new299 - 2006-07-21

I'm having a problem with pregap4. It only seems to load 19 sequences from my fasta files. My fasta files looks like this:

>R0
CCAATTAGTCCTATTAAGAC

>R1
CAATTAGTCCTATTAAGACT

>R2
AATTAGTCCTATTAAGACTG

>R3
ATTAGTCCTATTAAGACTGT

However if I include any more than 19 sequences in my fasta file I get the following error:

Failed files:
    /home/new/A1.fasta (UNK) 'init: Unknown file type'

Am I doing something wrong? As a work around I'm dividing my sequences in to separate files, but it would be nice to load them directly.

Also, I could do with some guidance with the GAP4 Assembler. Do the "Maximum consensus length" and "Maximum database size" settings have any effect on the reassembled sequence, or are they purely used for memory allocation?

GAP4 looks to be a very capable tool, I look forward to getting to grips with it.

Many Thanks,

Nava Whiteford
University of Southampton