. First the routine finds regions of contigs with data on only =
one strand. Then it selects templates and primers, which if used in sequen=
cing experiments, would produce data to cover these single stranded region=
s."

Sounds good and works really fine for walk primer design but not a single =
quality primer is created.

So I removed selective some readings to be sure to have a single stranded =
area. This region is about 100 bases long but again no quality primer was =
created.

Is there some hidden Parameter I missed or should single stranded area be =
longer=3F
I would be glad if you could point me into the right direction.

Thank you.


With kind regards

Stefan Kesberg
=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F
Viren-Scan f=FCr Ihren PC! Jetzt f=FCr jeden. Sofort, online und kostenlos.
Gleich testen! http://www.pc-sicherheit.web.de/freescan/=3Fmc=3D022222

Re: [Staden-package] Problems with "add_tags" (pregap scripting)

From: Stefan K. <Sq...@we...> - 2006-12-06 12:36:26

Hello,

Finally I was able to solve my problem.

The "find=5Fprimers" result includes some confusing start positions for prim=
er in "-" directions. By example the primer tag is set at position 42 on t=
he reading, in the result list the start position for this primer is state=
d with 1592. The trick is to count from right side of reading, reading len=
gth - 1592 results in 42.
Ok, solved one misunderstanding.

But "add=5Ftags" refused to work with this new list.

So I came over with a workaround. Instead of calling "add=5Ftags" after my l=
oop which creates a big list of tags to add I call "add=5Ftags" now in every=
 loop with the values for the current tag to add.
Not the best  solution, but now it works.

It seems as if I'm not able to build a proper Tcl list which "add=5Ftags" ac=
cepts.


Thank you for your hints and help.


With best regards,

Stefan Kesberg
=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=
=5F=5F=5F=5F
"Ein Herz f=FCr Kinder" - Ihre Spende hilft! Aktion: www.deutschlandsegelt.d=
e
Unser Dankesch=F6n: Ihr Name auf dem Segel der 1. deutschen America's Cup-Ya=
cht!

1 message has been excluded from this view by a project administrator.

Flat | Threaded

1 2 3 > >> (Page 1 of 3)